|
|
||||||||
Animal: DNA Viruses |
Medical Research Council Virology Unit, Church Street, Glasgow G11 5JR, UK1
The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104, USA2
Author for correspondence: Chris Preston. Fax +44 141 337 2236. e-mail c.preston{at}vir.gla.ac.uk
| Abstract |
|---|
|
|
|---|
-galactosidase expression from a range of viral IE promoters when mice were analysed at 4 days postinoculation. At later times, expression of pp71 resulted in a reduction in numbers of neurons containing
-galactosidase, indicating cytotoxicity or promoter shutoff. The HSV-1 latency-active promoter was not responsive to pp71, demonstrating specificity in the activity of the protein. Pp71 was as active in mice lacking both copies of the PML gene (PML-/-) as in control animals, and in PML-/- fibroblasts pp71 stimulated gene expression as effectively as in other cell types. Therefore, neither the PML protein nor the normal ND10 structure is necessary for pp71 to stimulate gene expression. | Introduction |
|---|
|
|
|---|
The human cytomegalovirus (HCMV) tegument phosphoprotein pp71, encoded by gene UL82, appears to be a functional counterpart of VP16. In transfection assays, expression of pp71 stimulates transcription from the HCMV major IE promoter and from heterologous promoters (Liu et al., 1992
; Baldick et al., 1997
; Chau et al., 1999
). Protein pp71 also exerts a general influence on gene expression since it increases the infectivity of transfected HCMV DNA through an effect that is separable from increased IE protein production (Baldick et al., 1997
). An HCMV mutant that lacks the pp71 coding sequences initiates infection poorly at low m.o.i., exhibiting a phenotype similar to that of HSV-1 strains deficient for VP16 function (Bresnahan & Shenk, 2000
). In a separate approach to studying pp71, an HSV-1 recombinant named in1324 was constructed (Homer et al., 1999
). The parental virus for in1324 was in1312, an HSV-1 mutant containing three mutations: an insertion that inactivates transactivation by VP16, a deletion that abrogates the function of the IE protein ICP0, and a temperature sensitive mutation that renders a major transcription factor, the IE protein ICP4, non-functional at temperatures greater than 38 °C (Preston et al., 1998
). The three proteins that are crucial for HSV-1 transcription are functionally impaired, and as a consequence the in1312 genome is converted to a repressed, quiescent state within the first few hours after infection (Preston & Nicholl, 1997
; Samaniego et al., 1998
). These features enable in1312 to be used as a vector, in which an inserted foreign gene is expressed transiently and is dependent on the intrinsic strength of the promoter controlling it. A cassette containing the HCMV UL82 coding sequences, controlled by the HCMV major IE promoter, was inserted into the in1312 genome to yield in1324, a virus that produces pp71 in infected cells (Homer et al., 1999
). Since in1312 can infect a wide range of cells in culture, the recombinant provides a means of producing pp71 in a variety of cell types. By use of in1324, it was shown that many viral promoters, themselves cloned into in1312, are activated by pp71 (Homer et al., 1999
). In addition expression of the adenovirus virus associated RNA I (VAI) was stimulated by pp71. The observation that the responsive promoters contain no obvious sequence homologies, together with the fact that VAI is transcribed by RNA polymerase III rather than polymerase II, indicates that pp71 is able to activate expression from a wide range of promoters when they are present in the HSV-1 genome.
In its broad promoter specificity pp71 resembles the HSV-1 IE protein ICP0, which increases expression from viral and cellular promoters indiscriminately in cotransfection assays. ICP0 is crucial for the onset of HSV-1 gene expression after infection of tissue culture cells at low m.o.i. (reviewed by Everett, 2000a
). Although ICP0 stimulates expression from all classes of promoter within the HSV-1 genome, it does not function as a classical transcription factor. ICP0 locates to and disrupts cellular nuclear domain 10 (ND10) structures and centromeres within the cell nucleus, due at least in part to stimulating the degradation of the ND10 proteins promyelocytic leukaemia (PML) and Sp100, and the centromere proteins CENP-A and CENP-C (Everett & Maul, 1994
; Maul & Everett, 1994
; Everett et al., 1999
; Lomonte et al., 2001
). Input HSV-1 DNA is located at ND10 (Ishov & Maul, 1996
; Maul & Everett, 1996
), and disruption of ND10 by ICP0 correlates strongly with activation of the viral gene expression programme (Everett et al., 1998a
, b
). HCMV DNA localizes to ND10 (Ishov et al., 1997
), and disruption of the structures during HCMV infection is achieved primarily by expression of the IE72 protein (Kelly et al., 1995
; Korioth et al., 1996
; Ahn & Hayward, 1997
; Ishov et al., 1997
; Wilkinson et al., 1998
).
In the studies described here, we investigated further the properties of pp71 and its functional similarity to ICP0 using in1312-based recombinants. We took a novel approach to investigation of pp71 function, namely the inoculation into mice, via the footpad, of in1324 together with an in1312-based recombinant containing the indicator gene lacZ. Gene expression was examined by histochemical staining for
-galactosidase activity in dorsal root ganglion (DRG) cells. Our previous studies showed that a foreign gene product (Cre recombinase) synthesized in neurons can act in trans during the first few days after inoculation, and that replication of in1312-based viruses is not detectable at the mouse body temperature (Rinaldi et al., 1999
; Marshall et al., 2000
). When HSV-1 is inoculated into mice, the virus eventually becomes latent in sensory neurons and thus a long term interaction is established. Expression from the HSV-1 latency-active region, which specifies the latency-associated transcript (LAT), can be monitored by the use of a construct in which the
-geo gene (a fusion of lacZ and neomycin phosphotransferase coding sequences) with an encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES) immediately upstream is inserted into the LAT transcription unit. This construct has been shown to direct expression of
-galactosidase with latent kinetics when cloned into the genomes of wild-type HSV-1 or in1312 (Lachmann & Efstathiou, 1997
; Marshall et al., 2000
).
We describe here the use of tissue culture and in vivo assays to investigate the activity of pp71 and its interaction with cellular ND10 structures.
| Methods |
|---|
|
|
|---|
Cells.
Plasmids.
Plasmid pCP7991 was produced by cloning a 700 bp AccIHindIII fragment from pJ 7
containing the simian CMV (SCMV) IE promoter (Morgenstern & Land, 1990
) upstream of the E. coli lacZ coding sequences in place of the HCMV IE promoter in plasmid pMJ101 (Nicholl & Preston, 1996
). Plasmid pAR37 was constructed from pCP43937 (Homer et al., 1999
), which contains the pp71 coding sequences, controlled by the HCMV major IE promoter, embedded in the HSV-1 TK coding region. A double-stranded oligonucleotide (top strand: 5' AGCTTCCATGGGCCATCATCATCATCATCATGGCCTGGTTCCGCGTGGATCCGG), with 4 bp extensions compatible with HindIII sites (5'end) or NcoI sites (3'end) was cloned into a plasmid containing pp71 coding sequences with the initiator ATG sequences changed to CCATGG, an NcoI site. A fragment with six N-terminal histidines [(his)6] fused to the pp71 coding region was cloned into pCP1802 (Homer et al., 1999
) to yield plasmid pAR37, in which the (his)6pp71 protein was controlled by the HCMV major IE promoter and embedded in the HSV-1 TK coding region. DNA sequencing confirmed that the oligonucleotide was inserted correctly. Plasmid pCP74126 was constructed by inserting a 380 bp TaqIEcoRV fragment containing the promoter for the HSV-1 UL48 (VP16) gene (Dalrymple et al., 1985
) upstream of lacZ in pMJ27 (Jamieson et al., 1995
). The resultant plasmid, pCP74126, contains lacZ controlled by the early/late UL48 promoter, embedded in the TK coding region. Plasmid pYFPpp71 was constructed by inserting pp71 coding sequences in the SmaI site of pEYFP-C1 (Clontech), such that a yellow fluorescent protein (YFP)pp71 fusion protein was produced. The sequences encoding the fusion protein were cloned as an AgeINotI fragment into pCP1802 to yield pMJ129, in which the YFPpp71 protein was controlled by the HCMV major IE promoter and embedded in the HSV-1 TK coding region
Viruses.
HSV-1 (strain 17) mutants in1312, in1324, in1372, in1382, in1383 and in1388 have been described previously (Preston et al., 1998
; Homer et al., 1999
; Rinaldi et al., 1999
; Preston & McFarlane, 1998
; Marshall et al., 2000
). Mutant in1357 was constructed by cotransfecting ScaI-cleaved pCP7991 with in1312 DNA. Thymidine kinase (TK)-deficient plaques that expressed
-galactosidase were purified, and an isolate containing no detectable parental virus when analysed by Southern hybridization was named in1357. Mutants in1316 and in1320 were constructed from pMJ129 and pAR37, respectively. ScaI-cleaved plasmids were cotransfected with in1312 DNA, TK-deficient plaques were purified, and isolates containing no detectable parental genomes by Southern hybridization were named in1316 and in1320. Virus dl1403/48lacZ was constructed by cotransfection of ScaI-cleaved pCP74126 with dl1403 DNA (Stow & Stow, 1986
). Plaque isolates that were TK negative and expressed
-galactosidase were analysed by Southern hybridization, and an isolate containing no parental DNA was purified and named dl1403/48lacZ. The inserted sequences of the in1312-based mutants used in the studies described here are summarized in Table 1
. Titres of in1312-based recombinants are expressed here as the value on baby hamster kidney clone 13 cells at 31 °C, in the presence of 3 mM hexamethylene bisacetamide (HMBA) (McFarlane et al., 1992
). This value underestimates the potential number of infectious units by a factor of approximately 50 due to the ICP0 mutation. The titre of dl1403/48lacZ was determined after fixing cells and staining with 5-bromo-4-chloro-3-indolyl
-D-galactoside (X-Gal), as described previously (Jamieson et al., 1995
).
|
Immunofluorescence.
Immunoblot analysis.
Proteins in cell extracts were analysed as described by Everett et al. (1999)
. Detection was achieved by use of mouse monoclonal anti-polyHistidine peroxidase-conjugated antibody diluted 1:1000 or rabbit anti-GFP serum (Abcam) diluted 1:1000 and processing for enhanced chemiluminescence.
Transfection.
Cell monolayers on coverslips were transfected with 0·2 µg of plasmid DNA, using Lipofectamine (Life Technologies) as carrier according to the manufacturer's instructions. Monolayers were fixed and processed for immunofluorescence at 6 h after transfection.
Inoculation of mice.
Female BALB/c mice, 45 weeks old, were inoculated in the footpad as described previously (Marshall et al., 2000
). Control or homozygous PML null mutant (PML-/-) mice (Wang et al., 1998a
), both strain 129Sv, were used at 46 weeks old and in these cases, due to variability in the breeding of animals, both males and females were used. Preliminary experiments showed that there were no significant differences in HSV-1 gene expression between males and females, and within the age range taken. Lumbar 3, 4 and 5 dorsal root ganglia (DRG) were dissected and stained with to X-Gal reveal
-galactosidase expressing cells, as described previously (Marshall et al., 2000
).
Assay for pp71 activity.
Activation of gene expression was determined as described by Homer et al. (1999)
. Monolayers were infected with in1312 derivatives that express pp71, incubated at 38·5 °C for 3 h, and infected with in1382. After a further 5 h at 38·5 °C, cell extracts were made and assayed for
-galactosidase activity, using 4-methylumbelliferyl
-D-galactoside as substrate (Preston & Nicholl, 1997
).
| Results |
|---|
|
|
|---|
|
|
Mice (BALB/c) were inoculated via the footpad with mixtures containing equal amounts of in1382 and either in1324 or in1372, and after 4 days ganglia were removed and stained for
-galactosidase activity. As shown in Fig. 2
and Table 3
, co-inoculation of in1324 resulted in a 4- to 5-fold increase in the numbers of positive neurons in fixed whole mounts of DRG, compared with the numbers observed upon co-inoculation of in1372. The same degree of increase was observed when in1357, in which the SCMV IE promoter controls lacZ, was co-inoculated with in1324 (Fig. 2
and Table 3
). In the case of in1383, in which the HSV-1 ICP0 promoter controls lacZ expression, no
-galactosidase-expressing neurons were detected when the virus was inoculated alone (results not shown) or with in1372, but when in1324 was co-inoculated approximately 18 positive neurons per mouse were observed (Fig. 2
and Table 3
). The presence of in1324 enabled detection of expression from the ICP0 promoter, an element that is not strong enough to give detectable
-galactosidase production in DRG neurons. Therefore, as in tissue culture cells, the expression of pp71 increased expression from herpesviral IE promoters when they were present in the in1312 genome.
|
|
-geo controlled by the HSV-1 latent promoter, with the EMCV IRES present to enable translation of
-galactosidase (Lachmann & Efstathiou, 1997
-galactosidase expression, in terms of numbers of positive neurons, was essentially maximal upon injection of 2x105 p.f.u. of in1388 (the amount of in1382, in1357 and in1383 used in the studies described here; Table 3The finding that co-inoculation of in1324 increased expression from the IE promoters tested raised the interesting possibility that pp71 may be able to improve long-term expression during HSV-1 latency in neurons. Ganglia were therefore examined at 42 days postinoculation, a time when HSV-1 is latent. In mice that received in1372 and either in1382 or in1357, the numbers of positive neurons observed were equivalent at 4 and 42 days, as previously found with the HCMV IE promoter in in1382 (K. R. Marshall & C. M. Preston, unpublished observations). By contrast, co-inoculation of in1357 and in1324, or co-inoculation of in1382 and in1324, resulted in 18- or 32-fold decreases, respectively, in the numbers of positive neurons compared with the 4 day values. Therefore, although expression of pp71 stimulated promoter activity in the short term, during latency it had a negative effect that was presumably due either to loss of neurons or promoter shutoff.
HCMV pp71 is active in the absence of PML
A transgenic homozygous mouse strain null for PML has been produced (Wang et al., 1998a
). The availability of this strain provided an opportunity to investigate whether PML is required for the activity of pp71, a possibility in view of the colocalization of the two proteins in tissue culture cells. PML-/- or control strain 129Sv mice were co-inoculated with in1357 plus either in1324 or in1372 (Table 4
). As found in BALB/c mice, the presence of in1324 gave a 3- to 5-fold increase in the number of positive neurons in both PML-/- and 129Sv mice. Greater variation was observed with the PML-/- and129Sv mice, compared with BALB/c, presumably due to the less stringent matching of age and sex at the time of inoculation. Nonetheless, the stimulatory effect of in1324 was highly significant in both PML-/- and 129Sv animals. As with BALB/c mice, expression from the LAT promoter was equivalent when in1388 was co-inoculated with either in1324 or in1372 (Table 4
). When
-galactosidase-positive neurons were counted at 42 days postinoculation, the numbers after co-inoculation of in1357 with in1372 surprisingly increased by 2-fold in both PML-/- and 129Sv mice, and the reasons for this difference from the findings in BALB/c are not clear. In mice co-inoculated with in1357 and in1324, however, the numbers decreased between 4 and 42 days, although not to the extent seen in BALB/c mice, and again there was no difference in the responses of PML-/- and 129Sv animals.
|
-galactosidase after a further 5 h was determined (Table 5
-galactosidase from in1382 approximately 1·5 times more efficiently than the 129Sv line, probably accounting for the slightly higher degree of response to pp71. This variation in absolute levels of expression is assumed to be due to the clonal nature of the cell lines rather than their PML contents. The intracellular localization of YFPpp71 was investigated after transfection of pYFPpp71 into PML-/- and control fibroblasts (Fig. 3
|
|
| Discussion |
|---|
|
|
|---|
The fact that expression of pp71 partially complements the replication of an ICP0-null HSV-1 mutant implies a degree of functional interchangeability although, as shown previously using HCMV particles as the source of pp71 (Preston & Nicholl, 1997
), this does not extend to reversal of the quiescent state. Similarity between pp71 and ICP0 is also apparent in the localization of the two proteins to ND10. Many viral proteins translocate to these sites, and the translocation usually correlates with positive effects on gene expression (Maul, 1998
; Everett, 2000a
). Most striking is HSV-1 ICP0, which exhibits reduced activation of gene expression if sequences important for accumulation at ND10 are altered by mutation (Everett et al., 1998a
). The fact that stimulation of gene expression occurs normally in the absence of PML indicates that pp71 does not need intact ND10 for its activity. The localized areas of pp71 staining in PML-/- fibroblasts are intriguing, as their existence may suggest that other components of ND10, which remain in discrete loci even when PML is absent, are binding sites for pp71. The significance of pp71 migration to ND10 is unclear at present. Our transfection studies with pYFPpp71 show that localization to ND10 is not dependent on the presence of a viral genome, although it is likely that colocalization of pp71, IE proteins and viral genomes to a specific site would be advantageous for activation of gene expression.
Since there are no animal models for HCMV infection, attempts to elucidate the activities of HCMV gene products in vivo rely on studies with their homologues in animal cytomegaloviruses. No functional information is available on the properties of pp71 homologues; thus the demonstration of activity in mouse DRG neurons is the only evidence to date that pp71 activates HCMV IE transcription in vivo. Although this conclusion could be anticipated, the known changes to the genome structure and growth characteristics of HCMV once in tissue culture always raise a suspicion that the virus may behave differently in vivo. In addition, our results demonstrate that cellular factors which mediate the activity of pp71 are present even in highly differentiated, postmitotic neurons. The effect is possibly most dramatic when the response of in1383 is considered: the ICP0 promoter in this virus is not sufficiently active to direct levels of
-galactosidase that are detectable by X-Gal staining, but in the presence of pp71 many neurons were positive for the enzyme.
The LAT promoter, in virus in1388, is currently the only promoter known to be unresponsive to pp71 in the coinfection assays we have used. The regulation of this element is complex, however, with downstream regions contributing to its activity and in addition maintaining latent expression while the remainder of the genome is silenced (Lachmann & Efstathiou, 1997
; Lokensgard et al., 1997
). There are a number of possible interpretations for the failure of in1324 to stimulate expression of
-galactosidase upon coinfection with in1388. These include the following: (1) sequence motifs in the LAT promoter, especially in the downstream region, may block or override pp71 activity; (2) pp71 may prevent or delay repression of the HSV-1 genome (and perhaps that of HCMV) thus LAT, which escapes repression, is not affected by the protein; (3) the LAT promoter in neurons may be transcribed at maximal levels, such that further stimulation is not possible due to limiting amounts of one or more transcription factors; (4) stimulation of transcription may be matched by an increase in cleavage of the primary transcript, a possibility since the splice donor site for the major LAT is present in the mRNA that encodes
-geo (Farrell et al., 1991
; Arthur et al., 1998
; Alvira et al., 1999
). Arguing against this final possibility is the observation that levels of the spliced mRNAs for HSV-1 ICP0 and ICP22 were increased by pp71 in tissue culture cells (Homer et al., 1999
).
The reduction in the numbers of positive neurons at 42 days after co-inoculation with in1324 suggests that expression of pp71 is, in the long term, toxic or causes a shutdown of transgene expression. Taking the former possibility, it may be that increased levels of HSV-1 IE proteins in neurons that receive in1324 cause damage or, alternatively, that pp71 stimulates the synthesis of toxic cellular gene products. It is unlikely that the decrease in positive neuron numbers is due to induction of apoptosis, since PML-/- cells are defective in the execution of certain apoptotic signals (Wang et al., 1998b
; Zhong et al., 2000
). If promoter shutdown occurs it is unlikely to be due directly to the activity of pp71, since the protein stimulates rather than represses gene expression, but may result from the synthesis of inhibitory cell factors.
Although not directly relevant to the action of pp71, our finding with in1388 shows that HSV-1 latency occurs apparently normally in the absence of PML. It is not known whether ND10 exists in mouse neurons in vivo, but on the assumption that any such structures would require PML, it appears that HSV-1 does not require ND10 as a site to harbour latent genomes in vivo. In the human neuron-like NT2 line, the permissiveness to HSV-1 infection was not significantly changed when PML levels were increased by manipulation of cell culture conditions (Hsu & Everett, 2001
).
Our results show that pp71 shares some properties with the HSV-1 IE protein ICP0, essentially in the ability to stimulate expression from a variety of promoters and migration to ND10. The functional significance of the intranuclear localization of pp71 is unclear, however, and the availability of cell lines that lack PML will be useful in unravelling the properties that are important for its effects on viral gene expression.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ahn, J.-H. & Hayward, G. S. (1997). The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells. Journal of Virology 71, 4599-4613.[Abstract]
Alvira, M. R., Goins, W. F., Cohen, J. B. & Glorioso, J. G. (1999). Genetic studies exposing the splicing events involved in herpes simplex virus type 1 latency-associated transcript production during lytic and latent infection. Journal of Virology 73, 3866-3876.
Arthur, J. L., Everett, R. D., Brierly, I. & Efstathiou, S. (1998). Disruption of the 5' and 3' splice sites flanking the major latency-associated transcripts of herpes simplex type 1: evidence for alternate splicing in lytic and latent infections. Journal of General Virology 79, 107-116.[Abstract]
Baldick, C. J., Marchini, A., Patterson, C. E. & Shenk, T. (1997). Human cytomegalovirus tegument protein pp71 (ppUL82) enhances the infectivity of viral DNA and accelerates the infectious cycle. Journal of Virology 71, 4400-4408.[Abstract]
Bresnahan, W. A. & Shenk, T. (2000). UL82 virion protein activates expression of immediate early viral genes in human cytomegalovirus-infected cells. Proceedings of the National Academy of Sciences, USA 97, 14506-14511.
Chau, N. H., Vanson, C. D. & Kerry, J. A. (1999). Transcriptional regulation of the human cytomegalovirus US11 early gene. Journal of Virology 73, 863-870.
Dalrymple, M. A., McGeoch, D. J., Davison, A. J. & Preston, C. M. (1985). DNA sequence of the herpes simplex virus type 1 gene whose product is responsible for the transcriptional activation of immediate early promoters. Nucleic Acids Research 13, 7865-7879.
Everett, R. D. (1989). Construction and characterisation of herpes simplex virus type 1 mutants with defined lesions in immediate early gene 1. Journal of General Virology 70, 1185-1202.
Everett, R. D. (2000a). ICP0, a regulator of herpes simplex virus during lytic and latent infection. Bioessays 22, 761-770.[Medline]
Everett, R. D. (2000b). ICP0 induces the accumulation of colocalizing conjugated ubiquitin. Journal of Virology 74, 9994-10005.
Everett, R. D. & Maul, G. G. (1994). HSV-1 IE protein Vmw110 causes redistribution of PML. EMBO Journal 13, 5062-5069.[Medline]
Everett, R. D., Freemont, P., Saitoh, H., Orr, A., Kathoria, M. & Parkinson, J. (1998a). The disruption of ND10 during herpes simplex virus infection correlates with the Vmw110 and proteasome-dependent loss of several PML isoforms. Journal of Virology 72, 6581-6591.
Everett, R. D., Orr, A. & Preston, C. M. (1998b). A viral activator of gene expression functions via the ubiquitin-proteasome pathway. EMBO Journal 17, 7161-7169.[Medline]
Everett, R. D., Earnshaw, W. C., Findlay, J. & Lomonte, P. (1999). Specific destruction of kinetochore protein CENP-C and disruption of cell division by herpes simplex virus immediate-early protein Vmw110. EMBO Journal 18, 1526-1538.[Medline]
Farrell, M. J., Dobson, A. T. & Feldman, L. T. (1991). Herpes simplex virus latency-associated transcript is a stable intron. Proceedings of the National Academy of Sciences, USA 88, 790-794.
Greaves, R. F. & Mocarski, E. S. (1998). Defective growth correlates with reduced accumulation of a viral DNA replication protein after low-multiplicity infection by a human cytomegalovirus ie1 mutant. Journal of Virology 72, 366-379.
Grotziger, T., Sternsdorf, T., Jensen, K. & Will, H. (1996). Interferon-modulated expression of genes encoding the nuclear-dot-associated proteins Sp100 and promyelocytic leukemia protein (PML). European Journal of Biochemistry 238, 554-560.[Medline]
Harris, R. A. & Preston, C. M. (1991). Establishment of latency in vitro by the herpes simplex virus type 1 mutant in1814. Journal of General Virology 72, 907-913.
Hensel, G. M., Meyer, H. H., Buchman, I., Pommerehne, D., Schmolke, S., Plachter, B., Radsak, K. & Kern, H. F. (1996). Intracellular localization and expression of the human cytomegalovirus matrix protein pp71 (UL82): evidence for its translocation to the nucleus. Journal of General Virology 77, 3087-3097.
Homer, E. G., Rinaldi, A., Nicholl, M. J. & Preston, C. M. (1999). Activation of herpesvirus gene expression by the human cytomegalovirus protein pp71. Journal of Virology 73, 8512-8518.
Hsu, W.-L. & Everett, R. D. (2001). Human neuron-committed teratocarcinoma NT2 cell line has abnormal ND10 structures and is poorly infected by herpes simplex type 1. Journal of Virology 75, 3819-3831.
Ishov, A. M. & Maul, G. G. (1996). The periphery of nuclear domain 10 (ND10) as a site of DNA virus deposition. Journal of Cell Science 134, 815-826.
Ishov, A. M., Stenberg, R. M. & Maul, G. G. (1997). Human cytomegalovirus immediate early interaction with host nuclear structures: definition of an immediate transcript environment. Journal of Cell Biology 138, 5-16.
Ishov, A. M., Sotnikov, A. G., Negorev, D., Vladimirova, O. V., Neff, N., Kamitani, T., Yeh, E. T. H., Strauss, J. F. & Maul, G. G. (1999). PML is critical for ND10 formation and recruits the PML-interacting protein Daxx to this nuclear structure when modified by SUMO-1. Journal of Cell Biology 147, 221-233.
Jamieson, D. R. S., Robinson, L. H., Daksis, J. I., Nicholl, M. J. & Preston, C. M. (1995). Quiescent viral genomes in human fibroblasts after infection with herpes simplex virus Vmw65 mutants. Journal of General Virology 76, 1417-1431.
Kelly, C., Van Driel, R. & Wilkinson, G. W. G. (1995). Disruption of PML-associated nuclear bodies during human cytomegalovirus infection. Journal of General Virology 76, 2887-2893.
Korioth, F., Maul, G. G., Plachter, B., Stamminger, T. & Frey, J. (1996). The nuclear domain 10 (ND10) is disrupted by the human cytomegalovirus gene product IE 1. Experimental Cell Research 229, 155-158.[Medline]
Lachmann, R. H. & Efstathiou, S. (1997). Utilization of the herpes simplex virus type 1 latency-associated regulatory region to drive stable reporter gene expression in the nervous system. Journal of Virology 71, 3197-3207.[Abstract]
Liu, B. & Stinski, M. F. (1992). Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements. Journal of Virology 66, 4434-4444.
Lokensgard, J. R., Berthomme, H. & Feldman, L. T. (1997). The latency-associated promoter of herpes simplex virus type 1 requires a region downstream of the transcription start site for long-term expression during latency. Journal of Virology 71, 6714-6719.[Abstract]
Lomonte, P., Sullivan, K. F. & Everett, R. D. (2001). Degradation of nucleosome-associated centromeric histone H3-like protein CENP-A induced by herpes simplex virus type 1 protein ICP0. Journal of Biological Chemistry 276, 5829-5835.
McFarlane, M., Daksis, J. I. & Preston, C. M. (1992). Hexamethylene bisacetamide stimulates herpes simplex virus immediate early gene expression in the absence of trans-induction by Vmw65. Journal of General Virology 73, 285-292.
Marshall, K. R., Lachmann, R. H., Efstathiou, S., Rinaldi, A. & Preston, C. M. (2000). Long-term transgene expression in mice infected with a herpes simplex virus type 1 mutant severely impaired for immediate-early gene expression. Journal of Virology 74, 956-964.
Maul, G. G. (1998). Nuclear domain 10, the site of DNA virus transcription and replication. Bioessays 20, 660-667.[Medline]
Maul, G. G. & Everett, R. D. (1994). The nuclear location of PML, a cellular member of the C3HC4 zinc-binding domain protein family, is rearranged during herpes simplex virus infection by the C3HC4 viral protein ICP0. Journal of General Virology 75, 1223-1233.
Maul, G. G., Guldner, H. H. & Spivack, J. G. (1993). Modification of discrete nuclear domains induced by herpes simplex virus type 1 immediate early gene 1 product. Journal of General Virology 74, 2679-2690.
Maul, G. G., Ishov, A. & Everett, R. D. (1996). Nuclear domain 10 as preexisting potential replication start sites of herpes simplex virus type-1. Virology 217, 67-75.[Medline]
Morgenstern, J. P. & Land, H. (1990). A series of mammalian expression vectors and characterization of their expression or a reporter gene in stably and transiently transfected cells. Nucleic Acids Research 18, 1068.
Mossman, K. L. & Smiley, J. R. (1999). Truncation of the C-terminal acidic transcriptional activation domain of herpes simplex virus VP16 renders expression of the immediate-early genes almost entirely dependent on ICP0. Journal of Virology 73, 9726-9733.
Nicholl, M. J. & Preston, C. M. (1996). Inhibition of herpes simplex virus type 1 immediate-early gene expression by alpha interferon is not VP16 specific. Journal of Virology 70, 6336-6339.[Abstract]
OHare, P. (1993). The virion transactivator of herpes simplex virus. Seminars in Virology 4, 145-155.
Parkinson, J. & Everett, R. D. (2000). Alphaherpesvirus proteins related to herpes simplex virus type 1 ICP0 affect cellular structures and proteins. Journal of Virology 74, 10006-10017.
Preston, C. M. (2000). Repression of viral transcription during herpes simplex virus latency. Journal of General Virology 81, 1-19.
Preston, C. M. & McFarlane, M. (1998). Cytodifferentiating agents affect the replication of herpes simplex virus type 1 in the absence of functional VP16. Virology 249, 418-426.[Medline]
Preston, C. M. & Nicholl, M. J. (1997). Repression of gene expression upon infection of cells with herpes simplex virus type 1 mutants impaired for immediate early protein synthesis. Journal of Virology 71, 7807-7813.[Abstract]
Preston, C. M., Rinaldi, A. & Nicholl, M. J. (1998). Herpes simplex virus type 1 immediate early gene expression is stimulated by inhibition of protein synthesis. Journal of General Virology 79, 117-124.[Abstract]
Rinaldi, A., Marshall, K. R. & Preston, C. M. (1999). A non-cytotoxic herpes simplex virus vector which expresses Cre recombinase directs efficient site specific recombination. Virus Research 65, 11-20.[Medline]
Samaniego, L. A., Neiderhiser, L. & DeLuca, N. A. (1998). Persistence and expression of the herpes simplex virus genome in the absence of immediate-early proteins. Journal of Virology 72, 3307-3320.
Sawtell, N. M. (1997). Comprehensive quantification of herpes simplex virus latency at the single-cell level. Journal of Virology 71, 5423-5431.[Abstract]
Steiner, I., Spivack, J. G., Deshmane, S. L., Ace, C. I., Preston, C. M. & Fraser, N. W. (1990). A herpes simplex virus type 1 mutant containing a non-transinducing Vmw65 protein establishes latent infection in vivo in the absence of viral replication and reactivates efficiently from explanted trigeminal ganglia. Journal of Virology 64, 1630-1638.
Stow, N. D. & Stow, E. C. (1986). Isolation and characterisation of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide Vmw110. Journal of General Virology 67, 2571-2585.
Stuurman, N., de Graaf, A., Floore, A., Josso, A., Humbel, B., de Jong, L. & van Driel, R. (1992). A monoclonal antibody recognizing nuclear matrix-associated nuclear bodies. Journal of Cell Science 101, 773-784.
Tal-Singer, R., Pichyangkura, R., Chung, E., Lasner, T. M., Randazzo, B. P., Trojanowski, J. Q., Fraser, N. W. & Triezenberg, S. J. (1999). The transcriptional activation domain of VP16 is required for efficient infection and establishment of latency by HSV-1 in the murine peripheral and central nervous systems. Virology 259, 20-33.[Medline]
Wang, Z. G., Delva, L., Gaboli, M., Rivi, R., Giorgio, M., Cordon-Cardo, C., Grosveld, F. & Pandolfi, P. P. (1998a). Role of PML in cell growth and the retinoic acid pathway. Science 279, 1547-1551.
Wang, Z.-G., Ruggero, D., Ronchetti, S., Zhong, S., Gaboli, M., Rivi, R. & Pandolfi, P. P. (1998b). Pml is essential for multiple apoptotic roles. Nature Genetics 20, 266-272.[Medline]
Wilkinson, G. W. G., Kelly, C., Sinclair, J. H. & Rickards, C. (1998). Disruption of PML-associated nuclear bodies by the human cytomegalovirus major immediate early gene product. Journal of General Virology 79, 1233-1245.[Abstract]
Wu, N., Watkins, S. C., Schaffer, P. A. & DeLuca, N. A. (1996). Prolonged gene expression and cell survival after infection by a herpes simplex virus mutant defective in the immediate-early genes encoding ICP4, ICP27, and ICP22. Journal of Virology 70, 6358-6369.[Abstract]
Zhong, S., Salomoni, P., Ronchetti, S., Guo, A., Ruggero, D. & Pandolfi, P. P. (2000). Promyelocytic leukemia protein (PML) and Daxx participate in a novel nuclear pathway for apoptosis. Journal of Experimental Medicine 191, 631-640.
Received 26 October 2001;
accepted 1 March 2002.
This article has been cited by other articles:
![]() |
I. J. Groves, M. B. Reeves, and J. H. Sinclair Lytic infection of permissive cells with human cytomegalovirus is regulated by an intrinsic 'pre-immediate-early' repression of viral gene expression mediated by histone post-translational modification J. Gen. Virol., October 1, 2009; 90(10): 2364 - 2374. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lukashchuk, S. McFarlane, R. D. Everett, and C. M. Preston Human Cytomegalovirus Protein pp71 Displaces the Chromatin-Associated Factor ATRX from Nuclear Domain 10 at Early Stages of Infection J. Virol., December 15, 2008; 82(24): 12543 - 12554. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Preston and M. J. Nicholl Induction of Cellular Stress Overcomes the Requirement of Herpes Simplex Virus Type 1 for Immediate-Early Protein ICP0 and Reactivates Expression from Quiescent Viral Genomes J. Virol., December 1, 2008; 82(23): 11775 - 11783. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tavalai, M. Kraiger, N. Kaiser, and T. Stamminger Insertion of an EYFP-pp71 (UL82) Coding Sequence into the Human Cytomegalovirus Genome Results in a Recombinant Virus with Enhanced Viral Growth J. Virol., November 1, 2008; 82(21): 10543 - 10555. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Kalejta Tegument Proteins of Human Cytomegalovirus Microbiol. Mol. Biol. Rev., June 1, 2008; 72(2): 249 - 265. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Prichard, E. Sztul, S. L. Daily, A. L. Perry, S. L. Frederick, R. B. Gill, C. B. Hartline, D. N. Streblow, S. M. Varnum, R. D. Smith, et al. Human Cytomegalovirus UL97 Kinase Activity Is Required for the Hyperphosphorylation of Retinoblastoma Protein and Inhibits the Formation of Nuclear Aggresomes J. Virol., May 15, 2008; 82(10): 5054 - 5067. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tavalai, P. Papior, S. Rechter, and T. Stamminger Nuclear Domain 10 Components Promyelocytic Leukemia Protein and hDaxx Independently Contribute to an Intrinsic Antiviral Defense against Human Cytomegalovirus Infection J. Virol., January 1, 2008; 82(1): 126 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tang and G. G. Maul Mouse cytomegalovirus crosses the species barrier with help from a few human cytomegalovirus proteins. J. Virol., August 1, 2006; 80(15): 7510 - 7521. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Preston and M. J. Nicholl Role of the cellular protein hDaxx in human cytomegalovirus immediate-early gene expression. J. Gen. Virol., May 1, 2006; 87(Pt 5): 1113 - 1121. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Saffert and R. F. Kalejta Inactivating a Cellular Intrinsic Immune Defense Mediated by Daxx Is the Mechanism through Which the Human Cytomegalovirus pp71 Protein Stimulates Viral Immediate-Early Gene Expression. J. Virol., April 1, 2006; 80(8): 3863 - 3871. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Trgovcich, C. Cebulla, P. Zimmerman, and D. D. Sedmak Human Cytomegalovirus Protein pp71 Disrupts Major Histocompatibility Complex Class I Cell Surface Expression J. Virol., January 15, 2006; 80(2): 951 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tamrakar, A. J. Kapasi, and D. H. Spector Human Cytomegalovirus Infection Induces Specific Hyperphosphorylation of the Carboxyl-Terminal Domain of the Large Subunit of RNA Polymerase II That Is Associated with Changes in the Abundance, Activity, and Localization of cdk9 and cdk7 J. Virol., December 15, 2005; 79(24): 15477 - 15493. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takemoto, M. Koike, Y. Mori, S. Yonemoto, Y. Sasamoto, K. Kondo, Y. Uchiyama, and K. Yamanishi Human Herpesvirus 6 Open Reading Frame U14 Protein and Cellular p53 Interact with Each Other and Are Contained in the Virion J. Virol., October 15, 2005; 79(20): 13037 - 13046. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bego, J. Maciejewski, S. Khaiboullina, G. Pari, and S. St. Jeor Characterization of an Antisense Transcript Spanning the UL81-82 Locus of Human Cytomegalovirus J. Virol., September 1, 2005; 79(17): 11022 - 11034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Cantrell and W. A. Bresnahan Interaction between the Human Cytomegalovirus UL82 Gene Product (pp71) and hDaxx Regulates Immediate-Early Gene Expression and Viral Replication J. Virol., June 15, 2005; 79(12): 7792 - 7802. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Preston and M. J. Nicholl Human Cytomegalovirus Tegument Protein pp71 Directs Long-Term Gene Expression from Quiescent Herpes Simplex Virus Genomes J. Virol., January 1, 2005; 79(1): 525 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Day, C. C. Baker, D. R. Lowy, and J. T. Schiller Establishment of papillomavirus infection is enhanced by promyelocytic leukemia protein (PML) expression PNAS, September 28, 2004; 101(39): 14252 - 14257. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. McGregor, F. Liu, and M. R. Schleiss Molecular, Biological, and In Vivo Characterization of the Guinea Pig Cytomegalovirus (CMV) Homologs of the Human CMV Matrix Proteins pp71 (UL82) and pp65 (UL83) J. Virol., September 15, 2004; 78(18): 9872 - 9889. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schierling, T. Stamminger, T. Mertens, and M. Winkler Human Cytomegalovirus Tegument Proteins ppUL82 (pp71) and ppUL35 Interact and Cooperatively Activate the Major Immediate-Early Enhancer J. Virol., September 1, 2004; 78(17): 9512 - 9523. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Eskiw, G. Dellaire, J. S. Mymryk, and D. P. Bazett-Jones Size, position and dynamic behavior of PML nuclear bodies following cell stress as a paradigm for supramolecular trafficking and assembly J. Cell Sci., November 1, 2003; 116(21): 4455 - 4466. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kronschnabl and T. Stamminger Synergistic induction of intercellular adhesion molecule-1 by the human cytomegalovirus transactivators IE2p86 and pp71 is mediated via an Sp1-binding site J. Gen. Virol., January 1, 2003; 84(1): 61 - 73. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |