J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cook, R. D.
Right arrow Articles by Porter, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cook, R. D.
Right arrow Articles by Porter, S. R.
Agricola
Right arrow Articles by Cook, R. D.
Right arrow Articles by Porter, S. R.
Journal of General Virology (2002), 83, 1613-1619.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Mixed patterns of transmission of human herpesvirus-8 (Kaposi’s sarcoma-associated herpesvirus) in Malawian families

Rachelle D. Cook1,2, Tim A. Hodgson1, Alastair C. W. Waughb,1, Elizabeth M. Molyneux3, Eric Borgstein4, A. Sherry4, Chong Gee Teo2 and Stephen R. Porter1

Department of Oral Medicine, Eastman Dental Institute for Oral Health Care Sciences, UCL, University of London, UK1
Virus Reference Division, Central Public Health Laboratory, 61 Colindale Avenue, London NW9 5HT, UK2
Department of Paediatrics3 and Department of Surgery4, College of Medicine, University of Malawi, Blantyre, Malawi

Author for correspondence: Rachelle Cook (at the Virus Reference Division). Fax +44 208 200 1569. e-mail rcook{at}phls.org.uk


   Abstract
TOP
Abstract
Main text
References
 
To study transmission patterns of human herpesvirus-8 (HHV-8) (Kaposi’s sarcoma-associated herpesvirus) in families in Malawi, nucleotide sequences derived from two hypervariable loci of the HHV-8 genome, the V1 and V2 regions of open reading frame K1 (K1/V1 and K1/V2, respectively), were amplified from blood and mouth rinse samples of 22 patients with treated and untreated Kaposi’s sarcoma (KS) and their first-degree relatives (n=67). In patients with KS, vincristine therapy was significantly associated with non-detectability of circulating, but not oral, K1/V1 DNA. Intra-familial K1/V1 phylogenetic comparisons of eight families were possible. Both identical and non-identical sequences were observed between family members, suggesting transmission of HHV-8 along both intra- and extra-familial transmission routes.


   Main text
TOP
Abstract
Main text
References
 
Kaposi’s sarcoma-associated herpesvirus (KSHV), also called human herpesvirus 8 (HHV-8), was first isolated from an AIDS-associated Kaposi’s sarcoma (KS) biopsy sample (Chang et al., 1994Down ). HHV-8 is now considered to be causally associated with all epidemiological forms of KS (Boshoff & Weiss, 2001Down ).

Serological studies have indicated that, unlike other human herpesviruses, HHV-8 is not ubiquitous. The prevalence of serologically determined HHV-8 infection is low in the USA and Europe, rising in Mediterranean countries and reaching levels of greater than 50% in some geographic regions of Africa (Gao et al., 1996Down ; Lenette et al., 1996Down ; Simpson et al., 1996Down ; Whitby et al., 1995Down ; Olsen et al., 1998Down ).

In North America and Europe, HHV-8 primary infection occurs mainly in adulthood, most notably among HIV-1-positive homosexual men (Martin et al., 1998Down ; Dukers et al., 2000Down ). Transmission of HHV-8 in homosexual men is likely to occur during sexual activity and HHV-8 seroprevalence in this group is linked to the number of sexual partners and to specific sexual practice (Martin et al., 1998Down ; Melbye et al., 1998Down ; Dukers et al., 2000Down ).

In African populations, KS was infrequently observed in children prior to the HIV epidemic; however, it is now increasingly prevalent (Athale et al., 1995Down ; Ziegler & Katongole-Mbidde, 1996Down ). Studies of HHV-8 seroprevalence in African populations indicate that HHV-8 infection occurs largely before puberty through casual family and community contact (Mayama et al., 1998Down ; Gessain et al., 1999Down ). Evidence to support non-sexual transmission of HHV-8 between mother and child and between siblings has been documented in African serological studies (Plancoulaine et al., 2000Down ). Passive transmission of maternal HHV-8 antibodies to the infant has also been demonstrated. However, HHV-8 seroprevalence in African children under 2 years of age is low, indicating vertical transmission of HHV-8 is not significant (Gessain et al., 1999Down ; Lyall et al., 1999Down ).

As both KS and HIV-1 infection are highly endemic in Malawi (Thomas, 2001Down ), we wanted to investigate the extent of non-sexual transmission of HHV-8 within family groups resident in this region. We describe here a molecular epidemiological study evaluating the transmission patterns of particular HHV-8 variants infecting families of known HHV-8-infected individuals. DNA sequences were amplified from two reported highly variable loci in the HHV-8 genome, the variable regions 1 and 2 (V1 and V2) of open reading frame (ORF) K1 (Cook et al., 1999Down ; Zong et al., 1999Down ).

Ethical approval was obtained prior to commencing this study from the Eastman Dental Institute (UK), University College London (UK) and the University of Malawi. Consecutive patients of the Central Hospital, Blantyre, Malawi, with presumptive cutaneous, oral and histologically confirmed nodal KS were invited to join the study. At presentation, all patients were offered palliative treatment with intravenous vincristine (2 mg/m2). Regardless of whether treatment was administered, patients were requested to return within a week with all available household members. During the return visit, blood and mouth rinse samples were taken from patients and from each family member.

HIV-1 seropositivity was confirmed by an IgG capture particle adherence test (Parry et al., 1995Down ), and HHV-8 seropositivity by the HHV-8 IgG IFA Kit (Advanced Biotechnologies Incorporated). This IFA utilizes the KS-1 cell line as a source of HHV-8, expressing both latent and lytic HHV-8 antigens on its cell surface. This highly specific and sensitive assay is appropriate for use in epidemiological studies (Chatlynne et al., 1998Down ).

DNA was extracted from the immunomagnetically selected CD45+ leukocyte fraction of blood, as described previously (Leao et al., 2000Down ). Study participants were asked to rinse with PBS and spit the rinse into a universal centrifuge tube. These samples were subsequently spun to separate the pellet from the cell-free fraction. DNA was extracted from 150 µl of mouth-rinse pellets by a guanidium thiocyanate–silica procedure (Boom et al., 1990Down ).

A 246 bp segment from the V1 region of ORF K1 (K1/V1; nt 573–819) (Zong et al., 1999Down ) was amplified by a nested PCR, using as first-round primers 5' CCCTGGAGTGATTTCAACGC 3' (sense) and 5' ACATGCTGACCACAAGTGAC 3' (antisense), and as second-round primers 5' GAGTGATTTAACGCCTTAC 3' (sense) and 5' TGCTGACCACAAGTGACTGT 3' (antisense). Negative controls were included during extraction and PCR to control for possible contamination resulting from the nested PCR. Selected K1/V1 DNA-positive extracts were processed to amplify a 575 bp segment from the V2 region of ORF K1 (K1/V2) by hemi-nested PCR using LGH2088 and LGH2089 (Cook et al., 1999Down ) as first-round primers, and LGH2088 and K1/408/1 (Zong et al., 1999Down ) as second-round primers.

All K1/V1 and K1/V2 products were cloned using the TOPO TA cloning kit (Invitrogen). DNA of three to five clones from each product was sequenced, using the CEQ 2000 dye terminator cycle sequencing kit and capillary array automated sequencing system (Beckman Coulter). Raw DNA sequence data were analysed using SeqMan software (DNASTAR). Phylogenetic trees were generated in PHYLIP (Felsenstein, 1993Down ) using NEIGHBOR to construct a NEIGHBOR-joining tree from the DNA distance matrix generated in DNADIST. Bootstrapping for 1000 replicates is reported (as a percentage) at major branch points as a measure of confidence.

Twenty-two of the 24 patients with KS were HHV-8 seropositive. These 22 comprised the index cases (Table 1Down). Sixty-seven family members of the index cases were enrolled into the study. Characteristics of the complete study group are shown in Table 1Down.


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics and virological status of Malawian KS patients and their family members

 
Twenty (91%) of the 22 index cases were HIV-1 seropositive and all were HHV-8 seropositive. Of the relatives, 16 (23%) were HIV-1 seropositive and 46 (69%) were HHV-8 seropositive. Overall, there was a positive association between HHV-8 and HIV-1 seropositivity in the total number of study subjects (P=0·004) ({chi}2 test).

Of the 22 index patients, 5 (23%) were K1/V1 DNA positive in blood and 4 (18%) in oral rinses (Table 1Up). HHV-8 DNA negativity in the blood in index cases was significantly associated with prior vincristine therapy (P=0·001) ({chi}2 test). In the samples of 67 family members of patients with KS, K1/V1 DNA was positive in the oral rinse of 18 (27%) but not in any of the blood samples. ORF K1/V1 DNA was detected in the oral sample in the absence of HHV-8 seropositivity in four of the family members (B3, K1, R3 and X2).

This higher rate of HHV-8 detection in the mouth compared with blood substantiates previous observations of frequent oral carriage of HHV-8. In Zimbabwean women with KS, HHV-8 DNA could be detected in oral rinse samples as frequently as in blood (Lampinen et al., 2000Down ), and in homosexual men, infectious HHV-8 has been isolated at high titre in the saliva (Koelle et al., 1997Down ). RNA transcripts have been visualized in the buccal mucosa of homosexual men by in situ hybridization (Pauk et al., 2000Down ), suggesting active HHV-8 replication within the oral epithelium.

Oral and blood samples were extracted using different techniques and this may have negatively affected our ability to amplify ORF K1/V1 DNA from the blood. However, both sets of samples were processed within 4 h of collection and stored at -20 °C until extraction. Furthermore, immunomagnetically selected blood fraction samples are stable when stored and are readily amplified by PCR (Leao et al., 2000Down ). We suggest our inability to amplify ORF K1/V1 DNA from blood as opposed to mouth rinse samples was due to the increased frequency of carriage of HHV-8 in the oral compartment of HHV-8 antibody-positive persons without overt KS disease. In addition, we attribute the significant decrease in PCR detectability of ORF K1/V1 DNA in the blood of the index cases to vincristine therapy.

ORF K1/V1 DNA sequences could be compared in eight families (B, E, G, K, T, W, X and Z). Characteristic amino acid motifs in either the V1 or V2 regions of ORF K1 permitted subtyping (Zong et al., 1999Down , 2002Down ). In areas of sub-Saharan Africa, ORF K1 subtypes A5 and B are most common (Lacoste et al., 2000Down ), and these two subtypes were predominantly represented in our sample set (Fig. 1aDown).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. Predicted phylogenetic distribution of a 213 bp segment of HHV-8 ORF K1/V1 (a) and a 462 bp segment of ORF K1/V2 (b) amplified from KS patients and their family members (in bold) in a background of GenBank sequences representing major ORF K1 subtypes. Sequences were recovered from oral samples unless otherwise indicated. Linear unrooted phylogenetic dendograms were generated using PHYLIP, DNADIST and NEIGHBOR programs. Bootstrapping for 1000 replicates is noted as a percentage at major branch points. The genetic distance size scale for 0·1 (10% divergence) is indicated. *Clones B5(III), T2(VI), E4(II), W4(IV), W2(V), B3(V), E4(III), E4(I), B3(IV), B3(I) and W4(V) have an identical sequence to T2(V).

 
Identical K1/V1 DNA sequences were recovered in families E, G, K and Z. Identical sequences were found in family E, between the mother (Ei) and one of her sons (E6), in families K and Z, between the mothers (Ki and Z2) and their sons (K1 and Zi), and in family G between a father (G1) and son (G2). Common sequences recovered from these family members indicated that intra-familial transmission of HHV-8 may have occurred. Transmission between mothers and their children has been previously reported (Plancoulaine et al., 2000Down ), and this may have occurred in families E, K and Z. In family G, a father and son shared the same sequence. The mother’s sequence (Gi) was not available for study and the possibility that she may have acted as a source of infection for both her spouse and her son cannot be excluded. In addition, sequences recovered from families G, K and Z, all ORF K1 A5 subtypes, were very similar and it is possible that a regional HHV-8 variant is circulating in this population.

Intra-family divergences of K1/V1 sequences were revealed in families B, E, T, W and X. Nucleotide divergence between family members ranged from 0·47% (between W1 and W2) to 27·7% (between X1 and X2). In all families except the B family, the sequences of all clones recovered from each sample were identical.

Within family B, there were two sequences recovered from B5 clones, designated B5(I) and B5(II). Subject B5 might have been dually infected with two HHV-8 variants, one A4 subtype virus [B5(I)] and one B1 subtype virus [B5(II)]. Recombination in HHV-8 viral strains recovered from African patients suggests dual infection may sometimes occur (Zong et al., 2002Down ). We were not able to consistently amplify the B5(I) sequence, and contamination from an external source cannot be ruled out.

Of the eight families studied for K1/V1 sequence diversity, K1/V2 DNA could be amplified from two or more members in six families. Sequence data were available for clones from B, E, T, G, K and W families, and comparisons could be made for all families other than family G (in which G1 sequence data could not be recovered). Sequencing was carried out on at least three clones for each sample; one to two nucleotide substitutions were observed between some clones. All clones with available sequence data were phylogenetically analysed (Fig. 1bUp).

The disparate K1/V1 and K1/V2 sequences found between T2 and T3 demonstrated that these siblings were unlikely to have acquired HHV-8 infection from one another. ORF K1/V1 sequences recovered from X1 and his daughter, X2, belonged to different genotypes (A2 and B1, respectively) indicating no transmission linkage between each other. ORF K1/V1 sequences compared between W4, her father, W1, and brother, W2, differed by one or two amino acids. Nevertheless, intra-familial HHV-8 transmission via the mother (Wi), whose ORF K1 sequence was not available, is possible. In family E, recovered ORF K1/V1 sequences revealed minor nucleotide variations between E4, E5 and Ei/E6. However, only E4 carried a divergent amino acid sequence (Fig. 2Down) and transmission from the mother, Ei, was possible in this family.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. CLUSTAL W alignment of HHV-8 K1/V1 amino acid sequences from families having more than two members positive for K1/V1 DNA.

 
Non-identical sequences recovered in each of these families indicated possible extra-familial transmission. However, intra-familial transmission through the seropositive/HHV-8 DNA-negative family members from whom ORF K1 sequences could not be recovered cannot be excluded. Very little sequence divergence was revealed between families E, B, W and T (ORF K1 B or B1 subtype), and it is possible that these individuals were infected with common subtype B variant present in the environment.

We found in our sample of Malawian families both patterns of HHV-8 sequence identity and non-identity among different members of the same family. Although our sample set was small, the data presented here indicated that patterns of transmission in endemic regions may be more complicated than that suggested by the mother-to-child model. Similar but not identical sequences were recovered both within and between families. Non-sexual transmission of prevailing HHV-8 variants within the population may result in the patterns we observed in this study.

These data also substantiate previous observations of early non-sexual HHV-8 acquisition in children living in endemic populations (Mayama et al., 1998Down ; Gessain et al., 1999Down ; Plancoulaine et al., 2000Down ). The higher rate of recovery of HHV-8 sequences from oral compared with blood samples suggests that oral secretions potentially act as vehicles of non-sexual horizontal spread. Thus, the control of HHV-8 infection and the KS epidemic cannot rely on community-wide environmental sterilization and disinfection. Reducing the size of the reservoir of infection by anti-viral treatment of infected persons is also impractical. The optimal route to control of KS in endemic regions would be through vaccination.


   Acknowledgments
 
This work was supported by NIH grant DE12176-03.


   Footnotes
 
All ORF K1/V1 DNA sequences have been deposited in GenBank, accession numbers AF398120AF398140 and AF451301AF451321.

b Present address: The School of Pharmacy, University of London, 29–39 Brunswick Square, London WC1N 1AX, UK. Back


   References
TOP
Abstract
Main text
References
 
Athale, U. H., Patil, P. S., Chintu, C. & Elem, B. (1995). Influence of HIV epidemic on the incidence of Kaposi’s sarcoma in Zambian children. Journal of Acquired Immunodeficiency Syndrome and Human Retrovirology 8, 96-100.

Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M. & van der Noorda, N. J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.[Abstract/Free Full Text]

Boshoff, C. & Weiss, R. A. (2001). Epidemiology and pathogenesis of Kaposi’s sarcoma-associated herpesvirus. Philosophical Transactions of the Royal Society of London Biological Sciences 356, 517-534.

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 266, 1865-1869.[Abstract/Free Full Text]

Chatlynne, L. G., Lapps, W., Handy, M., Huang, Y. Q., Masood, R., Hamilton, A. S., Said, J. W., Koeffler, H. P., Kaplan, M. H., Friedman-Kien, A., Gill, P. S., Whitman, J. E. & Ablashi, D. V. (1998). Detection and titration of human herpesvirus-8-specific antibodies in sera from blood donors, acquired immunodeficiency syndrome patients, and Kaposi’s sarcoma patients using a whole virus enzyme-linked immunosorbent assay. Blood 92, 53-58.[Abstract/Free Full Text]

Cook, P. M., Whitby, D., Calabro, M. L., Luppi, M., Kakoola, D. N., Hjalgrim, H., Ariyoshi, K., Ensoli, B., Davison, A. J. & Schulz, T. F. (1999). Variability and evolution of Kaposi’s sarcoma-associated herpesvirus in Europe and Africa. AIDS 13, 1165-1176.[Medline]

Dukers, N. H., Renwick, N., Prins, M., Geskus, R. B., Schulz, T. F., Weverling, G. J., Coutinho, R. A. & Goudsmit, J. (2000). Risk factors for human herpesvirus 8 seropositivity and seroconversion in a cohort of homosexual men. American Journal of Epidemiology 151, 213-224.[Abstract/Free Full Text]

Felsenstein, J. (1993). PHYLIP version 3.5c. University of Washington, Seattle, USA.

Gao, S. J., Kingsley, L., Hoover, D. R., Spira, T. J., Rinaldo, C. R., Saah, A., Phair, J., Detels, R., Parry, P., Chang, Y. & Moore, P. S. (1996). Seroconversion to antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi’s sarcoma. New England Journal of Medicine 335, 233-241.[Abstract/Free Full Text]

Gessain, A., Mauclere, P., van Beveren, M., Plancoulaine, S., Ayouba, A., Essame-Oyono, J. L., Martin, P. M. & de The, G. (1999). Human herpesvirus 8 primary infection occurs during childhood in Cameroon, Central Africa. International Journal of Cancer 81, 189-192.

Koelle, D. M., Huang, M. L., Chandran, B., Vieira, J., Piepkorn, M. & Corey, L. (1997). Frequent detection of Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) DNA in saliva of human immunodeficiency virus-infected men: clinical and immunologic correlates. Journal of Infectious Diseases 176, 94-102.[Medline]

Lacoste, V., Judde, J. G., Briere, J., Tulliez, M., Garin, B., Kassa-Kelembho, E., Morvan, J., Couppie, P., Clyti, E., Forteza, V. J., Rio, B., Delmer, A., Mauclere, P. & Gessain, A. (2000). Molecular epidemiology of human herpesvirus 8 in Africa: both B and A5 K1 genotypes, as well as the M and P genotypes of K14.1/K15 loci, are frequent and widespread. Virology 278, 60-74.[Medline]

Lampinen, T. M., Kulasingam, S., Min, J., Borok, M., Gwanzura, L., Lamb, J., Mahomed, K., Woelk, G. B., Strand, K. B., Bosch, M. L., Edelman, D. C., Constantine, N. T., Katzenstein, D. & Williams, M. A. (2000). Detection of Kaposi’s sarcoma-associated herpesvirus in oral and genital secretions of Zimbabwean women. Journal of Infectious Diseases 181, 1785-1790.[Medline]

Leao, J. C., Kumar, N., McLean, K. A., Porter, S. R., Scully, C. M., Swan, A. V. & Teo, C. G. (2000). Effect of human immunodeficiency virus-1 protease inhibitors on the clearance of human herpesvirus 8 from blood of human immunodeficiency virus-1-infected patients. Journal of Medical Virology 62, 416-420.[Medline]

Lennette, E. T., Blackbourn, D. J. & Levy, J. A. (1996). Antibodies to human herpesvirus type 8 in the general population and in Kaposi’s sarcoma patients. Lancet 348, 858-861.[Medline]

Lyall, E. G., Patton, G. S., Sheldon, J., Stainsby, C., Mullen, J., O’Shea, S., Smith, N. A., de Ruiter, A., McClure, M. O. & Schulz, T. F. (1999). Evidence for horizontal and not vertical transmission of human herpesvirus 8 in children born to human immunodeficiency virus-infected mothers. Pediatric Infectious Disease Journal 18, 795-799.[Medline]

Martin, J. N., Ganem, D. E., Osmond, D. H., Page-Shafer, K. A., Macrae, D. & Kedes, D. H. (1998). Sexual transmission and the natural history of human herpesvirus 8 infection. New England Journal of Medicine 338, 948-954.[Abstract/Free Full Text]

Mayama, S., Cuevas, L. E., Sheldon, J., Omar, O. H., Smith, D. H., Okong, P., Silvel, B., Hart, C. A. & Schulz, T. F. (1998). Prevalence and transmission of Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents. International Journal of Cancer 77, 817-820.

Melbye, M., Cook, P. M., Hjalgrim, H., Begtrup, K., Simpson, G. R., Biggar, R. J., Ebbesen, P. & Schulz, T. F. (1998). Risk factors for Kaposi’s-sarcoma-associated herpesvirus (KSHV/HHV-8) seropositivity in a cohort of homosexual men, 1981–1996. International Journal of Cancer 77, 543-548.

Olsen, S. J., Chang, Y., Moore, P. S., Biggar, R. J. & Melbye, M. (1998). Increasing Kaposi’s sarcoma-associated herpesvirus seroprevalence with age in a highly Kaposi’s sarcoma endemic region, Zambia in 1985. AIDS 12, 1921-1925.[Medline]

Parry, J. V., Connell, J. A., Reinbott, P., Garcia, A. B., Avillez, F. & Mortimer, P. P. (1995). GACPAT HIV 1 + 2: a simple, inexpensive assay to screen for, and discriminate between, anti-HIV 1 and anti-HIV 2. Journal of Medical Virology 45, 10-16.[Medline]

Pauk, J., Huang, M. L., Brodie, S. J., Wald, A., Koelle, D. M., Schacker, T., Celum, C., Selke, S. & Corey, L. (2000). Mucosal shedding of human herpesvirus 8 in men. New England Journal of Medicine 343, 1369-1377.[Abstract/Free Full Text]

Plancoulaine, S., Abel, L., van Beveren, M., Tregouet, D. A., Joubert, M., Tortevoye, P., de The, G. & Gessain, A. (2000). Human herpesvirus 8 transmission from mother to child and between siblings in an endemic population. Lancet 356, 1062-1065.[Medline]

Simpson, G. R., Schulz, T. F., Whitby, D., Cook, P. M., Boshoff, C., Rainbow, L., Howard, M. R., Gao, S. J., Bohenzky, R. A., Simmonds, P., Lee, C., de Ruiter, A., Hatzakis, A., Tedder, R. S., Weller, I. V., Weiss, R. A. & Moore, P. S. (1996). Prevalence of Kaposi’s sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen. Lancet 348, 1133-1138.[Medline]

Thomas, J. O. (2001). Acquired immunodeficiency syndrome-associated cancers in Sub-Saharan Africa. Seminars in Oncology 28, 198-206.[Medline]

Whitby, D., Howard, M. R., Tenant-Flowers, M., Brink, N. S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F. E., Aldam, D. M. & Denton, A. S. (1995). Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi’s sarcoma. Lancet 346, 799-802.[Medline]

Ziegler, J. L. & Katongole-Mbidde, E. (1996). Kaposi’s sarcoma in childhood: an analysis of 100 cases from Uganda and relationship to HIV infection. International Journal of Cancer 65, 200-203.

Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S. (1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposi’s sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.[Abstract/Free Full Text]

Zong, J., Ciufo, D. M., Viscidi, R., Alagiozoglou, L., Tyring, S., Rady, P., Orenstein, J., Boto, W., Kalumbuja, H., Romano, N., Melbye, M., Kang, G. H., Boshoff, C. & Hayward, G. S. (2002). Genotypic analysis at multiple loci across Kaposi’s sarcoma herpesvirus (KSHV) DNA molecules: clustering patterns, novel variants and chimerism. Journal of Clinical Virology 23, 119-148.[Medline]

Received 7 December 2001; accepted 5 March 2002.


This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Wojcicki, M. Mwanahamuntu, V. Minhas, B. Djokic, C. Kankasa, W. Klaskala, B. Brayfield, S. Phiri, C. Wood, and C. D. Mitchell
Mortality among HIV-1- and Human Herpesvirus Type 8-Affected Mother-Infant Pairs in Zambia
Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2238 - 2243.
[Abstract] [Full Text] [PDF]


Home page
J Int Assoc Physicians AIDS Care (Chic Ill)Home page
J. Stebbing, T. Powles, M. Nelson, and M. Bower
Significance of Variation Within HIV, EBV, and KSHV Subtypes
J Int Assoc Physicians AIDS Care (Chic Ill), September 1, 2006; 5(3): 93 - 102.
[Abstract] [PDF]


Home page
J. Gen. Virol.Home page
M. M. Brinkmann and T. F. Schulz
Regulation of intracellular signalling by the terminal membrane proteins of members of the Gammaherpesvirinae.
J. Gen. Virol., May 1, 2006; 87(Pt 5): 1047 - 1074.
[Abstract] [Full Text] [PDF]


Home page
ADRHome page
C.G. Teo
Conceptual Emergence of Human Herpesvirus 8 (Kaposi's Sarcoma-associated Herpesvirus) as an Oral Herpesvirus
Advances in Dental Research, April 1, 2006; 19(1): 85 - 90.
[Abstract] [Full Text] [PDF]


Home page
ADRHome page
J. Webster-Cyriaque, K. Duus, C. Cooper, and M. Duncan
Oral EBV and KSHV Infection in HIV
Advances in Dental Research, April 1, 2006; 19(1): 91 - 95.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B.-S. Lee, S.-H. Lee, P. Feng, H. Chang, N.-H. Cho, and J. U. Jung
Characterization of the Kaposi's Sarcoma-Associated Herpesvirus K1 Signalosome
J. Virol., October 1, 2005; 79(19): 12173 - 12184.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
E. Santos-Fortuna and A. Caterino-de-Araujo
Confirming Shedding of Human Herpesvirus 8 in Urine from Infected Patients in Brazil
J. Clin. Microbiol., February 1, 2005; 43(2): 1008 - 1008.
[Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
M. M. Beyari, T. A. Hodgson, W. Kondowe, E. M. Molyneux, C. M. Scully, S. R. Porter, and C. G. Teo
Genotypic Profile of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus) in Urine
J. Clin. Microbiol., July 1, 2004; 42(7): 3313 - 3316.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. M. Duus, V. Lentchitsky, T. Wagenaar, C. Grose, and J. Webster-Cyriaque
Wild-Type Kaposi's Sarcoma-Associated Herpesvirus Isolated from the Oropharynx of Immune-Competent Individuals Has Tropism for Cultured Oral Epithelial Cells
J. Virol., April 15, 2004; 78(8): 4074 - 4084.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B.-S. Lee, M. Connole, Z. Tang, N. L. Harris, and J. U. Jung
Structural Analysis of the Kaposi's Sarcoma-Associated Herpesvirus K1 Protein
J. Virol., July 15, 2003; 77(14): 8072 - 8086.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cook, R. D.
Right arrow Articles by Porter, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cook, R. D.
Right arrow Articles by Porter, S. R.
Agricola
Right arrow Articles by Cook, R. D.
Right arrow Articles by Porter, S. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS