|
|
||||||||
Animal: DNA Viruses |
Department of Oral Medicine, Eastman Dental Institute for Oral Health Care Sciences, UCL, University of London, UK1
Virus Reference Division, Central Public Health Laboratory, 61 Colindale Avenue, London NW9 5HT, UK2
Department of Paediatrics3 and Department of Surgery4, College of Medicine, University of Malawi, Blantyre, Malawi
Author for correspondence: Rachelle Cook (at the Virus Reference Division). Fax +44 208 200 1569. e-mail rcook{at}phls.org.uk
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
Serological studies have indicated that, unlike other human herpesviruses, HHV-8 is not ubiquitous. The prevalence of serologically determined HHV-8 infection is low in the USA and Europe, rising in Mediterranean countries and reaching levels of greater than 50% in some geographic regions of Africa (Gao et al., 1996
; Lenette et al., 1996
; Simpson et al., 1996
; Whitby et al., 1995
; Olsen et al., 1998
).
In North America and Europe, HHV-8 primary infection occurs mainly in adulthood, most notably among HIV-1-positive homosexual men (Martin et al., 1998
; Dukers et al., 2000
). Transmission of HHV-8 in homosexual men is likely to occur during sexual activity and HHV-8 seroprevalence in this group is linked to the number of sexual partners and to specific sexual practice (Martin et al., 1998
; Melbye et al., 1998
; Dukers et al., 2000
).
In African populations, KS was infrequently observed in children prior to the HIV epidemic; however, it is now increasingly prevalent (Athale et al., 1995
; Ziegler & Katongole-Mbidde, 1996
). Studies of HHV-8 seroprevalence in African populations indicate that HHV-8 infection occurs largely before puberty through casual family and community contact (Mayama et al., 1998
; Gessain et al., 1999
). Evidence to support non-sexual transmission of HHV-8 between mother and child and between siblings has been documented in African serological studies (Plancoulaine et al., 2000
). Passive transmission of maternal HHV-8 antibodies to the infant has also been demonstrated. However, HHV-8 seroprevalence in African children under 2 years of age is low, indicating vertical transmission of HHV-8 is not significant (Gessain et al., 1999
; Lyall et al., 1999
).
As both KS and HIV-1 infection are highly endemic in Malawi (Thomas, 2001
), we wanted to investigate the extent of non-sexual transmission of HHV-8 within family groups resident in this region. We describe here a molecular epidemiological study evaluating the transmission patterns of particular HHV-8 variants infecting families of known HHV-8-infected individuals. DNA sequences were amplified from two reported highly variable loci in the HHV-8 genome, the variable regions 1 and 2 (V1 and V2) of open reading frame (ORF) K1 (Cook et al., 1999
; Zong et al., 1999
).
Ethical approval was obtained prior to commencing this study from the Eastman Dental Institute (UK), University College London (UK) and the University of Malawi. Consecutive patients of the Central Hospital, Blantyre, Malawi, with presumptive cutaneous, oral and histologically confirmed nodal KS were invited to join the study. At presentation, all patients were offered palliative treatment with intravenous vincristine (2 mg/m2). Regardless of whether treatment was administered, patients were requested to return within a week with all available household members. During the return visit, blood and mouth rinse samples were taken from patients and from each family member.
HIV-1 seropositivity was confirmed by an IgG capture particle adherence test (Parry et al., 1995
), and HHV-8 seropositivity by the HHV-8 IgG IFA Kit (Advanced Biotechnologies Incorporated). This IFA utilizes the KS-1 cell line as a source of HHV-8, expressing both latent and lytic HHV-8 antigens on its cell surface. This highly specific and sensitive assay is appropriate for use in epidemiological studies (Chatlynne et al., 1998
).
DNA was extracted from the immunomagnetically selected CD45+ leukocyte fraction of blood, as described previously (Leao et al., 2000
). Study participants were asked to rinse with PBS and spit the rinse into a universal centrifuge tube. These samples were subsequently spun to separate the pellet from the cell-free fraction. DNA was extracted from 150 µl of mouth-rinse pellets by a guanidium thiocyanatesilica procedure (Boom et al., 1990
).
A 246 bp segment from the V1 region of ORF K1 (K1/V1; nt 573819) (Zong et al., 1999
) was amplified by a nested PCR, using as first-round primers 5' CCCTGGAGTGATTTCAACGC 3' (sense) and 5' ACATGCTGACCACAAGTGAC 3' (antisense), and as second-round primers 5' GAGTGATTTAACGCCTTAC 3' (sense) and 5' TGCTGACCACAAGTGACTGT 3' (antisense). Negative controls were included during extraction and PCR to control for possible contamination resulting from the nested PCR. Selected K1/V1 DNA-positive extracts were processed to amplify a 575 bp segment from the V2 region of ORF K1 (K1/V2) by hemi-nested PCR using LGH2088 and LGH2089 (Cook et al., 1999
) as first-round primers, and LGH2088 and K1/408/1 (Zong et al., 1999
) as second-round primers.
All K1/V1 and K1/V2 products were cloned using the TOPO TA cloning kit (Invitrogen). DNA of three to five clones from each product was sequenced, using the CEQ 2000 dye terminator cycle sequencing kit and capillary array automated sequencing system (Beckman Coulter). Raw DNA sequence data were analysed using SeqMan software (DNASTAR). Phylogenetic trees were generated in PHYLIP (Felsenstein, 1993
) using NEIGHBOR to construct a NEIGHBOR-joining tree from the DNA distance matrix generated in DNADIST. Bootstrapping for 1000 replicates is reported (as a percentage) at major branch points as a measure of confidence.
Twenty-two of the 24 patients with KS were HHV-8 seropositive. These 22 comprised the index cases (Table 1
). Sixty-seven family members of the index cases were enrolled into the study. Characteristics of the complete study group are shown in Table 1
.
|
2 test).
Of the 22 index patients, 5 (23%) were K1/V1 DNA positive in blood and 4 (18%) in oral rinses (Table 1
). HHV-8 DNA negativity in the blood in index cases was significantly associated with prior vincristine therapy (P=0·001) (
2 test). In the samples of 67 family members of patients with KS, K1/V1 DNA was positive in the oral rinse of 18 (27%) but not in any of the blood samples. ORF K1/V1 DNA was detected in the oral sample in the absence of HHV-8 seropositivity in four of the family members (B3, K1, R3 and X2).
This higher rate of HHV-8 detection in the mouth compared with blood substantiates previous observations of frequent oral carriage of HHV-8. In Zimbabwean women with KS, HHV-8 DNA could be detected in oral rinse samples as frequently as in blood (Lampinen et al., 2000
), and in homosexual men, infectious HHV-8 has been isolated at high titre in the saliva (Koelle et al., 1997
). RNA transcripts have been visualized in the buccal mucosa of homosexual men by in situ hybridization (Pauk et al., 2000
), suggesting active HHV-8 replication within the oral epithelium.
Oral and blood samples were extracted using different techniques and this may have negatively affected our ability to amplify ORF K1/V1 DNA from the blood. However, both sets of samples were processed within 4 h of collection and stored at -20 °C until extraction. Furthermore, immunomagnetically selected blood fraction samples are stable when stored and are readily amplified by PCR (Leao et al., 2000
). We suggest our inability to amplify ORF K1/V1 DNA from blood as opposed to mouth rinse samples was due to the increased frequency of carriage of HHV-8 in the oral compartment of HHV-8 antibody-positive persons without overt KS disease. In addition, we attribute the significant decrease in PCR detectability of ORF K1/V1 DNA in the blood of the index cases to vincristine therapy.
ORF K1/V1 DNA sequences could be compared in eight families (B, E, G, K, T, W, X and Z). Characteristic amino acid motifs in either the V1 or V2 regions of ORF K1 permitted subtyping (Zong et al., 1999
, 2002
). In areas of sub-Saharan Africa, ORF K1 subtypes A5 and B are most common (Lacoste et al., 2000
), and these two subtypes were predominantly represented in our sample set (Fig. 1a
).
|
Intra-family divergences of K1/V1 sequences were revealed in families B, E, T, W and X. Nucleotide divergence between family members ranged from 0·47% (between W1 and W2) to 27·7% (between X1 and X2). In all families except the B family, the sequences of all clones recovered from each sample were identical.
Within family B, there were two sequences recovered from B5 clones, designated B5(I) and B5(II). Subject B5 might have been dually infected with two HHV-8 variants, one A4 subtype virus [B5(I)] and one B1 subtype virus [B5(II)]. Recombination in HHV-8 viral strains recovered from African patients suggests dual infection may sometimes occur (Zong et al., 2002
). We were not able to consistently amplify the B5(I) sequence, and contamination from an external source cannot be ruled out.
Of the eight families studied for K1/V1 sequence diversity, K1/V2 DNA could be amplified from two or more members in six families. Sequence data were available for clones from B, E, T, G, K and W families, and comparisons could be made for all families other than family G (in which G1 sequence data could not be recovered). Sequencing was carried out on at least three clones for each sample; one to two nucleotide substitutions were observed between some clones. All clones with available sequence data were phylogenetically analysed (Fig. 1b
).
The disparate K1/V1 and K1/V2 sequences found between T2 and T3 demonstrated that these siblings were unlikely to have acquired HHV-8 infection from one another. ORF K1/V1 sequences recovered from X1 and his daughter, X2, belonged to different genotypes (A2 and B1, respectively) indicating no transmission linkage between each other. ORF K1/V1 sequences compared between W4, her father, W1, and brother, W2, differed by one or two amino acids. Nevertheless, intra-familial HHV-8 transmission via the mother (Wi), whose ORF K1 sequence was not available, is possible. In family E, recovered ORF K1/V1 sequences revealed minor nucleotide variations between E4, E5 and Ei/E6. However, only E4 carried a divergent amino acid sequence (Fig. 2
) and transmission from the mother, Ei, was possible in this family.
|
We found in our sample of Malawian families both patterns of HHV-8 sequence identity and non-identity among different members of the same family. Although our sample set was small, the data presented here indicated that patterns of transmission in endemic regions may be more complicated than that suggested by the mother-to-child model. Similar but not identical sequences were recovered both within and between families. Non-sexual transmission of prevailing HHV-8 variants within the population may result in the patterns we observed in this study.
These data also substantiate previous observations of early non-sexual HHV-8 acquisition in children living in endemic populations (Mayama et al., 1998
; Gessain et al., 1999
; Plancoulaine et al., 2000
). The higher rate of recovery of HHV-8 sequences from oral compared with blood samples suggests that oral secretions potentially act as vehicles of non-sexual horizontal spread. Thus, the control of HHV-8 infection and the KS epidemic cannot rely on community-wide environmental sterilization and disinfection. Reducing the size of the reservoir of infection by anti-viral treatment of infected persons is also impractical. The optimal route to control of KS in endemic regions would be through vaccination.
| Acknowledgments |
|---|
| Footnotes |
|---|
b Present address: The School of Pharmacy, University of London, 2939 Brunswick Square, London WC1N 1AX, UK. ![]()
| References |
|---|
|
|
|---|
Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M. & van der Noorda, N. J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.
Boshoff, C. & Weiss, R. A. (2001). Epidemiology and pathogenesis of Kaposis sarcoma-associated herpesvirus. Philosophical Transactions of the Royal Society of London Biological Sciences 356, 517-534.
Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposis sarcoma. Science 266, 1865-1869.
Chatlynne, L. G., Lapps, W., Handy, M., Huang, Y. Q., Masood, R., Hamilton, A. S., Said, J. W., Koeffler, H. P., Kaplan, M. H., Friedman-Kien, A., Gill, P. S., Whitman, J. E. & Ablashi, D. V. (1998). Detection and titration of human herpesvirus-8-specific antibodies in sera from blood donors, acquired immunodeficiency syndrome patients, and Kaposis sarcoma patients using a whole virus enzyme-linked immunosorbent assay. Blood 92, 53-58.
Cook, P. M., Whitby, D., Calabro, M. L., Luppi, M., Kakoola, D. N., Hjalgrim, H., Ariyoshi, K., Ensoli, B., Davison, A. J. & Schulz, T. F. (1999). Variability and evolution of Kaposis sarcoma-associated herpesvirus in Europe and Africa. AIDS 13, 1165-1176.[Medline]
Dukers, N. H., Renwick, N., Prins, M., Geskus, R. B., Schulz, T. F., Weverling, G. J., Coutinho, R. A. & Goudsmit, J. (2000). Risk factors for human herpesvirus 8 seropositivity and seroconversion in a cohort of homosexual men. American Journal of Epidemiology 151, 213-224.
Felsenstein, J. (1993). PHYLIP version 3.5c. University of Washington, Seattle, USA.
Gao, S. J., Kingsley, L., Hoover, D. R., Spira, T. J., Rinaldo, C. R., Saah, A., Phair, J., Detels, R., Parry, P., Chang, Y. & Moore, P. S. (1996). Seroconversion to antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposis sarcoma. New England Journal of Medicine 335, 233-241.
Gessain, A., Mauclere, P., van Beveren, M., Plancoulaine, S., Ayouba, A., Essame-Oyono, J. L., Martin, P. M. & de The, G. (1999). Human herpesvirus 8 primary infection occurs during childhood in Cameroon, Central Africa. International Journal of Cancer 81, 189-192.
Koelle, D. M., Huang, M. L., Chandran, B., Vieira, J., Piepkorn, M. & Corey, L. (1997). Frequent detection of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) DNA in saliva of human immunodeficiency virus-infected men: clinical and immunologic correlates. Journal of Infectious Diseases 176, 94-102.[Medline]
Lacoste, V., Judde, J. G., Briere, J., Tulliez, M., Garin, B., Kassa-Kelembho, E., Morvan, J., Couppie, P., Clyti, E., Forteza, V. J., Rio, B., Delmer, A., Mauclere, P. & Gessain, A. (2000). Molecular epidemiology of human herpesvirus 8 in Africa: both B and A5 K1 genotypes, as well as the M and P genotypes of K14.1/K15 loci, are frequent and widespread. Virology 278, 60-74.[Medline]
Lampinen, T. M., Kulasingam, S., Min, J., Borok, M., Gwanzura, L., Lamb, J., Mahomed, K., Woelk, G. B., Strand, K. B., Bosch, M. L., Edelman, D. C., Constantine, N. T., Katzenstein, D. & Williams, M. A. (2000). Detection of Kaposis sarcoma-associated herpesvirus in oral and genital secretions of Zimbabwean women. Journal of Infectious Diseases 181, 1785-1790.[Medline]
Leao, J. C., Kumar, N., McLean, K. A., Porter, S. R., Scully, C. M., Swan, A. V. & Teo, C. G. (2000). Effect of human immunodeficiency virus-1 protease inhibitors on the clearance of human herpesvirus 8 from blood of human immunodeficiency virus-1-infected patients. Journal of Medical Virology 62, 416-420.[Medline]
Lennette, E. T., Blackbourn, D. J. & Levy, J. A. (1996). Antibodies to human herpesvirus type 8 in the general population and in Kaposis sarcoma patients. Lancet 348, 858-861.[Medline]
Lyall, E. G., Patton, G. S., Sheldon, J., Stainsby, C., Mullen, J., OShea, S., Smith, N. A., de Ruiter, A., McClure, M. O. & Schulz, T. F. (1999). Evidence for horizontal and not vertical transmission of human herpesvirus 8 in children born to human immunodeficiency virus-infected mothers. Pediatric Infectious Disease Journal 18, 795-799.[Medline]
Martin, J. N., Ganem, D. E., Osmond, D. H., Page-Shafer, K. A., Macrae, D. & Kedes, D. H. (1998). Sexual transmission and the natural history of human herpesvirus 8 infection. New England Journal of Medicine 338, 948-954.
Mayama, S., Cuevas, L. E., Sheldon, J., Omar, O. H., Smith, D. H., Okong, P., Silvel, B., Hart, C. A. & Schulz, T. F. (1998). Prevalence and transmission of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents. International Journal of Cancer 77, 817-820.
Melbye, M., Cook, P. M., Hjalgrim, H., Begtrup, K., Simpson, G. R., Biggar, R. J., Ebbesen, P. & Schulz, T. F. (1998). Risk factors for Kaposis-sarcoma-associated herpesvirus (KSHV/HHV-8) seropositivity in a cohort of homosexual men, 19811996. International Journal of Cancer 77, 543-548.
Olsen, S. J., Chang, Y., Moore, P. S., Biggar, R. J. & Melbye, M. (1998). Increasing Kaposis sarcoma-associated herpesvirus seroprevalence with age in a highly Kaposis sarcoma endemic region, Zambia in 1985. AIDS 12, 1921-1925.[Medline]
Parry, J. V., Connell, J. A., Reinbott, P., Garcia, A. B., Avillez, F. & Mortimer, P. P. (1995). GACPAT HIV 1 + 2: a simple, inexpensive assay to screen for, and discriminate between, anti-HIV 1 and anti-HIV 2. Journal of Medical Virology 45, 10-16.[Medline]
Pauk, J., Huang, M. L., Brodie, S. J., Wald, A., Koelle, D. M., Schacker, T., Celum, C., Selke, S. & Corey, L. (2000). Mucosal shedding of human herpesvirus 8 in men. New England Journal of Medicine 343, 1369-1377.
Plancoulaine, S., Abel, L., van Beveren, M., Tregouet, D. A., Joubert, M., Tortevoye, P., de The, G. & Gessain, A. (2000). Human herpesvirus 8 transmission from mother to child and between siblings in an endemic population. Lancet 356, 1062-1065.[Medline]
Simpson, G. R., Schulz, T. F., Whitby, D., Cook, P. M., Boshoff, C., Rainbow, L., Howard, M. R., Gao, S. J., Bohenzky, R. A., Simmonds, P., Lee, C., de Ruiter, A., Hatzakis, A., Tedder, R. S., Weller, I. V., Weiss, R. A. & Moore, P. S. (1996). Prevalence of Kaposis sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen. Lancet 348, 1133-1138.[Medline]
Thomas, J. O. (2001). Acquired immunodeficiency syndrome-associated cancers in Sub-Saharan Africa. Seminars in Oncology 28, 198-206.[Medline]
Whitby, D., Howard, M. R., Tenant-Flowers, M., Brink, N. S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F. E., Aldam, D. M. & Denton, A. S. (1995). Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposis sarcoma. Lancet 346, 799-802.[Medline]
Ziegler, J. L. & Katongole-Mbidde, E. (1996). Kaposis sarcoma in childhood: an analysis of 100 cases from Uganda and relationship to HIV infection. International Journal of Cancer 65, 200-203.
Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S. & Hayward, G. S. (1999). High-level variability in the ORF-K1 membrane protein gene at the left end of the Kaposis sarcoma-associated herpesvirus genome defines four major virus subtypes and multiple variants or clades in different human populations. Journal of Virology 73, 4156-4170.
Zong, J., Ciufo, D. M., Viscidi, R., Alagiozoglou, L., Tyring, S., Rady, P., Orenstein, J., Boto, W., Kalumbuja, H., Romano, N., Melbye, M., Kang, G. H., Boshoff, C. & Hayward, G. S. (2002). Genotypic analysis at multiple loci across Kaposis sarcoma herpesvirus (KSHV) DNA molecules: clustering patterns, novel variants and chimerism. Journal of Clinical Virology 23, 119-148.[Medline]
Received 7 December 2001;
accepted 5 March 2002.
This article has been cited by other articles:
![]() |
J. Wojcicki, M. Mwanahamuntu, V. Minhas, B. Djokic, C. Kankasa, W. Klaskala, B. Brayfield, S. Phiri, C. Wood, and C. D. Mitchell Mortality among HIV-1- and Human Herpesvirus Type 8-Affected Mother-Infant Pairs in Zambia Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2238 - 2243. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stebbing, T. Powles, M. Nelson, and M. Bower Significance of Variation Within HIV, EBV, and KSHV Subtypes J Int Assoc Physicians AIDS Care (Chic Ill), September 1, 2006; 5(3): 93 - 102. [Abstract] [PDF] |
||||
![]() |
M. M. Brinkmann and T. F. Schulz Regulation of intracellular signalling by the terminal membrane proteins of members of the Gammaherpesvirinae. J. Gen. Virol., May 1, 2006; 87(Pt 5): 1047 - 1074. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.G. Teo Conceptual Emergence of Human Herpesvirus 8 (Kaposi's Sarcoma-associated Herpesvirus) as an Oral Herpesvirus Advances in Dental Research, April 1, 2006; 19(1): 85 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Webster-Cyriaque, K. Duus, C. Cooper, and M. Duncan Oral EBV and KSHV Infection in HIV Advances in Dental Research, April 1, 2006; 19(1): 91 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-S. Lee, S.-H. Lee, P. Feng, H. Chang, N.-H. Cho, and J. U. Jung Characterization of the Kaposi's Sarcoma-Associated Herpesvirus K1 Signalosome J. Virol., October 1, 2005; 79(19): 12173 - 12184. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Santos-Fortuna and A. Caterino-de-Araujo Confirming Shedding of Human Herpesvirus 8 in Urine from Infected Patients in Brazil J. Clin. Microbiol., February 1, 2005; 43(2): 1008 - 1008. [Full Text] [PDF] |
||||
![]() |
M. M. Beyari, T. A. Hodgson, W. Kondowe, E. M. Molyneux, C. M. Scully, S. R. Porter, and C. G. Teo Genotypic Profile of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus) in Urine J. Clin. Microbiol., July 1, 2004; 42(7): 3313 - 3316. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Duus, V. Lentchitsky, T. Wagenaar, C. Grose, and J. Webster-Cyriaque Wild-Type Kaposi's Sarcoma-Associated Herpesvirus Isolated from the Oropharynx of Immune-Competent Individuals Has Tropism for Cultured Oral Epithelial Cells J. Virol., April 15, 2004; 78(8): 4074 - 4084. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-S. Lee, M. Connole, Z. Tang, N. L. Harris, and J. U. Jung Structural Analysis of the Kaposi's Sarcoma-Associated Herpesvirus K1 Protein J. Virol., July 15, 2003; 77(14): 8072 - 8086. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |