J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jenson, H. B.
Right arrow Articles by Mackett, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jenson, H. B.
Right arrow Articles by Mackett, M.
Agricola
Right arrow Articles by Jenson, H. B.
Right arrow Articles by Mackett, M.
Journal of General Virology (2002), 83, 1621-1633.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Characterization of an Epstein–Barr virus-related gammaherpesvirus from common marmoset (Callithrix jacchus)

Hal B. Jenson1,2, Yasmin Ench1, Yanjin Zhang1, Shou-Jiang Gao1,2, John R. Arrand3 and Michael Mackett3

Departments of Pediatrics1 and Microbiology2, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900, USA
Paterson Institute for Cancer Research, Christie Hospital NHS Trust, Manchester, UK3

Author for correspondence: Hal Jenson (at Department of Pediatrics). Fax +1 210 567 6305. e-mail jenson{at}uthscsa.edu


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
A gammaherpesvirus related to Epstein–Barr virus (EBV; Human herpesvirus 4) infects otherwise healthy common marmosets (Callithrix jacchus). Long-term culture of common marmoset peripheral blood lymphocytes resulted in outgrowth of spontaneously immortalized lymphoblastoid cell lines, primarily of B cell lineage. Electron microscopy of cells and supernatants showed herpesvirus particles. There were high rates of serological cross-reactivity to other herpesviruses (68–86%), but with very low geometric mean antibody titres [1:12 to human herpesvirus 6 and 1:14 to Herpesvirus papio (Cercopithecine herpesvirus 12)]. Sequence analysis of the conserved herpesvirus DNA polymerase gene showed that the virus is a member of the lymphocryptovirus subgroup and is most closely related to a lymphocryptovirus from rhesus macaques and is closely related to EBV and Herpesvirus papio. High seroprevalence (79%, with geometric mean antibody titre of 1:110) among 28 common marmosets from two geographically distinct colonies indicated that the virus is likely present in many common marmosets in captivity. A New World primate harbouring a lymphocryptovirus suggests that this subgroup arose much earlier than previously thought.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Humans are the only known host for Epstein–Barr virus (EBV; Human herpesvirus 4), a ubiquitous gammaherpesvirus that is the principal cause of infectious mononucleosis and is also associated with several human tumours including Burkitt’s lymphoma, nasopharyngeal carcinoma, B cell lymphoproliferative disorders, Hodgkin’s disease and leiomyosarcomas (Niedobitek et al., 2001Down ). EBV-like viruses in closely related primates have been recognized for over 25 years including Herpesvirus gorilla (Pongine herpesvirus 3) (Neubauer et al., 1979Down ), Herpesvirus pan (Pongine herpesvirus 1) (Gerber et al., 1976Down ; Landon et al., 1968Down ), Herpesvirus pongo (Pongine herpesvirus 2) (Rabin et al., 1978Down ) and Herpesvirus papio (Cercopithecine herpesvirus 12) (Falk et al., 1976Down , 1977Down ), all belonging to the lymphocryptovirus subgroup of the gammaherpesvirus subfamily. More recently, lymphocryptoviruses have been identified in lymphoid tumours of several macaque species including cynomolgus macaque (Macaca fascicularis) (Hayashi et al., 1995Down , 1999Down ; Li et al., 1994Down ), stump-tailed macaque (Macaca arctoides) (Wutzler et al., 1995Down ), pig-tailed macaque (Macaca nemestrina) (Rivadeneira et al., 1999Down ) and rhesus macaque (Macaca mulatta) (Moghaddam et al., 1997Down , 1998Down ; Rangan et al., 1986Down ; Rivailler et al., 2002Down ). Various models for EBV-related lymphoid disease and infection have been developed from these findings. The incidence and prevalence of most of these viruses in wild or captive animals are not known, although the epidemiology of Herpesvirus papio in a large baboon colony is very similar to that of EBV in humans (Jenson et al., 2000Down ). All the host primate species for these lymphocryptoviruses are from the Old World. It has been speculated that the inability to develop authentic animal models for EBV in these species is due to the presence of endogenous infection with species-specific gammaherpesviruses and cross-reactive antibodies to EBV (Kalter et al., 1972Down ; Levy et al., 1971Down ). In contrast, New World monkey species, including the cotton-top tamarin (Sanguinus oedipus oedipus) (Epstein et al., 1985Down ), owl monkey (Aotus trivirgatus) (Epstein et al., 1973Down ) and common marmoset (Callithrix jacchus), develop B cell lymphoma upon challenge with EBV (Falk et al., 1976Down ).

The common marmoset is a New World monkey of the family Callitrichidae that, under experimental conditions, may be infected with EBV with a humoral response similar to that of humans and unlike the response to EBV infection of the cottontop tamarin or the owl monkey (Wedderburn et al., 1984Down ). Following EBV infection of common marmosets, EBV-associated tumours have been reported in some studies (Falk et al., 1976Down ) but not in others (Ablashi et al., 1978Down ). Several studies suggest the utility of this animal model for the development of EBV vaccines (Cox et al., 1996Down , 1998Down ; Mackett et al., 1996Down ; Wedderburn et al., 1984Down ), although difficulties have been encountered in the serological assessments of EBV infection.

Previously, gammaherpesviruses were believed to infect only humans and Old World primates. A gammaherpesvirus, Callitrichine herpesvirus 3, closely related to EBV has been identified in common marmosets in association with fatal lymphoproliferative disease (Ramer et al., 2000Down ) and lymphoma (Cho et al., 2001Down ). We characterize 10 new isolates of gammaherpesviruses present in healthy common marmosets without disease. We report the apparently widespread epidemiology of this virus in two captive common marmoset colonies and demonstrate the close serological and genomic relationship of this virus to EBV and other lymphocryptoviruses.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cell cultures for spontaneous lymphoblastoid cell lines.
Plasma and peripheral blood mononuclear cells (PBMCs) were obtained from a total of 28 common marmosets (Callithrix jacchus), including 12 animals from Charles River Primates, Inc., Houston, TX, USA, and 16 animals from the Wisconsin Regional Primate Research Center, Madison, WI, USA. All of the animals were adults (>15 months for common marmosets) from 21–37 months old, approximately 240–260 g in body weight, born and raised in captivity in the respective colonies. PBMCs from 16 animals were separated using Histopaque 1077 (Sigma), washed twice and resuspended with 5 ml RPMI-1640 (Gibco/Invitrogen) supplemented with 20% foetal bovine serum (FBS; HyClone), 1·5% glutaMAX-1 (Gibco/BRL Life Technologies), 50 µg/ml gentamicin (Sigma), 5 µg/ml Fungizone (Sigma) and 0·2 µg/ml cyclosporin (Sandimmune, Novartis). PBMC from the remaining 12 animals were separated and frozen in cryoprotective medium (above medium with 50% FBS and 10% DMSO) until EBV serologies were performed.

Generation of spontaneous cell lines from PBMCs of 24 marmosets was attempted (cells from animals 57, 184, 244 were not tested because these animals were seronegative; animal 11344 was attempted but lost in culture) by incubation at 37 °C with 5% CO2 with replacement of half of the volume of medium every 3–4 days. Viable cell counts were performed by trypan blue exclusion after 8 weeks in culture and then periodically while cells remained viable. Cultures with no viable cells at 10 weeks were discarded. Cultures with spontaneously immortalized cells were diluted to a starting density of 5x105 cells/ml and passaged every 5–6 days in RPMI-1640 supplemented with 10% FBS and no cyclosporin.

Standard cell lines as the source for EBV included B95-8, HR-1K and Raji cells. Human herpesvirus 6 (HHV-6) strain DV (Salahuddin et al., 1986Down ) was used to infect HSB-2 cells. Herpesvirus papio was from the 594S-1X1055 cell line, which was derived by infection of peripheral mononuclear cells of a Papio anubis baboon (1X1055) with virus in supernatant from a spontaneous cell line derived from the spleen of a female Papio hamadryas baboon with lymphoreticular hyperplasia (Rabin et al., 1977Down ).

{blacksquare} Immortalization of marmoset lymphocytes by EBV.
PBMCs from seven animals with no or low detectable EBV antibody were infected in vitro with EBV (strain B95-8) (Jenson & Ench, 2002Down ). Cells were pelleted and 3·6–6·4x106 cells were incubated with 106·7 TD50 filtered EBV (strain B95-8) in 1 ml medium. Virus was allowed to adsorb to the cells for 90 min at 37 °C in 5% CO2, after which growth medium containing 0·2 µg/ml cyclosporin was added and the cultures were maintained for evidence of cell immortalization. Seven immortalized cell lines (designated M57/B95-8, M184/B95-8, M244/B95-8, M11340/B95-8, M11344/B95-8, M11345/B95-8, M11348/B95-8) were derived, including six cell lines from common marmosets that were seronegative for EBV and Herpesvirus papio (animals 57, 184, 244, 11340, 11344, 11345) and one cell line from a common marmoset that had an antibody titre of 1:5 to EBV and Herpesvirus papio (11348).

{blacksquare} Electron microscopy.
Five uninduced, spontaneously immortalized common marmoset cell lines (M11342, M11347, M12014, M12016, M12017) were washed twice in PBS and pelleted at 300 g for 5 min. To enhance herpesvirus replication, the spontaneous lymphoblastoid cell line from marmoset M117 was treated with the phorbol ester 12-O-tetradecanoyl phorbol-13-acetate (TPA), a known inducer of EBV (zur Hausen et al., 1978Down ), at 20 ng/ml for 8 days and supernatant was concentrated at 40000 g for 2 h at 4 °C. Two induced, spontaneously transformed cell lines, M11341 and M11342, were pelleted after 8 days of TPA treatment. Cell and virus pellets were resuspended in 1 ml phosphate-buffered 4% formaldehyde/1% glutaraldehyde (pH 7·4), pelleted, fixed with a modified Karnovsky fixative for 2 h and rinsed in 0·1 M phosphate buffer (pH 7·4). The pellet was then treated with 1% osmium tetroxide for 30 min at room temperature and dehydrated through a series of graded ethanol washes, with a final dehydration of two changes of propylene oxide for 10 min each. Infiltration was achieved with 1:1 propylene oxide/PolyBed 812 resin for 30 min at room temperature, followed by a final infiltration of 100% PolyBed 812 under vacuum (25 p.s.i.) for 30 min. The samples were incubated at 70 °C overnight for polymerization.

Blocks were sectioned using a Sorvall MT 5000 ultramicrotome for the uninduced cell lines and a Leica Ultracut microtome for the induced cell lines. Ultrathin sections (75 nm) were collected on a 150 mesh copper grid and stained with saturated aqueous uranyl acetate and Reynold's lead citrate. Photographs were taken using a JEOL 100CX electron microscope and a Philips EM208S electron microscope (FEI).

{blacksquare} Immunophenotyping.
Spontaneously immortalized marmoset cells and freshly isolated PBMCs were tested by FACS, or flow cytometry, for cell-surface markers CD2-FITC, CD3-FITC, CD4-FITC, CD8-FITC, CD11b-RPE, CD19-RPE, CD20-RPE and CD56-RPE (Becton-Dickinson).

{blacksquare} PCR, DNA sequencing and Southern blotting.
In order to determine whether herpesvirus genomic sequences were present in the cell lines and to further classify these as alpha-, beta- or gammaherpesvirus, two 5' degenerate primers [DFASA, 5' GTGTTCGACTT(CT)GC(ACGT)AG(CT)(CT)T(ACGT)TA(CT)CC 3'; VYGA, 5' ACGTGCAACGCGGTGTA(CT)GG(ACGT)(GT)T(AGCT)AC(AC-GT)GG 3'] and one 3' primer [GDTB1B, 5' CGGCATGCGACAAACACGGAGTC(ACGT)GT(AG)TC(ACGT)CC(AG)TA 3'] were synthesized, corresponding to a highly conserved region of the DNA polymerase gene of herpesviruses (Rose et al., 1997Down ). The DFASA/GDTD1B PCR product, since the larger product would provide more sequence information, from marmoset cell lines M117, M12017 and M11347 was amplified by PCR, separated from unincorporated nucleotides by centrifugation using a Centricon-100 column (Amicon) and cloned into a T-vector (Helena Biosciences). Plasmid DNA was prepared using Qiagen plasmid midicolumns and sequenced using a Big Dye Terminator sequencing kit on an ABI 373-S sequencer (PE Biosystems). The DNA sequences were assembled and analysed with the Wisconsin Package (version 10.0, Genetics Computer Group). This DNA sequence has been deposited with GenBank (AF291653).

Based on the results of DNA sequencing of PCR products from EBV B95-8 cells and M11347 common marmoset cells, additional PCR primers were synthesized that were specific for EBV (Baer et al., 1984Down ) (B95-8 m1, 5' AGGGCCTGCAGGTTGGCG 3', at positions 154549–154566 of B95-8; B95-8 m2, 5' ACGCCGGGAGAAGAGCAC 3', at positions 154934–154917 of B95-8) and the new marmoset virus (Marm1, 5' AGTTTCTCTAAATCTGTAA 3'; Marm2, 5' ACGCCGGGANAAGAAGGG 3'). The B95-8 primer sequences were chosen to maximize the difference between EBV and the new marmoset virus. The ‘N’ nucleotide in the Marm2 primer was because of uncertainty of this base in the initial DNA sequencing.

The corresponding Herpesvirus papio DNA polymerase sequence was obtained from the PCR products of DNA from the 594S-1X1055 cell line using the primers DFASA/GBTB1B followed by direct sequencing using the GBTB1B primer (Rose et al., 1997Down ).

To exclude the presence of concomitant EBV infection, either endogenous virus in the animals or possibly resulting from laboratory contamination, DNA was prepared from cell lines M11347, M11346 and M12017 and analysed for the presence of EBV BamHI W by PCR, using primers W-1 and W2-b, and Southern blotting (McClain et al., 1995Down ).

{blacksquare} Serological testing and cross-reactivity.
Plasma from all 28 animals was tested by indirect immunofluorescence assay (IFA) for antibodies to the common marmoset virus (using the spontaneously immortalized cell line M11349 treated with TPA) and for cross-reacting antibodies to EBV (using TPA-treated B95-8, HR-1K and Raji cells), HHV-6 (using HSB-2 cells infected with HHV-6 strain DV) and Herpesvirus papio (using the 594S-1X1055 cell line).

{blacksquare} Antibodies to common marmoset herpesvirus.
Cells of the spontaneously immortalized marmoset cell line M11349 were treated with 20 ng/ml TPA, incubated for 5 days and fixed on glass slides with acetone for 5 min. Sera for all marmosets were diluted 1:5 to 1:1280 and incubated with fixed cells for 45 min followed by incubation with anti-human IgG–FITC (BioSource International) for 30 min.

{blacksquare} Antigen cross-reaction with EBV.
All spontaneously immortalized marmoset cell lines and the EBV-immortalized marmoset cell line M244/B95-8 were tested for cross-reaction with EBV latent and lytic antigens. Monoclonal antibodies (mAbs) were used to EBV p160, gp125, EA-D (p50), EA-R (p85) and gp350 (membrane antigen) in an IFA (Advanced Biotechnologies Inc.) (Jenson et al., 1999Down ; Jenson & Ench, 2002Down ). Normal mouse IgG (Sigma) was used as a negative antibody control. Goat F(ab')2 anti-mouse IgG (light chain-specific) conjugated to FITC (Biosource International) was used at a 1:100 dilution.

mAbs to LMP-1 (Vector Laboratories), EBNA1 (Advanced Biotechnologies, Inc) and EBNA2 (Vector Laboratories) were used in an amplified IFA with biotin and streptavidin. Biotinylated horse anti-mouse IgG (Vector Laboratories) was used as the second antibody followed by fluorescein–streptavidin conjugate (Vector Laboratories) was used as the second antibody. Mouse IgG1 {kappa} (Sigma) was used as a negative control.

{blacksquare} Serological cross-reaction with HHV-6.
HSB-2 cells infected with HHV-6 strain DV (Salahuddin et al., 1986Down ) were used to detect cross-reacting antibodies to HHV-6 in marmosets. Infected and uninfected cells were washed twice with PBS, spotted on glass slides, air-dried, fixed with cold acetone for 5 min and stored at -20 °C until assayed by indirect IFA (Brown et al., 1988Down ). Marmoset serum or plasma was diluted in PBS and incubated for 45 min at 37 °C on fixed cells followed by an incubation with 1:250-diluted anti-human IgG–FITC (BioSource International) and processed as described for EBV antibodies.

{blacksquare} Serological cross-reaction with Herpesvirus papio.
Acetone-fixed smears of the 594S-1X1055 cell line (Rabin et al., 1977Down ) were used in an indirect IFA to detect cross-reacting antibodies in marmosets to Herpesvirus papio (Jenson et al., 2000Down ; Jenson & Ench, 2002Down ).

{blacksquare} EBV receptor (CD21) and CD23.
Acetone-fixed immortalized PBMCs from marmosets M117, M11341, M11346 and M12017 were assayed by IFA for human CD21 (OKB7; Ortho Diagnostics) (Nemerow et al., 1985Down ), the EBV receptor, and CD23 (DAKO) (Thorley-Lawson et al., 1985Down ), which is strongly expressed on EBV-transformed B lymphoblasts, using the biotin–streptavidin procedure.

{blacksquare} Immortalization of human lymphocytes by common marmoset herpesvirus.
Supernatants from cell cultures of three spontaneously immortalized common marmoset cell lines (M11342, M11347, M12014) were tested in a transformation assay for immortalization of human umbilical cord lymphocytes (Lennette, 1995Down ). Supernatants were filtered (0·22 µm), ultracentrifuged (100000 g) for 2 h and then inoculated onto human umbilical cord lymphocytes (3·3x106 cells in 2 ml medium). Cultures were fed twice weekly and observed for 10 weeks. Controls included supernatant from EBV B95-8 cells and human umbilical cells without virus.

{blacksquare} DNA and protein sequence comparisons.
Deduced amino acid sequences of the partial DNA polymerase gene of the new marmoset virus and other herpesviruses were aligned with Lasergene 99 (DNASTAR Inc.). In order to establish the genetic relationship of the new marmoset virus with other human and primate herpesviruses, we undertook a phylogenetic analysis by comparing the sequenced fragment of the DNA polymerase gene with sequences from other herpesviruses using the program PAUP (Sinauer Associates, Sunderland, MA). A majority-rule consensus tree was computed from 100 bootstrap replications.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Cell cultures for spontaneous lymphoblastoid cell lines
Cultures of common marmoset PBMCs were evaluated weekly. Viable cell counts in the non-immortalized cell cultures decreased steadily over time. This occurred as early as 12 weeks (animals 11343 and 11348) or as late as 31 weeks (animals 11340, 11345 and 12015). The latter three cultures were held for 31 weeks because the remaining cells in these cultures were still viable although the total cell count decreased over time.

Spontaneously immortalized common marmoset cell lines were derived from 10 animals, including nine from marmosets from the Wisconsin Regional Primate Center (11341, 11342, 11346, 11347, 11349, 11350, 12014, 12016 and 12017) and one (117) from a marmoset from Charles River Primates, Inc. (Table 1Down). In contrast to the non-immortalized cell lines, these spontaneously immortalized cell lines showed significant increases in viable cell counts with appearance similar to the B95-8 lymphocyte cell line (Miller et al., 1972Down ), the prototypic EBV-infected marmoset cell line (Fig. 1ADown, BDown).


View this table:
[in this window]
[in a new window]
 
Table 1. Antibody titres in 28 common marmosets against the common marmoset herpesvirus, EBV, HHV-6 and Herpesvirus papio

 


View larger version (123K):
[in this window]
[in a new window]
 
Fig. 1. Microscopy of spontaneously immortalized common marmoset cell lines. (A) Phase-contrast microscopy of cell line M11349 showed that the majority of cells grew in suspension with occasional large clumps of cells characteristic of cells infected with gammaherpesviruses. (B) After TPA induction (at 6 days), the majority of cells become adherent to the flask, similar to the EBV-infected marmoset cell line B95-8. Original magnification: x120. (C) Electron microscopy of a cell from cell line M11341 after TPA induction showed numerous cytoplasmic icosadeltahedron structures characteristic of the herpesvirus nucleocapsid. Original magnification: x100000. Enveloped viruses were also identified by electron microscopy in concentrated supernatant (not shown).

 
Spontaneous transformation in the immortalized cell lines was demonstrated as early as 6–8 weeks by changes in cell morphology and growth characteristics similar to those seen in spontaneous immortalization of human PBMCs infected with EBV. Clumping of rapidly dividing cells was evident in all these cell lines, as was acid production in the cell culture medium and the appearance of blast-like cells. Some adherent cells with fibroblast-like shape were also apparent in some cultures, similar to the morphology of the B95-8 cell line (Miller et al., 1972Down ). There was a gradual increase in cell counts as the cell lines continued to proliferate, and the concentration of FBS was reduced from 20 to 10% without any adverse effect on growth. The resulting cell lines continued to proliferate.

The incubation period necessary to identify spontaneous immortalization of the marmoset cell lines extended to several weeks: three cultures (M11346, M11347 and M12017) showed immortalization at 9 weeks, two cultures (M11349 and M11350) at 12 weeks and at approximately 20 weeks for the remainder (M117, M11341, M11342, M12014 and M12016). All of these spontaneously immortalized cell lines have been passaged through at least 10 passages, while some are at passage 30 with continued growth similar to EBV-immortalized human lymphocyte cell lines.

TPA treatment of the cultures resulted in the majority of the cells adhering to the flask with a few cells remaining in clumps.

Electron microscopy
Cells from five transformed, uninduced marmoset cell lines (M11342, M112347, M12014, M12016 and M12017) were examined by electron microscopy. No virus was seen in these uninduced cell lines. Electron microscopy of cells from the spontaneously transformed common marmoset cell lines M11341 and M11342 after TPA induction showed numerous cytoplasmic icosadeltahedron structures characteristic of the herpesvirus nucleocapsid (Fig. 1CUp). Concentrated supernatant (from M117) revealed scattered similar virus particles with a nucleocapsid surrounded by an amorphous tegument and envelope, which is characteristic of herpesviruses (data not shown).

Immunophenotyping
The cells infected by the common marmoset herpesvirus were primarily B cells. Spontaneously transformed common marmoset cell lines showed comparatively mild diversity of CD expression: 2·5–7·0% CD3 in five of eight cell lines; 2·4–3·0% CD11b in three cell lines; 2% of CD2, CD3 and CD8 each in one cell line; and 2–4% of CD56 in two cell lines. By comparison, marmoset cells transformed with EBV strain B95-8 showed only 2% CD11b in one of six cell lines, but CD56 was detected in all six cell lines (mean 34·4%; range 9·5–56%).

Immortalization of marmoset lymphocytes with EBV
All seven cultures of PBMCs from the marmosets inoculated with EBV B95-8 yielded immortalized marmoset cell lines (designated M57, M184, M244, M11340, M11344, M11345, M11348). The morphological characteristics of these PBMCs from seronegative marmosets that were transformed in vitro were similar to those of the spontaneously immortalized marmoset cells. EBV-immortalized marmoset cells showed signs of transformation (i.e. rapid growth, clumps and acid medium) 15–21 days after infection compared with the 9–20 weeks for the spontaneous marmoset cell lines. All seven of these cell lines showed signs of immortalization in less than 4 weeks of culture.

PCR, DNA sequencing and Southern blotting
Both the DFASA/GDTD1B and VYGA/GDTD1B primer sets (Rose et al., 1997Down ) gave positive signals in all five cells tested (M117, M12017, M11341, M11346, M11347) by PCR, with expected products of 536 and 236 bp, respectively. Stronger signals were observed using VYGA/GDTD1B. Since the larger PCR product from the primer pair DFASA/GDTD1B would provide more sequence information, these primers were used for PCR from the marmoset cell lines M117, M12017 and M11347 followed by T-cloning. Approximately 10 clones from two independent cloning experiments were sequenced using standard forward and reverse primers. There were no ambiguities and the sequences of the PCR products from all three cell lines were identical (Fig. 2Down).



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2. (A) Comparison of 364 bp of the DNA sequence of DNA polymerase (BALF5) from EBV (Human herpesvirus 4) strain B95-8 (coordinates 154559–154922; Baer et al., 1984Down ) to the corresponding DNA sequences of the polymerase gene of the new common marmoset herpesvirus, Callitrichine herpesvirus 3, and Herpesvirus papio (Cercopithecine herpesvirus 12) (306 bp). The DNA sequences of the three common marmoset isolates that were sequenced (M117, M12017 and M11347) were identical. The EBV B95-8 DNA sequence is shown as the consensus sequence, with only the differences of the new common marmoset herpesvirus (above) and Herpesvirus papio (below) indicated. (B) Comparison of the 121 aa deduced amino acid sequence translated from 363 bp of the DNA polymerase gene of the common marmoset virus, Callitrichine herpesvirus 3, with that of the equivalent sequences of DNA polymerase (BALF5) from EBV (Human herpesvirus 4) strain B95-8 (coordinates 154559–154922; Baer et al., 1984Down ) and the overlapping 303 bp (101 amino acids) of Herpesvirus papio (Cercopithecine herpesvirus 12) that has been sequenced. Vertical lines indicate identical amino acids. Double dots indicate conservative amino acid differences.

 
Because this region of the DNA polymerase sequence of Herpesvirus papio was not available, a PCR of Herpesvirus papio-immortalized baboon lymphocyte cell line 594S-1X1055 was performed using primers DFASA and GDTB1B and the product was T-cloned and sequenced. The common marmoset virus and Herpesvirus papio had 74% identity in this region of DNA polymerase (Fig. 2Up).

PCR using the EBV primers gave a strong signal from B95-8 cells and faint signals from Herpesvirus papio 594S-1X10555 and the five marmoset cell lines tested (M117, M11341, M11346, M11347, M12017). The Marm1 and Marm2 PCR primers detected an identically sized amplification from all five common marmoset cell lines tested but not from EBV B95-8 or Herpesvirus papio 594S-1X10555 (data not shown).

Supernatants from spontaneously immortalized marmoset cell lines (M11346, M11347, M12017) from three different marmosets and from 7-week-old cell cultures showing no signs of immortalization from 15 different marmosets (M11341, M12014, M12015, M11339, M11340, M11343, M11342, M12016, M12017, M11345, M11346, M11347, M11348, M11349, M11350) were assayed by PCR in duplicate for EBV using primers for the internal repeat, BamHI W (data not shown). All supernatants except one of two lanes of M11347 were negative for EBV (data not shown). Six immortalized PBMC cell lines were also assayed for EBV by PCR. Three cell lines (M11346, M11347 and M12017) with common marmoset-immortalizing virus were negative for EBV, while three marmoset cell lines immortalized by EBV (M57, M184, M244) were positive for EBV (Fig. 3Down). Southern blotting of total intracellular DNA from spontaneously immortalized marmoset cell lines was negative using EBV BamHI W as a probe (data not shown).



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. PCR amplification in two different types of cell lines harbouring the common marmoset virus, Callitrichine herpesvirus 3. PCR detected sequences of EBV BamHI W in: (i) spontaneously transformed common marmoset cells from three animals (M11346, M11347, M12017) and (ii) EBV strain B95-8-immortalized cells from three animals (M57, M244, M184). The EBV cell line B95-8 is a positive control. Faint signals were detected in spontaneously transformed common marmoset cells, with strong signals to EBV BamHI W from the B95-8-immortalized common marmoset cells.

 
Serological testing and antigen cross-reactivity
Antibodies to common marmoset virus.
Twenty-two of the 28 marmosets had antibodies to the common marmoset virus detected by IFA using the spontaneously immortalized cell line M11349 (Fig. 4Down), with positive antibody titres ranging from 1:10 to 1:1280 (Table 1Up). All of the 10 spontaneously immortalized marmoset cell lines were derived from animals with antibodies to this herpesvirus.



View larger version (153K):
[in this window]
[in a new window]
 
Fig. 4. Detection of antibodies in marmoset sera to the common marmoset herpesvirus, Callitrichine herpesvirus 3, by IFA using the spontaneously transformed M11349 common marmoset cell line. Cells were treated with 20 ng/ml TPA and, after 5 days, were fixed with acetone. At a serum dilution of 1:10, 22 of 28 (79%) common marmosets had detectable antibodies (A) to this herpesvirus, with a geometric mean titre of 1:110. A negative reaction with serum from a seronegative common marmoset (M11340) is also shown (B). The distribution and appearance of positive cells are similar to that seen with EBV antibody-positive serum and EBV-positive cells (Jenson & Ench, 2002Down ). Original magnification: x250.

 
Serological cross-reaction with EBV.
Of the 28 common marmosets, 19 (68%) had cross-reacting antibodies to EBV strain B95-8 and 23 (82%) had cross-reacting antibodies to EBV strain HR-1K (Table 1Up). None of the animals had detectable antibodies to EBV EA or EBNA.

There was no cross-reaction of non-stimulated, spontaneously immortalized marmoset PBMCs with mAbs to EBV MA (gp350), EA-D (p50), EA-R (p85), VCA (p160), LMP, EBNA-1 or EBNA-2. However, approximately 10% of the cells from each cell line did cross-react with mAb to EBV VCA (gp125) (Fig. 5Down). Two of the spontaneously immortalized marmoset cell lines (11349 and 12014) were treated with TPA (20 ng/ml) for 8 days. For both cell lines, the percentage of cross-reacting cells to EBV VCA (gp125) increased from approximately 10% to approximately 20%, and approximately 10% of the total cells showed a weak positive reaction with VCA (p160).



View larger version (126K):
[in this window]
[in a new window]
 
Fig. 5. Detection of common marmoset herpesvirus antigens that cross-react with EBV antigens. Cells of the spontaneously immortalized common marmoset cell line M11349 before induction with TPA were stained with (A) mAb to EBV VCA (gp125) and (B) mAb to EBV VCA (p160) after induction with TPA. The EBV VCA (p160) was not detected without TPA induction (not shown). Original magnification: x400.

 
The common marmoset cell line immortalized in vitro with EBV strain B95-8, M244/B95-8, was positive for antigen expression using each of the EBV mAbs (Fig. 6Down), confirming that EBV can infect and transform common marmoset lymphocytes. EBNA-1 was present as weak immunofluorescence in all cells, EBNA-2 was present as strong immunofluorescence in approximately 10% of cells and weak immunofluorescence in approximately 50% of cells and LMP1, EA-D, EA-R, VCA gp125, VCA p160 and membrane antigen gp350/220 were present as strong immunofluorescence in approximately 10% of cells.



View larger version (126K):
[in this window]
[in a new window]
 
Fig. 6. Detection of EBV antigens in M244/B95-8, peripheral blood cells from an adult marmoset (M244) immortalized with EBV strain B95-8. The cells spontaneously expressed several EBV antigens: (A) VCA (gp125); (B) VCA (p160); (C) EA-D (p50); (D) EA-R (p85); (E) MA (gp350/220); (F) LMP; (G) EBNA-1, which was present as weak immunofluorescence in all cells; and (H) EBNA-2, which was present as strong immunofluorescence in approximately 10% of cells and weak immunofluorescence in approximately 50%. Original magnification: x400.

 
Serological cross-reaction with HHV-6.
There was a high prevalence of cross-reactive antibodies with HHV-6 (Table 1Up). Of the 28 common marmosets, 24 (86%) were seropositive with a geometric mean titre of 1:14 in the 24 seropositive animals.

Serological cross-reaction with Herpesvirus papio.
There was a high but relatively lower prevalence of detectable serological cross-reactivity with Herpesvirus papio (Table 1Up). Of the 28 common marmosets, 20 (71%) were seropositive, with a geometric mean titre of 1:12 in the 20 seropositive animals.

CD21 and CD23.
No specific immunofluorescence was seen with either mAb against CD21 or CD23 in the four marmoset cell lines tested. The control cells Raji, MOLT-4 and HSB-2 showed the expected results, with positive staining for CD21 and CD23 in Raji, weak staining for CD21 and absence of CD23 in MOLT-4 and absence of both in HSB-2 (data not shown).

Immortalization of human lymphocytes with marmoset virus
None of the three supernatants from cell cultures of common marmoset lymphoblastoid cell lines that were tested for immortalization of human umbilical cord lymphocytes demonstrated immortalization after 8–10 weeks. The marmoset cells were not treated with TPA and, therefore, the amount of lytic virus may have been relatively low. However, approximately 10% of uninduced cells cross-reacted with lytic EBV antigens, suggesting a significant level of spontaneous lytic replication and virus production. Control immortalization of human lymphocytes with EBV strain B95-8 was positive.

DNA and protein sequence comparisons
DNA sequence alignment showed that the common marmoset virus shared 75% DNA and 83% amino acid sequence identify with EBV strain B95-8 (Fig. 2Up). Phylogenic analysis based on the 364 bp DNA polymerase gene sequences of herpesviruses was performed to generate a consensus tree (Fig. 7Down). These herpesviruses were clearly divided into three different groups in the phylogram, with all gammaherpesviruses in one branch. The common marmoset herpesvirus formed a sub-branch with rhesus lymphocryptovirus (Cercopithecine herpesvirus 15) (Moghaddam et al., 1997Down ; Rivailler et al., 2002Down ), to which it was most closely related, but it was also closely related to EBV (Human herpesvirus 4) and Herpesvirus papio (Cercopithecine herpesvirus 12). Herpesvirus papio was more closely related to EBV than either of these other two lymphocryptoviruses (McGeoch et al., 2000Down ).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 7. Phylogenetic analysis of the partial DNA polymerase gene sequences of the common marmoset gammaherpesvirus, Callitrichine herpesvirus 3, and other herpesviruses. The division of herpesviruses into subfamilies Alphaherpesvirinae ({alpha}), Betaherpesvirinae ({beta}) and Gammaherpesvirinae ({gamma}) is shown. GenBank accession numbers are shown in parentheses. The majority-rule consensus tree was computed from 100 bootstrap replications. This tree was computed using parsimony and therefore the scale value of 10 means 10 steps. The DNA polymerase sequences of these three isolates (M117, M12017 and M11347) were identical to each other and also identical to sequences of viruses (Callitrichine herpesvirus 3, CalHV-3) isolated from common marmosets with B cell lymphomas, which have been sequenced partially (AF091055; Ramer et al., 2000Down ) or completely (AF319782; Cho et al., 2001Down ). The sequence of common marmoset virus CalHV-3 (AF291653) was most closely related to that of rhesus lymphocryptovirus (Cercopithecine herpesvirus 15) (AY037858; Rivailler et al., 2002Down ). The sequence of Herpesvirus papio (Cercopithecine herpesvirus 12) (Fig. 2Up) was most similar to EBV (V01555). The herpesviruses analysed included RRV17577 (Macaca mulatta rhadinovirus 17577; a member of Cercopithecine herpesvirus 17), RRV/H26-95 (rhesus monkey rhadinovirus H26-95; a member of Cercopithecine herpesvirus 17), MGVMn (macaque gamma virus strain Macaca nemestrina), MneRV2 (Macaca nemestrina rhadinovirus 2), MGVMf (macaque gamma virus strain Macaca fascicularis), MndRHV2 (Mandrillus rhadino-herpesvirus 2), ChRV2 (Chlorocebus rhadinovirus 2), PanRHV2 (Pan rhadino-herpesvirus 2), RFHV-mM (retroperitoneal fibromatosis-associated herpesvirus – Macaca mulatta; Cercopithecine herpesvirus 19), MndRHV1 (Mandrillus rhadino-herpesvirus 1), RFHV-Mn (retroperitoneal fibromatosis-associated herpesvirus – Macaca nemestrina; Cercopithecine herpesvirus 18), ChRV1 (Chlorocebus rhadinovirus 1), PanRHV1 (Pan rhadino-herpesvirus 1), KSHV (Kaposi’s sarcoma-associated herpesvirus; Human herpesvirus 8), GorRHV1 (gorilla rhadinovirus 1), AHV1 (Alcelaphine herpesvirus 1), OHV1 (Ovine herpesvirus 2), PLHV-1 (porcine lymphotropic herpesvirus 1), PLHV-2 (porcine lymphotropic herpesvirus 2), HVS (Herpesvirus saimiri; Saimiriine herpesvirus 2), HVA3 (Ateline herpesvirus 3), MHV-68 (murine herpesvirus 68; Murid herpesvirus 4), EHV2 (Equid herpesvirus 2), BLHV (bovine lymphotropic herpesvirus; Bovine herpesvirus 6), BHV4 (Bovine herpesvirus 4), HVP (Herpesvirus papio; Cercopithecine herpesvirus 12), RhLCV (Cercopithecine herpesvirus 15), MndCMV (Mandrillus cytomegalovirus), RhHV5 (rhesus cytomegalovirus; Cercopithecine herpesvirus 8), HCMV (human cytomegalovirus; Human herpesvirus 5), MCMV (mouse cytomegalovirus; Murid herpesvirus 1), HHV7 (Human herpesvirus 7), MndHV{beta} (Mandrillus herpesvirus beta), HHV6 (Human herpesvirus 6), HSV-1 (Herpes simplex virus 1; Human herpesvirus 1), HSV-2 (Herpes simplex virus 2; Human herpesvirus 2), PRV (pseudorabies virus; Suid herpesvirus 1), GHV2 (Gallid herpesvirus 2), EHV1 (Equid herpesvirus 1) and BHV1 (Bovine herpesvirus 1).

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Several lines of morphological and molecular evidence support the presence of a new lymphocryptovirus in the immortalized cell cultures established from PBMCs of common marmosets. Firstly, there was development of typical lymphoblastoid cell lines following immortalization by the new virus, a phenomenon characteristic of other gammaherpesviruses. Secondly, the partial DNA sequence of the DNA polymerase gene was distinct from other identified herpesviruses, but had high similarity to sequences from several other gammaherpesviruses. Thirdly, virions with typical herpesvirus structure were identified by electron microscopy in cells and also in culture supernatants following TPA induction. Fourthly, currently recognized gammaherpesviruses were not detected in the cultures by DNA hybridization and PCR assays. Finally, there was low but significant antigen cross-reactivity with other herpesviruses, similar to that seen between other recognized gammaherpesviruses (Jenson, 2000Down ). The cross-reactivity in these animals was similar in prevalence and titre to previous reports of EBV cross-reacting antibodies in common marmosets (de-Thé et al., 1980Down ; Kalter et al., 1972Down ). This virus has been tentatively designated Callitrichine herpesvirus 3 (Ramer et al., 2000Down ).

The high prevalence (79%) of specific antibodies to this new common marmoset herpesvirus, with a comparable prevalence at both colonies [9/12 (75%) versus 13/16 (81%)] (Table 1Up), indicates that most common marmosets are infected with this herpesvirus. High prevalence of infection, with spontaneous cell lines from a portion of those infected, is similar to the experience with EBV infection in humans and Herpesvirus papio infection of baboons (Jenson, 2000Down ). All three DNA sequences from the three marmoset virus strains tested, which included animals from both colonies, were identical. Identification of the same virus from two geographically distinct animal colonies indicates that this virus is likely to be present in many common marmosets in captivity.

There was also high prevalence of cross-reactivity to Herpesvirus papio (71%), which is not unexpected because of the similarity of the common marmoset virus, EBV and Herpesvirus papio (Fig. 7Up). There was also a high seroprevalence (86%) to HHV-6. It is unlikely that this common marmoset gammaherpesvirus cross-reacts serologically with HHV-6. This result suggests the possibility of another virus closely related to HHV-6 that infects common marmosets, as has been suggested by serological studies in other primates (Higashi et al., 1989Down ).

There have been several studies of EBV infection of common marmosets (Cox et al., 1996Down , 1998Down ; Emini et al., 1986Down ; Farrell et al., 1997Down ; Mackett et al., 1996Down ; Wedderburn et al., 1984Down ). The present results suggest the possibility that some of the findings of previous studies may have been confounded by the presence of an unrecognized endogenous gammaherpesvirus in the common marmoset population. Alternatively, the infectious mononucleosis-like illness with EBV infection of common marmosets may indicate that the immune response to an endogenous gammaherpesvirus does not protect against subsequent gammaherpesvirus disease if the host cells are susceptible (Emini et al., 1986Down ; Wedderburn et al., 1984Down ). This may have relevance for understanding the basis of multiple EBV infections in humans (Apolloni & Sculley, 1994Down ; Sixbey et al., 1989Down ). The presence of an antigenically similar gammaherpesvirus would likely have also impaired the ability to discern EBV infection by serological testing, if the animals were infected with this new virus. This common marmoset herpesvirus requires a very long incubation period for spontaneous passage, which may partially explain why earlier studies did not identify this virus, if the animals were infected. The long incubation period for immortalization reflects similarity to EBV type 2, which does not immortalize lymphocytes as rapidly as EBV type 1 (Rickinson et al., 1987Down ).

These results confirm that EBV can infect common marmoset lymphocytes in the absence of the common marmoset gammaherpesvirus. EBV B95-8-transformed cell lines were developed from each of the seven animals that were seronegative for common marmoset herpesvirus, EBV and Herpesvirus papio antibodies. The CD21 EBV receptor was not detected in common marmoset cells, using the mAb OKB7, suggesting specificity of this antibody to the human EBV receptor and some differences in the cell receptor despite the relative ease of EBV infection of common marmoset cells. Herpesvirus papio, like EBV, is also capable of infecting common marmoset cells, suggesting a common mechanism for gammaherpesvirus entry into common marmoset lymphocytes (Deinhardt et al., 1978Down ). There is also evidence of decreased tumorigenicity of EBV in common marmoset lymphoblastoid cells compared with human lymphoblastoid cell lines (Katz et al., 1994Down ).

Analysis of the sequence of eight highly conserved herpesvirus genes has led to estimates of an evolutionary timescale for the herpesvirus family (McGeoch et al., 1995Down ). Assuming co-speciation of virus and host lineages and a constant molecular clock, the three subfamilies (alpha, beta and gamma) of herpesviruses arose approximately 180–220 million years ago, while the divergence between gamma-1 lymphocryptoviruses such as EBV and gamma-2 rhadinoviruses such as Herpesvirus saimiri (Saimiriine herpesvirus 2) was estimated to have occurred between 93 and 108 million years ago. This is consistent with our finding of a lymphocryptovirus in common marmosets from South America, the progenitor of which may well have arisen before the separation of South America and Africa over 100 million years ago. Interestingly, our phylogenetic analysis grouped the marmoset virus most closely with the rhesus lymphocryptovirus (Cercopithecine herpesvirus 15), a virus of New World monkeys, and distinguished it from EBV and the baboon lymphocryptovirus Herpesvirus papio (Cercopithecine herpesvirus 12), which were more closely related to each other than to either the rhesus or common marmoset lymphocryptovirus (Fig. 7Up). This analysis of a fragment of the polymerase gene clearly distinguishes the major sublineages of the herpesviruses and distinguishes the lymphocryptoviruses from the rhadinoviruses in the gammaherpesvirus subgroup. The fine-detail of the branching within these subgroups is less well resolved and will require further sequence data to clarify relationships and make them more statistically reliable.

It will be of interest to determine the pathology and diseases that occur in the marmoset with acute as well as persistent infection with this new virus. The ability of EBV to infect common marmoset lymphocytes and the presence of an endogenous gammaherpesvirus provide a unique model to study the pathology and interactions of gammaherpesvirus infections.


   Acknowledgments
 
These studies were supported by grants CA57957 and RR-13986 from the National Institute for Allergy and Infectious Diseases, National Institutes of Health, and The Cancer Research Campaign. We thank Kathleen Brasky, PhD, Scott Chambers and Thomas M. Butler, DVM, MS, for veterinary support.


   Footnotes
 
The DNA sequence reported in this study has been deposited in GenBank with the accession number AF291653.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Ablashi, D. V., Pearson, G., Rabin, H., Armstrong, G., Easton, J., Valerio, M. & Cicmanec, J. (1978). Experimental infection of Callithrix jacchus marmosets with Herpesvirus ateles, Herpesvirus saimiri, and Epstein Barr virus. Biomedicine 29, 7-10.[Medline]

Apolloni, A. & Sculley, T. B. (1994). Detection of A-type and B-type Epstein-Barr virus in throat washings and lymphocytes. Virology 202, 978-981.[Medline]

Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Séguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310, 207-211.[Medline]

Brown, N. A., Kovacs, A., Lui, C. R., Hur, C., Zaia, J. A. & Mosley, J. W. (1988). Prevalence of antibody to human herpesvirus 6 among blood donors infected with HIV. Lancet ii, 1146.

Cho, Y., Ramer, J., Rivailler, P., Quink, C., Garber, R. L., Beier, D. R. & Wang, F. (2001). An Epstein-Barr-related herpesvirus from marmoset lymphomas. Proceedings of the National Academy of Sciences, USA 98, 1224-1229.[Abstract/Free Full Text]

Cox, C., Chang, S., Karran, L., Griffin, B. & Wedderburn, N. (1996). Persistent Epstein–Barr virus infection in the common marmoset (Callithrix jacchus). Journal of General Virology 77, 1173-1180.[Abstract/Free Full Text]

Cox, C., Naylor, B. A., Mackett, M., Arrand, J. R., Griffin, B. E. & Wedderburn, N. (1998). Immunization of common marmosets with Epstein-Barr virus (EBV) envelope glycoprotein gp340: effect on viral shedding following EBV challenge. Journal of Medical Virology 55, 255-261.[Medline]

Deinhardt, F., Falk, L., Wolfe, L. G., Schudel, A., Nonoyama, M., Lai, P., Lapin, B. & Yakovleva, L. (1978). Susceptibility of marmosets to Epstein-Barr virus-like baboon herpesviruses. Primates in Medicine 10, 163-170.[Medline]

de-Thé, G., Dubouch, P., Fontaine, C., Wedderburn, N., Carter, R. L., Edwards, M. B. & Cohen, B. (1980). Natural antibodies to EBV-VCA antigens in common marmosets (Callithrix jacchus) and response after EBV inoculation. Intervirology 14, 284-291.[Medline]

Emini, E. A., Luka, J., Armstrong, M. E., Banker, F. S., Provost, P. J. & Pearson, G. R. (1986). Establishment and characterization of a chronic infectious mononucleosislike syndrome in common marmosets. Journal of Medical Virology 18, 369-379.[Medline]

Epstein, M. A., Hunt, R. D. & Rabin, H. (1973). Pilot experiments with EB virus in owl monkeys (Aotus trivirgatus). I. Reticuloproliferative disease in an inoculated animal. International Journal of Cancer 12, 309-318.

Epstein, M. A., Morgan, A. J., Finerty, S., Randle, B. J. & Kirkwood, J. K. (1985). Protection of cottontop tamarins against Epstein-Barr virus-induced malignant lymphoma by a prototype subunit vaccine. Nature 318, 287-289.[Medline]

Falk, L., Deinhardt, F., Nonoyama, M., Wolfe, L. G. & Bergholz, C. (1976). Properties of a baboon lymphotropic herpesvirus related to Epstein-Barr virus. International Journal of Cancer 18, 798-807.

Falk, L. A., Henle, G., Henle, W., Deinhardt, F. & Schudel, A. (1977). Transformation of lymphocytes by Herpesvirus papio. International Journal of Cancer 20, 219-226.

Farrell, P. J., Hollyoake, M., Niedobitek, G., Agathanggelou, A., Morgan, A. & Wedderburn, N. (1997). Direct demonstration of persistent Epstein–Barr virus gene expression in peripheral blood of infected common marmosets and analysis of virus-infected tissues in vivo. Journal of General Virology 78, 1417-1424.[Abstract]

Gerber, P., Pritchett, R. F. & Kieff, E. D. (1976). Antigens and DNA of a chimpanzee agent related to Epstein-Barr virus. Journal of Virology 19, 1090-1099.[Abstract/Free Full Text]

Hayashi, K., Koirala, T. R., Ino, H., Chen, H. L., Ohara, N., Teramoto, N., Yoshino, T., Takahashi, K., Yamada, M., Nii, S. and others (1995). Malignant lymphoma induction in rabbits by intravenous inoculation of Epstein-Barr-virus-related herpesvirus from HTLV-II-transformed cynomolgus leukocyte cell line (Si-IIA). International Journal of Cancer 63, 872–880.

Hayashi, K., Chen, H. L., Yanai, H., Koirala, T. R., Ohara, N., Teramoto, N., Oka, T., Yoshino, T., Takahashi, K., Miyamoto, K., Fujimoto, K., Yoshikawa, Y. & Akagi, T. (1999). Cyno-EBV (EBV-related herpesvirus from cynomolgus macaques) induces rabbit malignant lymphomas and their tumor cell lines frequently show specific chromosomal abnormalities. Laboratory Investigation 79, 823-835.[Medline]

Higashi, K., Asada, H., Kurata, T., Ishikawa, K., Hayami, M., Spriatna, Y., Sutarman & Yamanishi, K. (1989). Presence of antibody to human herpesvirus 6 in monkeys. Journal of General Virology 70, 3171–3176.[Abstract/Free Full Text]

Jenson, H. B. (2000). Leiomyoma and leiomyosarcoma. In Infectious Causes of Cancer: Targets for Intervention , pp. 145-159. Edited by J. J. Goedert. Totowa, NJ:Humana Press.

Jenson, H. B. & Ench, Y. (2002). Epstein-Barr virus. In Manual of Clinical Laboratory Immunology , pp. 615-626. Edited by N. R. Rose, R. G. Hamilton & B. Detrick. Washington, DC:American Society for Microbiology.

Jenson, H. B., Montalvo, E. A., McClain, K. L., Ench, Y., Heard, P., Christy, B. A., Dewalt-Hagan, P. J. & Moyer, M. P. (1999). Characterization of natural Epstein-Barr virus infection and replication in smooth muscle cells from a leiomyosarcoma. Journal of Medical Virology 57, 36-46.[Medline]

Jenson, H. B., Ench, Y., Gao, S. J., Rice, K., Carey, D., Kennedy, R. C., Arrand, J. R. & Mackett, M. (2000). Epidemiology of herpesvirus papio infection in a large captive baboon colony: similarities to Epstein-Barr virus infection in humans. Journal of Infectious Diseases 181, 1462-1466.[Medline]

Kalter, S. S., Heberling, R. L. & Ratner, J. J. (1972). EBV antibody in sera of non-human primates. Nature 238, 353-354.[Medline]

Katz, B. Z., Salimi, B., Saini, U., McNamara, J. G. & Eisen, R. (1994). Epstein-Barr virus-infected marmoset cells do not form lymphomas in mice with severe combined immunodeficiency. Pediatric Research 36, 456-460.[Medline]

Landon, J. C., Ellis, L. B., Zeve, V. H. & Fabrizio, D. P. (1968). Herpes-type virus in cultured leukocytes from chimpanzees. Journal of the National Cancer Institute 40, 181-192.

Lennette, E. T. (1995). Epstein-Barr virus (EBV). In Diagnostic Procedures for Viral, Rickettsial, and Chlamydial Infections , pp. 299-312. Edited by E. H. Lennette, D. A. Lennette & E. T. Lennette. Washington, DC:American Public Health Association.

Levy, J. A., Levy, S. B., Hirshaut, Y., Kafuko, G. & Prince, A. (1971). Presence of EBV antibodies in sera from wild chimpanzees. Nature 233, 559-560.[Medline]

Li, S. L., Biberfeld, P. & Ernberg, I. (1994). DNA of lymphoma-associated herpesvirus (HVMF1) in SIV-infected monkeys (Macaca fascicularis) shows homologies to EBNA-1, -2 and -5 genes. International Journal of Cancer 59, 287-295.

McClain, K. L., Leach, C. T., Jenson, H. B., Joshi, V. V., Pollock, B. H., Parmley, R. T., DiCarlo, F. J., Chadwick, E. G. & Murphy, S. B. (1995). Association of Epstein-Barr virus with leiomyosarcomas in young people with AIDS. New England Journal of Medicine 332, 12-18.[Abstract/Free Full Text]

McGeoch, D. J., Cook, S., Dolan, A., Jamieson, F. E. & Telford, E. A. (1995). Molecular phylogeny and evolutionary timescale for the family of mammalian herpesviruses. Journal of Molecular Biology 247, 443-458.[Medline]

McGeoch, D. J., Dolan, A. & Ralph, A. C. (2000). Toward a comprehensive phylogeny for mammalian and avian herpesviruses. Journal of Virology 74, 10401-10406.[Abstract/Free Full Text]

Mackett, M., Cox, C., Pepper, S. D., Lees, J. F., Naylor, B. A., Wedderburn, N. & Arrand, J. R. (1996). Immunisation of common marmosets with vaccinia virus expressing Epstein-Barr virus (EBV) gp340 and challenge with EBV. Journal of Medical Virology 50, 263-271.[Medline]

Miller, G., Shope, T., Lisco, H., Stitt, D. & Lipman, M. (1972). Epstein-Barr virus: transformation, cytopathic changes, and viral antigens in squirrel monkey and marmoset leukocytes. Proceedings of the National Academy of Sciences, USA 69, 383-387.[Abstract/Free Full Text]

Moghaddam, A., Rosenzweig, M., Lee-Parritz, D., Annis, B., Johnson, R. P. & Wang, F. (1997). An animal model for acute and persistent Epstein-Barr virus infection. Science 276, 2030-2033.[Abstract/Free Full Text]

Moghaddam, A., Koch, J., Annis, B. & Wang, F. (1998). Infection of human B lymphocytes with lymphocryptoviruses related to Epstein-Barr virus. Journal of Virology 72, 3205-3212.[Abstract/Free Full Text]

Nemerow, G. R., McNaughton, M. E. & Cooper, N. R. (1985). Monoclonal antibody to the Epstein-Barr virus receptor induces human B lymphocyte activation and differentiation. Transactions of the Association of American Physicians 98, 290-300.[Medline]

Neubauer, R. H., Rabin, H., Strnad, B. C., Nonoyama, M. & Nelson-Rees, W. A. (1979). Establishment of a lymphoblastoid cell line and isolation of an Epstein-Barr-related virus of gorilla origin. Journal of Virology 31, 845-848.[Abstract/Free Full Text]

Niedobitek, G., Meru, N. & Delecluse, H. J. (2001). Epstein-Barr virus infection and human malignancies. International Journal of Experimental Pathology 82, 149-170.[Medline]

Rabin, H., Neubauer, R. H., Hopkins, R. F., Dzhikidze, E. K., Shevtsova, Z. V. & Lapin, B. A. (1977). Transforming activity and antigenicity of an Epstein-Barr-like virus from lymphoblastoid cell lines of baboons with lymphoid disease. Intervirology 8, 240-249.[Medline]

Rabin, H., Neubauer, R. H., Hopkins, R. F. & Nonoyama, M. (1978). Further characterization of a herpesvirus-positive orangutan cell line and comparative aspects of in vitro transformation with lymphotropic old world primate herpesviruses. International Journal of Cancer 21, 762-767.

Ramer, J. C., Garber, R. L., Steele, K. E., Boyson, J. F., O'Rourke, C. & Thomson, J. A. (2000). Fatal lymphoproliferative disease associated with a novel gammaherpesvirus in a captive population of common marmosets. Comparative Medicine 50, 59-68.

Rangan, S. R., Martin, L. N., Bozelka, B. E., Wang, N. & Gormus, B. J. (1986). Epstein-Barr virus-related herpesvirus from a rhesus monkey (Macaca mulatta) with malignant lymphoma. International Journal of Cancer 38, 425-432.

Rickinson, A. B., Young, L. S. & Rowe, M. (1987). Influence of the Epstein-Barr virus nuclear antigen EBNA 2 on the growth phenotype of virus-transformed B cells. Journal of Virology 61, 1310-1317.[Abstract/Free Full Text]

Rivadeneira, E. D., Ferrari, M. G., Jarrett, R. F., Armstrong, A. A., Markham, P., Birkebak, T., Takemoto, S., Johnson-Delaney, C., Pecon-Slattery, J., Clark, E. A. & Franchini, G. (1999). A novel Epstein-Barr virus-like virus, HVMNE, in a Macaca nemestrina with mycosis fungoides. Blood 94, 2090-2101.[Abstract/Free Full Text]

Rivailler, P., Jiang, H., Cho, Y. G., Quink, C. & Wang, F. (2002). Complete nucleotide sequence of the rhesus lymphocryptovirus: genetic validation for an Epstein-Barr virus animal model. Journal of Virology 76, 421-426.[Abstract/Free Full Text]

Rose, T. M., Strand, K. B., Schultz, E. R., Schaefer, G., Rankin, G. W. J., Thouless, M. E., Tsai, C. C. & Bosch, M. L. (1997). Identification of two homologs of the Kaposi’s sarcoma-associated herpesvirus (human herpesvirus 8) in retroperitoneal fibromatosis of different macaque species. Journal of Virology 71, 4138-4144.[Abstract]

Salahuddin, S. Z., Ablashi, D. V., Markham, P. D., Josephs, S. F., Sturzenegger, S., Kaplan, M., Halligan, G., Biberfeld, P., Wong-Staal, F., Kramarsky, B. & Gallo, R. C. (1986). Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234, 596-601.[Abstract/Free Full Text]

Sixbey, J. W., Shirley, P., Chesney, P. J., Buntin, D. M. & Resnick, L. (1989). Detection of a second widespread strain of Epstein-Barr virus. Lancet ii, 761–765.

Thorley-Lawson, D. A., Nadler, L. M., Bhan, A. K. & Schooley, R. T. (1985). BLAST-2 [EBVCS], an early cell surface marker of human B cell activation, is superinduced by Epstein Barr virus. Journal of Immunology 134, 3007-3012.[Abstract]

Wedderburn, N., Edwards, J. M., Desgranges, C., Fontaine, C., Cohen, B. & de The, G. (1984). Infectious mononucleosis-like response in common marmosets infected with Epstein-Barr virus. Journal of Infectious Diseases 150, 878-882.[Medline]

Wutzler, P., Meerbach, A., Farber, I., Wolf, H. & Scheibner, K. (1995). Malignant lymphomas induced by an Epstein-Barr virus-related herpesvirus from Macaca arctoides – a rabbit model. Archives of Virology 140, 1979-1995.[Medline]

zur Hausen, H., O’Neill, F. J., Freese, U. K. & Hecker, E. (1978). Persisting oncogenic herpesvirus induced by the tumour promotor TPA. Nature 272, 373-375.[Medline]

Received 28 November 2001; accepted 8 March 2002.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
L. Wu and L. M. Hutt-Fletcher
Compatibility of the gH homologues of Epstein-Barr virus and related lymphocryptoviruses
J. Gen. Virol., August 1, 2007; 88(8): 2129 - 2136.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Lacoste, E. J. Verschoor, E. Nerrienet, and A. Gessain
A novel homologue of Human herpesvirus 6 in chimpanzees
J. Gen. Virol., August 1, 2005; 86(8): 2135 - 2140.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. H. Fogg, A. Carville, J. Cameron, C. Quink, and F. Wang
Reduced Prevalence of Epstein-Barr Virus-Related Lymphocryptovirus Infection in Sera from a New World Primate
J. Virol., August 1, 2005; 79(15): 10069 - 10072.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S.-H. Chiou, K.-C. Chow, C.-H. Yang, S.-F. Chiang, and C.-H. Lin
Discovery of Epstein-Barr virus (EBV)-encoded RNA signal and EBV nuclear antigen leader protein DNA sequence in pet dogs
J. Gen. Virol., April 1, 2005; 86(4): 899 - 905.
[Abstract] [Full Text] [PDF]