J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gheit, T.
Right arrow Articles by Chemin, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gheit, T.
Right arrow Articles by Chemin, I.
Agricola
Right arrow Articles by Gheit, T.
Right arrow Articles by Chemin, I.
Journal of General Virology (2002), 83, 1645-1649.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Experimental transfection of Macaca sylvanus with cloned human hepatitis B virus

Tarik Gheit1, Souad Sekkat2, Lucyna Cova1, Michèle Chevallier3, Marie Anne Petit1, Olivier Hantz1, Mylène Lesénéchal4, Abdallah Benslimane2, Christian Trépo1 and Isabelle Chemin1

Unité de recherche sur les virus des hépatites et pathologies associées, Institut national de la santé et de la recherche médicale 271, 69424 Lyon Cedex 03, France1
Centre d’immunologie, Faculté de Médecine et Pharmacie, BP 9154, Casablanca, Morocco2
Laboratoire d’anatomie et de cytologie pathologiques, Laboratoire Marcel Mérieux, 69365 Lyon Cedex 07, France3
bioMérieux, Marcy l’étoile 69280, France4

Author for correspondence: Isabelle Chemin. Fax +33 4 72 68 19 71. e-mail chemin{at}lyon151.inserm.fr


   Abstract
TOP
Abstract
Main text
References
 
Due to the absence of easily accessible animal models for the study of hepatitis B virus (HBV), the possibility of using Macaca sylvanus, a monkey originating from Morocco, North Africa, was investigated. Three monkeys were intrahepatically inoculated with a replication-competent head-to-tail HBV DNA plasmid dimer construct. The HBV surface antigen and HBV DNA were detected prior to alanine aminotransferase elevation in the serum of two of three HBV-inoculated monkeys at day 2 post-transfection and persisted for several weeks. This indicates that transfected animals developed markers of HBV infection. In addition, electron microscopy of the serum 3 weeks post-transfection showed the presence of virus particles whose shape and size were similar to complete 42 nm HBV Dane particles. Histological examination of liver tissues also revealed pathological changes not observed in uninfected controls, which strongly suggested acute hepatitis. HBV DNA was also detected by PCR in these monkey livers. Taken together, these results indicate that HBV can successfully replicate in this model and that M. sylvanus could be a potentially useful new primate model for the study of HBV replication.


   Main text
TOP
Abstract
Main text
References
 
In spite of the availability of an effective vaccine, infection by hepatitis B virus (HBV) remains a worldwide public health problem, with 400 million chronic HBV carriers. Every year, nearly 1 million individuals succumb to HBV-associated liver disease, especially cirrhosis and hepatocellular carcinoma (Wright et al., 1993Down ). The treatment of chronic HBV infection is still unsatisfactory. Therefore, the development of better animal models to test new therapeutic approaches is highly desirable. Nowadays, several nonprimate animal models, which are naturally infected by HBV-related hepadnaviruses, are available for in vivo screening of putative antiviral compounds. Pekin ducks infected by duck HBV (Lambert et al., 1991Down ; Cova et al., 1993Down ; Le Guerhier et al., 2000Down ) and American woodchuck infected by woodchuck HBV (Hantz et al., 1984Down ) are the two models currently used to test the effectiveness of new therapeutic approaches, including screening of new antiviral molecules (Zoulim & Trepo, 1999Down ) or evaluation of DNA-based vaccines (Davis et al., 1996Down ; Donnelly et al., 1997Down ; Rollier et al., 1999Down ). The development of a new experimental model that is closer to humans and susceptible to HBV infection is of particular importance, since it will represent an essential tool for drug and HBV variant testing. Although chimpanzees can be readily infected by HBV and develop acute hepatitis (Will et al., 1982Down ), this species is endangered and expensive and, thus, is inappropriate for research programs that require a large number of animals. Attempts of experimental in vivo HBV infections of tupaias (Walter et al., 1996Down ; Yan et al., 1996Down ) and baboons (Kedda et al., 2000Down ) were also performed, although transient infection of these animals did result in rapid seroconversion.

Several seroepidemiological studies in monkeys indicate that many old world species, such as macaques, chimpanzees, African green monkeys and baboons, are simian T-cell leukaemia virus type 1 carriers (Ibrahim et al., 1995Down ; Ishikawa et al., 1987Down ; Mahieux et al., 1998Down ; Meertens et al., 2001Down ). These studies suggest that lymphotropic and also hepatotropic viruses may be transmitted between different African monkey species but also from monkeys to humans.

In the present study, we have evaluated the potential use of Macaca sylvanus as a new experimental and alternative primate model for HBV infection. These monkeys were captured in the wild (middle Atlas mountains) and were quarantined and maintained at the Pasteur Institute of Casablanca (Morocco) under conditions that met or exceeded all of the requirements needed for the physical and psychological well being of such animals. These animals had not been exposed to any hepatotropic viruses prior to the in vivo inoculation of HBV DNA and all animals were negative for serological markers of infection with hepatitis A, B and C viruses as well as human T-lymphotropic viruses types I and II. We established the baseline of alanine aminotransferase (ALT) at 61 U/L by calculating the mean of all of the sera sampled from all of the animals over a period of 3 months before inoculation of HBV DNA. This value of 61 U/L is in accordance with ALT levels in humans (56 U/L) and chimpanzees (55 U/L) (Bassett et al., 1999Down ). All molecular analyses were performed at INSERM U271 (Lyon, France). Three M. sylvanus monkeys (BL05, BL10 and BL11) were intrahepatically inoculated with a total of 450  µg of a replication-competent head-to-tail HBV DNA (ayw, genotype D) plasmid dimer (pBR322) construct (Burrell et al., 1979Down ; Charnay et al., 1979Down ; Galibert et al., 1979Down ) dissolved in water and injected into three sites of the liver using paediatric Menghini needles, as described for chimpanzees (Will et al., 1982Down ), tupaias (Walter et al., 1996Down ) and ducks (Sprengel et al., 1984Down ). After inoculation, animals were bled weekly to test for HBV surface antigens (HBsAg), anti-HBc antibodies and ALT and aminotransferase (AST) activities. Out of the three control M. sylvanus monkeys (BL15, BL16 and BL17), one died accidentally prior to the beginning of the experiment. After 36 weeks of follow-up, the animals were sacrificed. All experiments were carried out under general anaesthesia using ketamine (1 mg/kg body weight) (IMALGEN).

Interestingly, two of three M. sylvanus monkeys transfected with cloned HBV DNA developed markers of virus infection, while the two control animals followed in parallel didn't develop such markers. For one animal (BL05) from the HBV DNA-transfected group, no serum HBsAg was detected. In contrast, starting 2 days post-transfection, HBsAg expression was detected in the serum of monkeys BL10 and BL11 for a period of 4 and 7 weeks, respectively (Fig. 1aDown). Similar to acute self-limited HBV in humans, HBsAg was eliminated from the serum of these monkeys. Therefore, in M. sylvanus, HBsAg positivity persisted for a longer time (4–7 weeks) than for experimental HBV infection in tupaias or some chimpanzees (Will et al., 1982Down ; Walter et al., 1996Down ), which revealed only transient HBsAg expression in serum that was limited to a few days and up to a maximum of 4 weeks.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. (a) Schematic representation of the follow-up of markers of HBV infection in animals BL05, BL10 and BL11. HBsAg detection was performed with the bioMérieux VIDAS HBsAg Ultradetection kit and the ORTHO antibody to HBsAg ELISA, system 3. The limit of detection of such tests is about 0·2–0·3 ng/ml. Total anti-HBc antibody detection was performed with the Vidas Anti-HBc Total II kit (bioMérieux). ALT levels were determined using a Welltech kit. HBV DNA was detected by PCR in the S and C genes, as described in the text. Shading in the horizontal bars represents a positive response for the corresponding parameter. (b) Southern blot analysis of PCR products (145 and 118 bp) located in the S and C genes. Lanes 2–6 represent PCR detection of HBV DNA in animal BL11 at weeks 1, 2, 3, 4 and 7, respectively. Lane 1 corresponds to a serum sample from animal BL11 prior to inoculation (used as a control).

 
After transfection, no anti-HBc antibodies were detected in the serum of M. sylvanus monkeys. This may occur due to either the low level of anti-HBc antibodies in the serum of the animals or the lack of reactivity of anti-HBc antibodies elicited in M. sylvanus monkeys. It is of note that the test used (bioMérieux Vidas Anti-HBc Detection kit) is designed for detection in human sera. Also, anti-HBsAg antibodies were not detected, probably for the same reason. We have not looked for the HVB e-antigen because of the limited amount of serum available.

We also tested for the presence of HBV DNA in the sera of transfected M. sylvanus monkeys using PCR and Southern blot analysis (Fig. 1aUp). Primers for PCR amplification were selected from a domain overlapping the core and the surface gene, which is highly conserved among all human HBV genotypes. Both a 118 bp region in the surface gene (sense, 5' GGAGTGGGCCTCAGCCCGTTTCTC 3'; reverse, 5' GCCCCCAATACCACATCATCCATA 3') and a 145 bp region in the core gene (sense, 5' TCGGAGTGTGGATTCGCACTCCTC 3'; reverse, 5' GATTGAGACCTTCCTCCTCTGCGAGGA 3') were amplified. The specificity of the amplified bands was confirmed by Southern blot hybridization using a 32P-labelled random-primed HBV DNA probe. High stringency hybridization conditions using buffers containing 50% formamide, 7% SDS, 0·25 M sodium phosphate, pH 7·2, 0·25 M NaCl and 1 mM EDTA were used at 42 °C with washes in 2–0·5xSSC containing 0·1% SDS at 65 °C. The results showed significant and persistent expression of viral DNA during follow-up for both M. sylvanus monkeys BL10 and BL11, which was particularly intense for BL11, as illustrated in Fig. 1(b)Up. In order to quantify HBV DNA in the serum of M. sylvanus BL11, quantitative PCR was performed using the Amplicor HBV Monitor test (Roche). Primers used in this test are located within the HBV preC/C region and the sensitivity of the test has been estimated to range between 103 and 105·5 genome copies/ml. A progressive increase in serum HBV genome copy numbers was observed during the first 3 weeks post HBV DNA inoculation, which peaked at 2·105 genome copies/ml at week 3 (data not shown).

In addition, a transient and significant peak of transaminase activity was observed for animals BL10 (307 U/L) and BL11 (286 U/L) at week 8 but no increase was observed for BL05 (Fig. 1aUp). Moreover, after HBV DNA inoculation, biochemical evidence of hepatitis was correlated with HBV DNA detection by PCR and abnormal histological findings. As illustrated in Fig. 2(b)Down, histological analysis of liver sections from these animals revealed definite modifications of infected hepatocytes, including swelling of the cells and disarray of cell plates but without cell necrosis. Such changes were conspicuous in both the lobules and portal tract. Early portal fibrosis could be demonstrated by the reticulin stain, which revealed slightly enlarged portal tracts extending in thin periportal septa. As illustrated in the Fig. 2(a)Down, liver analysis from control animals did not show such abnormalities and no rise in serum transaminase levels was seen during follow-up.



View larger version (139K):
[in this window]
[in a new window]
 
Fig. 2. Histological analysis of liver biopsies after reticulin staining. (a) Normal portal tract and regular reticulin patterns in the lobule of an uninfected animal. (b) Increase in the size of the portal tract, early periportal fibrosis (arrows) and disorganized cell plate patterns (asterisk) in the lobule of an HBV DNA-transfected animal, BL11. Note the hepatocyte swelling (arrowheads). Original magnification, 10x.

 
During the course of the experiment, we were not able to perform biopsies of the animals enrolled in the study. Nevertheless, to search for intrahepatic HBV replication, Southern blot analysis of total intrahepatic DNA from animals BL10 and BL11 was performed using autopsy liver samples obtained at the end of the experiment, i.e. 9 months after the initial HBV DNA inoculation. Despite intrahepatic HBV DNA detection by PCR, Southern blot analysis of liver samples from these animals did not reveal the presence of HBV DNA replicative forms. The low level of HBV DNA replication in the liver might explain this. Similarly, the replicative forms of HBV DNA were not detected in the livers of HBV DNA-transfected chimpanzee (Will et al., 1983Down ).

We have also looked for the presence of virus particles in the serum of monkey BL11 serum using sucrose gradient sedimentation followed by electron microscopy examination. To this end, serum samples (1·5 ml) from this animal, which were HBsAg- and HBV DNA-positive (2·105 genome copies/ml of serum) at week 3 post-transfection, had first been concentrated by centrifuging at 210000 g for 2 h in a Beckman L8-70M ultracentrifuge. After serum ultracentrifugation, the pellet was resuspended in 150 µl PBS and subjected to equilibrium centrifugation on a 15–45% (w/w) linear sucrose gradient in PBS buffer for 17 h at 210000 g at 4 °C. HBV DNA was analysed by PCR and Southern blotting following nucleic acid extraction in all collected fractions. HBV DNA was detected between 22 and 27·5% sucrose (fractions 3–9). It was generally admitted that such virus particles did not contain HBV DNA when HBV DNA was detected by the classical hybridization technique. However, when we used highly sensitive PCR techniques, especially nested PCR or PCR followed by Southern blotting, HBV DNA could be detected in fractions at 20–25% sucrose, as described by Petit et al. (2001)Down .

A more intense signal was found between 40 and 41·5% sucrose (fractions 16 and 17) (Fig. 3Down). Electron microscopy examination of these fractions, 16 and 17, further purified by dialysis and ultracentrifugation, revealed the presence of incomplete 22 nm particles in fraction 6 (25% sucrose) (data not shown) as well as 42 nm virions in fraction 17 (41·5% sucrose) (Fig. 3Down). The size and shape of virions in fraction 17 was similar to complete HBV Dane particles, which have been previously identified at a similar density (42% sucrose) following equilibrium centrifugation of HBV DNA-positive human serum under the same centrifugation conditions (Petit et al., 1990Down ). Sucrose gradient fractions remaining negative for HBV DNA by PCR did not exhibit the presence of any virus-like particles. Therefore, our results strongly suggest that complete HBV particles can be produced in the serum of HBV-transfected M. sylvanus monkeys.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 3. Isopycnic sucrose gradient ultracentrifugation was performed on 1·5 ml of serum from a transfected M. sylvanus monkey, BL11, positive for HBsAg and HBV DNA. A total of 20 fractions was collected and tested for HBV DNA by PCR specific for the S gene. A Southern blot of fractions 3–19 (F3–F19) is shown. Fractions were absorbed onto carbon-coated grids for 10 min, rinsed in water for 2 min and stained with 4% APT, pH 7·2, and dried on absorbent paper prior to examined by a JEOL 100 CX electron microscope. The presence of a 42 nm diameter virus particle in the pooled fractions 16 and 17 is shown below.

 
Importantly, the histological examination of liver tissues from M. sylvanus animals transfected by HBV DNA demonstrated pathological changes, which strongly suggested that acute infection did occur in the M. sylvanus animal model. Indeed, the pattern of liver injury at necropsy was suggestive of regeneration associated with the resolutive phase of acute hepatitis. The minimal fibrosis observed was integrated into this interpretation. In contrast, no evidence of hepatic injury was shown by histological examination of the liver tissue from HBV-infected tupaias (Walter et al., 1996Down ) or baboons (Kedda et al., 2000Down ) and no elevated serum AST levels were observed in these animals.

As described for tupaias (Yan et al., 1996Down ), serial passages of released HBV particles will be attempted in M. sylvanus monkeys to test their infectivity and to favour virus infection in this model. This may improve the efficiency of infection, allow higher levels of viral gene expression and may lead to the establishment of a chronic infection.

Taken together, our results show that, following direct HBV DNA transfection of M. sylvanus liver, we have been able to detect in the serum of two of three transfected animals, increasing amounts of circulating HBV DNA together with the presence of HBsAg. In addition, serum ultracentrifugation experiments did confirm the presence of virus particles, with a size and density characteristic of HBV Dane particles observed only in the HBV DNA-positive fractions. Moreover, the presence of virus markers in the sera of transfected monkeys was followed by increased transaminase levels and histological patterns, suggestive of resolving acute liver injury. Therefore, our study demonstrates for the first time the occurrence of HBV replication associated with acute hepatitis after intrahepatic transfection of M. sylvanus monkeys with HBV DNA.

In conclusion, our study demonstrates that M. sylvanus, a small monkey abundant in Morocco, could be a potentially useful new primate model for the study of HBV replication. If we succeed through serial passage of HBV in M. sylvanus and, possibly, in developing an immunosuppressive regimen to establish a chronic HBV infection, such a model will be suitable for the study of the safety, immunogenicity and efficacy of novel HBV therapeutic vaccines as well as antiviral strategies but also for the testing of replication capacity of HBV mutants that emerge in chronically infected patients.


   Acknowledgments
 
We would like to acknowledge Dr Gheit Gheit for his advice and help in performing this work with the intrahepatic inoculation of Macaca sylvanus.


   References
TOP
Abstract
Main text
References
 
Bassett, S. E., Di Bisceglie, A. M., Bacon, B. R., Sharp, R. M., Govindarajan, S., Hubbard, G. B., Brasky, K. M. & Lanford, R. E. (1999). Effects of iron loading on pathogenicity in hepatitis C virus-infected chimpanzees. Hepatology 29, 1884-1892.[Medline]

Burrell, C. J., Mackay, P., Greenaway, P. J., Hofschneider, P. H. & Murray, K. (1979). Expression in Escherichia coli of hepatitis B virus DNA sequences cloned in plasmid pBR322. Nature 279, 43-47.[Medline]

Charnay, P., Pourcel, C., Louise, A., Fritsch, A. & Tiollais, P. (1979). Cloning in Escherichia coli and physical structure of hepatitis B virion DNA. Proceedings of the National Academy of Sciences, USA 76, 2222-2226.[Abstract/Free Full Text]

Cova, L., Fourel, I., Vitvitski, L., Lambert, V., Chassot, S., Hantz, O. & Trepo, C. (1993). Animal models for the understanding and control of HBV and HDV infections. Journal of Hepatology 17 (Suppl. 3), S143–S148.[Medline]

Davis, H. L., McCluskie, M. J., Gerin, J. L. & Purcell, R. H. (1996). DNA vaccine for hepatitis B: evidence for immunogenicity in chimpanzees and comparison with other vaccines. Proceedings of the National Academy of Sciences, USA 93, 7213-7218.[Abstract/Free Full Text]

Donnelly, J. J., Ulmer, J. B. & Liu, M. A. (1997). DNA vaccines. Life Sciences 60, 163-172.[Medline]

Galibert, F., Mandart, E., Fitoussi, F., Tiollais, P. & Charnay, P. (1979). Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281, 646-650.[Medline]

Hantz, O., Ooka, T., Vitvitski, L., Pichoud, C. & Trepo, C. (1984). Comparison of properties of woodchuck hepatitis virus and human hepatitis B virus endogenous DNA polymerases. Antimicrobial Agents and Chemotherapy 25, 242-246.[Abstract/Free Full Text]

Ibrahim, F., de The, G. & Gessain, A. (1995). Isolation and characterization of a new simian T-cell leukemia virus type 1 from naturally infected celebes macaques (Macaca tonkeana): complete nucleotide sequence and phylogenetic relationship with the Australo-Melanesian human T-cell leukemia virus type 1. Journal of Virology 69, 6980-6993.[Abstract]

Ishikawa, K., Fukasawa, M., Tsujimoto, H., Else, J. G., Isahakia, M., Ubhi, N. K., Ishida, T., Takenaka, O., Kawamoto, Y., Shotake, T. and others (1987). Serological survey and virus isolation of simian T-cell leukemia/T-lymphotropic virus type I (STLV-I) in non-human primates in their native countries. International Journal of Cancer 40, 233–239.

Kedda, M. A., Kramvis, A., Kew, M. C., Lecatsas, G., Paterson, A. C., Aspinall, S., Stark, J. H., De Klerk, W. A. & Gridelli, B. (2000). Susceptibility of chacma baboons (Papio ursinus orientalis) to infection by hepatitis B virus. Transplantation 69, 1429-1434.[Medline]

Lambert, V., Chassot, S., Kay, A., Trepo, C. & Cova, L. (1991). In vivo neutralization of duck hepatitis B virus by antibodies specific to the N-terminal portion of pre-S protein. Virology 185, 446-450.[Medline]

Le Guerhier, F., Pichoud, C., Guerret, S., Chevallier, M., Jamard, C., Hantz, O., Li, X. Y., Chen, S. H., King, I., Trepo, C., Cheng, Y. C. & Zoulim, F. (2000). Characterization of the antiviral effect of 2’,3'-dideoxy-2’,3'-didehydro- {beta}-L-5-fluorocytidine in the duck hepatitis B virus infection model. Antimicrobial Agents and Chemotherapy 44, 111-122.[Abstract/Free Full Text]

Mahieux, R., Pecon-Slattery, J., Chen, G. M. & Gessain, A. (1998). Evolutionary inferences of novel simian T lymphotropic virus type 1 from wild-caught chacma (Papio ursinus) and olive baboons (Papio anubis). Virology 251, 71-84.[Medline]

Meertens, L., Rigoulet, J., Mauclere, P., Van Beveren, M., Chen, G. M., Diop, O., Dubreuil, G., Georges-Goubot, M. C., Berthier, J. L., Lewis, J. & Gessain, A. (2001). Molecular and phylogenetic analyses of 16 novel simian T cell leukemia virus type 1 from Africa: close relationship of STLV-1 from Allenopithecus nigroviridis to HTLV-1 subtype B strains. Virology 287, 275-285.[Medline]

Petit, M. A., Zoulim, F., Capel, F., Dubanchet, S., Dauguet, C. & Trepo, C. (1990). Variable expression of preS1 antigen in serum during chronic hepatitis B virus infection: an accurate marker for the level of hepatitis B virus replication. Hepatology 11, 809-814.[Medline]

Petit, M. A., Buffello-Le Guillou, D., Roche, B., Dussaix, E., Duclos-Vallee, J. C., Feray, C. & Samuel, D. (2001). Residual hepatitis B virus particles in liver transplant recipients receiving lamivudine: PCR quantitation of HBV DNA and ELISA of preS1 antigen. Journal of Medical Virology 65, 493-504.[Medline]

Rollier, C., Sunyach, C., Barraud, L., Madani, N., Jamard, C., Trepo, C. & Cova, L. (1999). Protective and therapeutic effect of DNA-based immunization against hepadnavirus large envelope protein. Gastroenterology 116, 658-665.[Medline]

Sprengel, R., Kuhn, C., Manso, C. & Will, H. (1984). Cloned duck hepatitis B virus DNA is infectious in Pekin ducks. Journal of Virology 52, 932-937.[Abstract/Free Full Text]

Walter, E., Keist, R., Niederost, B., Pult, I. & Blum, H. E. (1996). Hepatitis B virus infection of tupaia hepatocytes in vitro and in vivo. Hepatology 24, 1-5.[Medline]

Will, H., Cattaneo, R., Koch, H. G., Darai, G., Schaller, H., Schellekens, H., van Eerd, P. M. & Deinhardt, F. (1982). Cloned HBV DNA causes hepatitis in chimpanzees. Nature 299, 740-742.[Medline]

Will, H., Darai, G., Deinhardt, F., Schellekens, H. & Schaller, H. (1983). Hepatitis B after infection of a chimpanzee with cloned HBV DNA. Developments in Biological Standardization 54, 131-133.[Medline]

Wright, T. L. & Lau, J. Y. (1993). Clinical aspects of hepatitis B virus infection. Lancet 342, 1340-1344.[Medline]

Yan, R. Q., Su, J. J., Huang, D. R., Gan, Y. C., Yang, C. & Huang, G. H. (1996). Human hepatitis B virus and hepatocellular carcinoma. I. Experimental infection of tree shrews with hepatitis B virus. Journal of Cancer Research and Clinical Oncology 122, 283-288.[Medline]

Zoulim, F. & Trepo, C. (1999). New antiviral agents for the therapy of chronic hepatitis B virus infection. Intervirology 42, 125-144.[Medline]

Received 30 November 2001; accepted 26 February 2002.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gheit, T.
Right arrow Articles by Chemin, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gheit, T.
Right arrow Articles by Chemin, I.
Agricola
Right arrow Articles by Gheit, T.
Right arrow Articles by Chemin, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS