J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harvala, H.
Right arrow Articles by Stanway, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harvala, H.
Right arrow Articles by Stanway, G.
Agricola
Right arrow Articles by Harvala, H.
Right arrow Articles by Stanway, G.
Journal of General Virology (2002), 83, 1697-1706.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Mapping of tissue tropism determinants in coxsackievirus genomes

Heli Harvala1, Hannu Kalimo2, Leif Dahllund1, Juhana Santti1, Pamela Hughes3, Timo Hyypiä1,4 and Glyn Stanway3

Department of Virology and MediCity Research Laboratory, University of Turku, Kiinamyllynkatu 13, FIN-20520 Turku, Finland1
Department of Pathology, University of Turku and Turku University Hospital, FIN-20520 Turku, Finland2
Department of Biological Sciences, University of Essex, Colchester CO4 3SQ, UK3
Department of Virology, Haartman Institute, PO Box 21, FIN-00014 Helsinki, Finland4

Author for correspondence: Heli Harvala. Fax +358 2 2513303. e-mail heli.harvala{at}utu.fi


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Genomic regions responsible for the different tissue tropisms of coxsackievirus A9 (CAV9) and coxsackievirus B3 (CBV3) in newborn mice were investigated using recombinant viruses. Infectious cDNA clones of CAV9, a virus known to infect striated muscle, and CBV3, affecting the central nervous system, pancreas, liver, brown fat and striated muscle, were used to generate chimeric viruses. In situ hybridization analysis of different tissues from mice infected with the recombinant viruses, constructed by exchanging the 5' non-coding region (5'NCR), structural and non-structural genes, demonstrated that the pancreo- and liver tropism map predominantly to CBV3 sequences within the capsid genes, evidently due to receptor recognition. Although the major neurotropism determinant in the CBV3 genome was in the capsid region, viruses containing the CAV9 capsid were also able to initiate infection in the central nervous system provided they contained the CBV3 5'NCR. The presence of the 5'NCR of CAV9 clearly enhanced muscle tissue tropism.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Coxsackieviruses, members of the Enterovirus genus in the family Picornaviridae, are important human pathogens responsible for a wide spectrum of illnesses varying from the common cold to severe infections of the central nervous system and myocardium (Grist et al., 1978Down ). In addition to polioviruses, which have a well-defined pathogenicity, some other enteroviruses are also associated with specific illnesses, such as coxsackievirus A16 (CAV16) and enterovirus 71 with hand-foot-and-mouth disease, CAV24 variant and enterovirus 70 with acute haemorrhagic conjunctivitis and coxsackie B viruses (CBVs) with pleurodynia (Moore & Morens, 1984Down ). However, most enteroviruses can be responsible for highly similar clinical diseases including aseptic meningitis and encephalitis commonly caused by echoviruses, CBVs and coxsackievirus A9 (CAV9) (Grist et al., 1978Down ; Hovi et al., 1996Down ). Moreover, enteroviruses do not usually exhibit a direct correlation between the serotype and clinical manifestation in humans, as the same serotype can cause diverse symptoms. Therefore, the pathogenicity of coxsackieviruses is a complex phenomenon, evidently due to variation in the genetic and immunological background, and is difficult to investigate in humans. Differences in mouse pathogenicity of CAV9 and coxsackievirus B3 (CBV3), which are genetically closely related, offer an opportunity to investigate directly molecular determinants affecting the tissue tropism of coxsackieviruses.

Enteroviruses are small particles containing a single-stranded, positive-sense RNA genome (approximately 7500 nt). A 5' non-coding region (5'NCR) is followed by an open reading frame encoding a polyprotein, which is processed into four structural proteins (VP1–4) and seven non-structural proteins (2A–D, 3A–C). The 5'NCR has an important role in internal initiation of translation, while the structural proteins form the capsid surrounding the genome and the non-structural proteins are involved in the virus replication cycle and protein processing. The 3'NCR is involved in the initiation of complementary RNA strand synthesis. Major pathogenic determinants of coxsackievirus infections have been localized to the 5'NCR (Tu et al., 1995Down ; Rinehart et al., 1997Down ; Dunn et al., 2000Down ) and the capsid protein coding region (Caggana et al., 1993Down ; Ramsingh & Collins, 1995Down ; Knowlton et al., 1996Down ) in the enterovirus genome. The initial event in viral infection is attachment of the virus to a specific receptor on the cell surface, which is an important determinant for tissue tropism. CBVs make use of at least two cell membrane proteins: coxsackievirus–adenovirus receptor (CAR) (Bergelson et al., 1997Down ), a member of the immunoglobulin superfamily, and decay-accelerating factor of the complement system (DAF/CD55) (Bergelson et al., 1995Down ). Attachment of CAV9 to the cell surface integrin {alpha}v{beta}3 (Roivainen et al., 1991Down , 1994Down ) is mediated by an arginine–glycine–aspartic acid (RGD) tripeptide in a viral capsid protein (Chang et al., 1989Down ), but CAV9 is also able to use an RGD-independent pathway in cell entry, since deletion or mutation of the RGD motif does not completely destroy infectivity (Roivainen et al., 1991Down ; Hughes et al., 1995Down ).

Historically, coxsackieviruses were divided into A and B subgroups according to pathogenicity in newborn mice; coxsackie A viruses induce flaccid paralysis, while coxsackie B viruses cause spastic paralysis (Dalldorf & Melnick, 1965Down ). CAVs are known to infect striated (skeletal and heart) muscle while CBVs are detected in striated muscle, the central nervous system, exocrine pancreas, liver and brown fat, and this tropism may be the basis for the pathogenicity differences exhibited (Hyypiä et al., 1993Down ). Although traditionally used as a major criterion of subgroup division of coxsackieviruses, there is no exact data about the viral determinants of the differences in mouse pathogenesis. To examine the molecular determinants affecting tissue tropism differences between coxsackie A and B viruses, a collection of recombinant viruses between CAV9 and CBV3 (overall 79·6% nucleotide sequence identity; Chang et al., 1989Down ; Klump et al., 1990Down ) was constructed. Newborn mice were infected via the intraperitoneal route, different tissues were explored by histopathology and in situ hybridization was used to localize viral genomes in tissue specimens.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Construction of recombinant cDNAs.
Molecular cloning and construction of a full-length cDNA of the CAV9 Griggs strain (Chang et al., 1989Down ) and CBV3 Nancy strain (Kandolf & Hofschneider, 1985Down ) have been described previously. Recombinant plasmids were prepared by replacing fragments, approximately corresponding to the 5'NCR, structural and non-structural genes of CAV9, by homologous sequences from CBV3. The restriction endonuclease sites used for construction were MunI (nt 598 in the CAV9 genome/nt 596 in the CBV3 genome), SmaI (nt 883 in CBV3) and SpeI (nt 3887 in the CAV9 genome/nt 3837 in the CBV3 genome). SpeI cleaves in the 2B gene and was the only possible unique site situated close to the structural genes of CAV9 and CBV3. The additional cloning sites used for preparation of the chimeras were EcoRI (CBV3), ClaI (CAV9) and XhoI (CAV9), each located downstream of the cDNA in the respective polylinker. The final constructs were examined by sequencing across the cloning sites. The names of the recombinants represent the origin of the three distinct fragments; for instance, BAB has the 5'NCR from CBV3, the structural regions from CAV9 and the non-structural regions from CBV3.

BAB.
The 3228 nt MunI–SpeI fragment, containing the structural genes of CAV9, was purified and ligated to a 7121 nt SpeI–MunI fragment obtained from the CBV3 construct. The resulting full-length plasmid BAB contained nt 1–599 from CBV3, 601–3889 from CAV9 and from 3839 to the 3' end of the genome of CBV3.

BAA.
The 3660 nt SpeI–EcoRI fragment of BAB was replaced by the 3660 nt SpeI–XhoI fragment from CAV9. This BAA plasmid contained nt 1–599 from CBV3, while the rest of the genome originated from CAV9.

AAB.
The 3660 nt SpeI–EcoRI fragment, representing the non-structural genes and 3'NCR of the CBV3 genome, was subcloned into pBluescript II plasmid (Stratagene). A 3680 nte fragment containing the insert was cleaved with SpeI and ClaI, and ligated to a 6820 nt ClaI–SpeI fragment obtained from the CAV9 cDNA construct. The plasmid AAB contained a full-length recombinant cDNA consisting of nt 1–3889 from the CAV9 genome and 3839 to the 3' poly(A) from CBV3.

BBA.
The 3660 nt SpeI–ClaI fragment representing the non-structural genes and 3'NCR region of CAV9 was subcloned into pBluescript II plasmid. A 3680 nt fragment from this plasmid was cleaved with SpeI and XhoI, and ligated to a fragment (6820 nt) obtained from the CBV3 construct with EcoRI and SpeI. This plasmid BBA contained nt 1–3830 from CBV3 and 3889–7445 from CAV9.

ABA.
This plasmid was constructed using fusion PCR and molecular cloning, since it proved impossible to use the MunI site for its preparation. Two primer pairs were used to amplify fragments from CAV9 (nt 511–765; primers 1 and 2) and CBV3 (nt 741–910; primers 3 and 4) cDNAs. These products were used together as a template when amplifying a 403 nt PCR product using primers 1 and 4. Primers 1 (5' CGTGTCGTAACGGGCAACTCTG 3') and 3 (5' ATGGGAGCTCAAGTATCAACG 3'; ATG is the start codon at the beginning of the VP4 protein) were antisense primers, whereas the polarity of primers 2 (5' CGTTGATACTTGAGCTCCCATTTTGTTGTATTGAATAAC 3') and 4 (5' ATCGATCTGTGTGAACTTGCCCGGGTC 3'; ATCGAT is an unnatural ClaI site and CCCGGG is a natural SmaI site) was sense. The PCR reaction mixture contained 2 µl of cDNA, 100 pmol of the primers, 0·25 mM dNTPs, 10 mM Tris–HCl (pH 8·8), 50 mM KCl, 1·5 mM MgCl2, 0·1% Triton X-100 and 1 U Taq polymerase (Perkin-Elmer). Amplification was initiated with one cycle at 95 °C for 10 min followed by 30 cycles of 95 °C for 1 min, 45 °C for 2 min and 72 °C for 3 min, and finally one cycle at 72 °C for 7 min. Gel-purified fusion PCR product (CAV9 from nt 511 to 746 and CBV3 from nt 744 to 910) was cloned into the pGEM-T easy vector (Promega) and sequenced. A 409 bp fragment obtained from the amplicon using MunI and SpeI was ligated to the AAB SpeI–MunI fragment (7162 nt). A XbaI fragment from this clone (containing CAV9 cDNA from nt 1 to 598, CBV3 from nt 598 to 910 and CBV3 from nt 3837 to 7399) was ligated into pBluescript II plasmid. Moving the cDNA to the pBluescript II vector made the SmaI site in CBV3 cDNA unique in the resultant clone and facilitated the subsequent use of SmaI. Then, a SmaI–ClaI fragment (6516 nt) from the BBA plasmid was ligated to a ClaI–SmaI fragment (3885 nt) obtained from the subclone. The resulting full-length construct consisted of CAV9 from nt 1 to 744 (i.e. all the 5'NCR), CBV3 from nt 755 to 3839 and CAV9 from nt 3889 to the 3' terminus.

{blacksquare} Generation of viruses and infectivity assays.
Recombinant and parental RNAs, generated from linearized cDNA clones using SP6 or T7 RNA polymerase (Promega), were transfected into green monkey kidney (GMK) cells using the lipofectin procedure (Life Technologies). The cells were incubated until complete CPE was observed, collected and then, after three cycles of freezing and thawing, the stocks were used to infect new cells. The sequences of chimeric sites in the genomes were determined after RNA isolation and RT–PCR (Santti et al., 2000Down ). The virus titres were determined by a plaque assay (Hughes et al., 1995Down ). To examine the growth curves of the recombinant viruses, GMK cells were infected with 10 p.f.u. of virus stock per cell. The virus titres of the samples, collected after different time intervals, were determined using the plaque assay. To further investigate the growth properties of the viruses, rhabdomyosarcoma (RD) cell monolayers were infected with 10 p.f.u. per cell and the cells were immunoperoxidase-stained using heat-treated echovirus 11 rabbit antiserum (known to react with CAV9 and CBVs; T. Hyypiä, unpublished data) 1 and 4 days after infection (Waris et al., 1990Down ).

{blacksquare} Animal experiments.
To study in vivo pathogenicity of the recombinant viruses, groups of BALB/c mice (Animal Center of the University of Turku) were infected at the age of 8–24 h intraperitoneally with 2x104 p.f.u. of the chimeric (BAA, ABA, BBA, AAB or BAB) or parental (CAV9 or CBV3) viruses in 50 µl of PBS. The groups of mice (the size of litters varied from 4 to 13) were maintained separately. The mice were observed daily. One to three mice from each group were decapitated 1, 3 and 5 days post-infection (p.i.) and fixed in 10% formalin. Transverse sections of the head, upper and lower abdomen, and lower limb were embedded in paraffin and used for microscopic examination.

{blacksquare} Histopathology and in situ hybridization.
Histopathological features were analysed in tissue sections stained with Herovichi stain. In situ hybridization using a CAV9 (Chang et al., 1989Down ) and CBV3 (Kandolf & Hofschneider, 1985Down ) cDNA probe mixture, radiolabelled with [35S]dATP and [35S]dCTP (NEN) using nick translation (Gibco BRL) to a specific activity of 5x108 c.p.m./µg, was used to determine the presence of viral mRNA in tissue sections (Arola et al., 1995Down ). Both uninfected mouse tissue and a plasmid probe were used to control the specificity of the hybridization reactions. After hybridization and washes, slides were dipped in photographic emulsion and stored at 4 °C for 12 days, when they were developed and fixed. The slides were counterstained with haematoxylin and eosin.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Construction of recombinant cDNAs
We produced a collection of viral chimeras between CAV9 and CBV3 (Fig. 1Down) in order to localize genomic regions responsible for different cell and tissue tropisms between coxsackie A and B viruses. To determine the role of the 5'NCR in mouse pathogenicity, BAA (containing nt 1–599 from CBV3 and the rest of the genome from CAV9) was constructed. Recombinant ABA contained CAV9 sequences with the exception of nt 755–3839, which code for the CBV3 capsid proteins, 2A protein and a part of 2B protein. This recombinant was constructed to determine whether the CBV3 structural proteins would be sufficient to convert the recombinant strain into a neurovirulent virus in the mouse model. Recombinant BAB, consisting of CBV3 sequences surrounding capsid protein genes of CAV9 (nt 601–3889), was prepared to study the effect of the CAV9 capsid on cell and tissue tropism. The role of the non-structural genes in mouse virulence was examined using BBA and AAB recombinant viruses, where the corresponding parts of the genomes were changed.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Schematic diagram of parental and recombinant cDNAs used to generate viruses. The designation of each plasmid is shown at the right and the restriction sites used for the construction of the chimeric genomes are depicted at the top. Each genome has either the T7 (CAV9, AAB, ABA) or SP6 (CBV3, BAB, BAA, BBA) promoter for transcription of infectious viral RNA. White boxes, CAV9 Griggs strain; black boxes, CBV3 Nancy strain.

 
Growth properties of recombinant viruses
The high degree of similarity between CAV9 and CBV3 (overall 79·6% nucleotide sequence identity; Chang et al., 1989Down ; Klump et al., 1990Down ) suggested that different parts of the genomes might be interchangeable in order to produce viable viruses. Transfection of GMK cells with RNA transcripts from the parental and the five chimeric plasmids gave complete CPE within 3 days. Examination of the growth curves of recombinant viruses in GMK cells showed similar production of infectious virus when compared with the parental viruses CAV9 and CBV3 (Fig. 2DownA). Maximum virus yield was obtained approximately 8 h p.i. To investigate further the characteristics of the chimeric viruses, the infectivity assays were performed in RD cells, which are susceptible to CAV9 but not to CBV3 infection (Fig. 2BDown). In repeated experiments, this cell line did not support the growth of ABA and BBA recombinant viruses (i.e. those with a CBV3 capsid region), while all other chimeric strains grew efficiently. These results indicate a central role for the viral capsid, for instance, in mediating cell tropism in vitro, as the growth properties of the recombinants differed in RD cells but not in GMK cells.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 2. Growth properties of parental and chimeric viruses in cell culture. (A) GMK cells were inoculated with the virus stock (10 p.f.u./cell), samples were collected at given time points and virus titres were determined by plaque assay. (B) RD cells were infected with the virus stocks (10 p.f.u./cell) and stained using antiserum recognizing capsid proteins of CAV9 and CBV3. The cultures infected with CAV9, AAB, BAB and BAA were stained 1 day p.i., while control, CBV3-, ABA- and BBA-infected cultures were stained 4 days p.i. Original magnification x32.

 
Infection of newborn BALB/c mice with recombinant viruses
To analyse the effect of different genomic regions on tissue tropism and pathogenicity in vivo, BALB/c mice were infected intraperitoneally. These BALB/c mice were inbred, but the effect of genetic background was not further characterized and may have had some influence on the results. Following the inoculation, one to three mice from each group were sacrificed after 1–5 days, and cross-sections were used to determine the presence of viral RNA by in situ hybridization. Most of the newborn mice infected with CAV9 or CBV3 died between 3 and 5 days p.i. (Table 1Down). It was observed consistently that BAA-infected animals died before the third day post-infection, while the mortality of the ABA- and BAB-infected mice resembled that of parental viruses, as some animals were still alive on day 3 p.i. but died before the fifth day. The BBA and AAB recombinants appeared to be less virulent because some mice survived until day 5 p.i.


View this table:
[in this window]
[in a new window]
 
Table 1. Infection of parental and recombinant viruses in Balb/C mice

 
Tissue tropism of recombinant viruses
The presence of parental and recombinant virus mRNA as detected by in situ hybridization and the histopathological features in selected tissues (liver, pancreas, skeletal muscle and the central nervous system) were specifically analysed (Figs 3Down, 4Down and 5Down). These results are summarized in Table 2Down.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 3. Histopathological changes in Herovici-stained murine muscle and liver tissues. Myofibre degeneration (arrows) in intercostal muscles of an animal infected with the ABA recombinant was observed 3 days after intraperitoneal infection (A), and necrosis of hepatocytes (arrow) was observed 3 days after BBA infection (B). Original magnification x156.

 


View larger version (124K):
[in this window]
[in a new window]
 
Fig. 4. Localization of viral RNA in skeletal muscle (left panel; original magnifications A–E x32), spinal cord (middle panel; original magnifications A x32, B–E x20) and pancreas (right panel; original magnifications A–C, E x51, D x80) in dark field pictures by in situ hybridization analysis. SI, small intestine. (A) ABA replicates efficiently in the skeletal muscle and the spinal cord 3 days p.i., while a detectable signal from the pancreas was obtained only 1 day p.i. (B) Three days after AAB infection, signals were obtained from skeletal muscle, mostly from the intercostal muscles, but the spinal cord and pancreas remained negative. (C) Replication of BBA was less prominent in the skeletal muscle, whereas strong signals were present in the anterior column of the spinal cord (3 days p.i.) and in the exocrine pancreas (1 day p.i.). (D) Positive reactions were also seen also in the skeletal muscle, the spinal cord (3 days p.i.) and the pancreas (1 day p.i.) after BAB infection. (E) Analysis of viral RNA 1 day after BAA infection showed some signals in the skeletal muscle and pancreas, but not in the spinal cord. (F) Intercostal muscles of an animal infected with CAV9 appeared strongly positive 3 days p.i., whereas the spinal cord and pancreas remained negative. (G) Localization of viral RNA showed that CBV3 replicated efficiently in the spinal cord (3 days p.i.) and pancreas (1 day p.i.), but less prominently in the skeletal muscle (3 days p.i).

 


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 5. Liver tissue samples of mice infected with BBA (A), ABA (C) or parental CBV3 (F) strain were positive by in situ hybridization 1 day p.i. whereas liver specimens of mice infected with AAB (B), BAA (D), BAB (E) or parental CAV9 (G) remained negative. Bright field pictures are on the left side and the corresponding dark field pictures are on the right. Original magnifications: (A)–(B) x64, (F) x80, (C)–(G) x103.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Tissue tropism of recombinant and parental viruses

 
Liver.
In the liver, hepatocytes were positive by hybridization analysis following infection by CBV3 as well as ABA and BBA chimeras 1 day p.i., whereas no signal was seen following CAV9, BAB, BAA and AAB infections (Fig. 5Up). Only in BBA-infected mice with intensive signal was necrosis of hepatocytes observed (Fig. 3BUp), whereas in the other mice no definitive tissue destruction was detected.

Pancreas.
CBV3, ABA, BBA, BAB and BAA recombinant genomes were detectable by in situ hybridization analysis in the exocrine part of the pancreas 1 day after inoculation, whereas no signals were obtained after CAV9 and AAB infections (Fig. 4Up). The hybridization signal seen in ABA- and BBA-infected mice was much more intense than that observed after BAA and BAB infections. Histological tissue destruction, inflammation and acinar cell necrosis correlated well with the intensity of the hybridization signal.

Central nervous system.
While CBV3, ABA, BBA and BAB chimeras replicated in the central nervous system, CAV9 and the AAB recombinant did not (Fig. 4Up). The neurotropism of the BAA strain remained unknown, since all BAA-infected mice died before the third day when the signals were normally seen. The hybridization signal was mainly located in the neurons of the anterior column of the spinal cord and brain, whereas glial cells appeared to remain negative. Due to variation among individual animals, the significance of differences in the intensity of the hybridization signals was difficult to assess. No histopathological changes were found in the central nervous system.

Skeletal muscle.
Skeletal muscle was strongly positive by in situ hybridization analysis of CAV9, AAB and ABA infections 1 day p.i. (Fig. 4Up). The intense signals were obtained, for example, from diaphragm, intercostal and thigh muscles. CBV3, BBA, BAB and BAA also replicated in the skeletal muscle, although the signal was much weaker than that observed during AAB and ABA infection. Histopathological changes, including degeneration of myofibres (Fig. 3AUp), were observed 3 days p.i.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Initial replication of enteroviruses usually occurs in the respiratory and gastrointestinal tracts. Thereafter, the viruses can reach the bloodstream and cause viraemia, which occasionally leads to the infection of secondary target organs such as the central nervous system, myocardium and pancreas. Tissue tropism of enteroviruses partially stems from the presence of receptor molecules on the cell surface that are recognized by the virus and initiate internalization and uncoating events (Evans & Almond, 1998Down ). However, the expression of virus receptor on the cells, a relatively well-known feature, does not completely explain tissue tropism. Interactions of the 5'NCR and determinants in the viral genome also contribute significantly to the phenomenon (Ren et al., 1990Down ; Koike et al., 1991Down ; Ren & Racaniello, 1992Down ; Freistadt et al., 1993Down ; Gromeier et al., 1999Down , 2000Down ).

In this work, we explored genomic regions responsible for tissue tropism differences in a mouse model for coxsackie A and B virus interactions, using recombinant viruses. Although all CAV reference strains replicate in newborn mice, and myositis in the absence of lesions elsewhere is a typical finding for CAVs (Hyypiä et al., 1993Down ), they have been found to differ genetically from each other (Pulli et al., 1995Down ; Hyypiä et al., 1997Down ; King et al., 2000Down ). The 23 CAV serotypes fall into two genetic clusters, with the sole exception of CAV9, which is genetically more closely related to CBVs and echoviruses than to other CAVs. CAV9 was chosen for the study since it has typical CAV-like tropism, but its close sequence similarity to CBVs suggested that the different parts of the genomes would be interchangeable, producing viable chimeras. CBV3 was chosen as a typical representative of the CBV group.

The interaction between the virus and its specific receptor is determined by the capsid structure. According to our results, the capsid (structural) genes of CAV9 are needed for growth of the chimeric viruses in RD cells, since BBA and ABA recombinants were not viable in these cells. This observation is consistent with findings that the CBV3 Nancy strain cannot replicate in RD cells, which are known to lack the CBV receptor CAR (Bergelson et al., 1995Down ). Comparisons among sequences of different CBV3 strains have shown that a CBV3 mutant with modifications in the VP2 gene is able to replicate in the RD cell line, and this is correlated with acquisition of DAF-binding ability through the mutations (Lindberg et al., 1992Down ). The phenotype of another CBV3 variant, showing a weak interaction with CAR but strong binding to DAF, was due to six mutations in the VP1 gene (Schmidtke et al., 2000Down ).

Our findings suggest that the structural genes of CBV3 determine tropism to the liver tissue in newborn mice because, similarly to the parental CBV3 strain, recombinant viruses containing the CBV3 capsid proteins were detectable 1 day p.i. in the hepatocytes (Fig. 5Up). In contrast, CAV9 and recombinants containing CAV9 capsid gene sequences were not detectable in hepatocytes. The structural genes of CBV3 may also contain the primary determinants of mouse pancreovirulence, since very intensive hybridization signals and significant histopathological changes were observed following inoculation of mice with the CBV3 strain, BBA or ABA recombinants (Fig. 4Up), whereas inoculation with the BAA and BAB recombinants did not result in extensive signals in the pancreas. None the less, as BAB and BAA gave some, albeit weaker, signals, the CBV3 5'NCR appears to contribute to pancreotropism. Measuring the titre of infectious virus in each tissue would have been informative, but due to the extremely small size of tissues, it was impossible to perform. It has been shown that the CAR functions as a receptor for CBVs (Bergelson et al., 1997Down ), but, in contrast, CAV9 does not appear to recognize CAR. The histopathology observed is consistent with these observations as CAR is known to be widely expressed in liver tissue (Bergelson et al., 1998Down ) and in pancreas acinar cells (Mena et al., 2000Down ). These results suggest that CAR may be required for infection of liver and pancreas, offering an explanation of why the capsid genes of CBV3 are the major liver and pancreotropism determinants in the coxsackievirus genome.

The chimeric viruses containing the capsid proteins of CBV3 were detectable in the spinal cord 3 days p.i. (Fig. 4Up), providing evidence that the structural genes of CBV3 also contain the primary determinants for neurotropism in mice. In addition to the capsid genes, the 2A gene or the part of the 2B gene (nt 3304–3837 in the genome of CBV3) present in the recombinant viruses could also contain significant tropism determinants. This alternative cannot be completely excluded, though it is less probable. However, the situation appeared to be more complex in the central nervous system compared with the liver and pancreas tissues, as the BAB recombinant (and to a lesser extent the BAA recombinant) also exhibited neurotropism. This may be a reflection of the level of viraemia or other unknown factors, which determine virus replication in the central nervous system.

In addition to viral receptors, several intracellular factors can be involved in determining tissue tropism. In our work, all chimeras having the 5'NCR of CAV9 replicated efficiently in skeletal muscle, and the recombinants containing the 5'NCR of CBV3 were detectable in the exocrine pancreas (Fig. 4Up), suggesting that there are some intracellular factors in these tissues that bind specifically either to the 5'NCR of CAV9 or CBV3 and modulate their functions. An ABB construct, which proved impossible to produce, may have given further confirmation of the contribution of the 5'NCR to tropism. A number of cellular proteins are known to bind to the 5'NCR, although little is known about the interaction patterns exhibited by different 5'NCRs. Since the overall sequence identity between the 5'NCR of CAV9 and CBV3 is 84%, and even in the hypervariable region (corresponding to nt 655–743 of the CAV9 genome) the identity is as high as 71%, relatively subtle changes must be responsible for the differences in tropism between the viruses. In previous studies, the 5'NCR region has been shown to contribute to the virulence or tropism of other enteroviruses. For instance, the virulence of CBV1 in a mouse model (Rinehart et al., 1997Down ) and the cardiovirulent phenotype of CBV3 maps to a 5'NCR determinant at one or more positions (Tu et al., 1995Down ; Dunn et al., 2000Down ), and attenuating mutations of picornaviruses (PVs) map to single nucleotides in the region (Evans et al., 1985Down ; Svitkin et al., 1990Down ; Ren et al., 1991Down ; Minor, 1992Down ).

Binding of the viral protein 3CD to the 5'NCR has been shown to be essential for RNA replication of enteroviruses, and the binding is also known to modulate interactions between the internal ribosomal entry site and different cellular proteins (Andino et al., 1999Down ; Gamarnik & Andino, 2000Down ). If the 5'NCR and the viral proteins originate from different viruses, mouse lethality could be affected by altering such RNA–protein interactions. Replacement of the CBV3 5'NCR with that of a genetically rather distant PV is known to result in a chimeric virus with attenuated phenotype when assessed for pancreo- and cardiovirulence (Chapman et al., 2000Down ). Interestingly, recombinant viruses carrying either the 5'NCR from CAV9 together with the 3CD protein gene region from CBV3, or the 5'NCR from CBV3 together with the 3CD gene from CAV9 replicated almost as wild-type viruses in GMK or RD cell lines. Moreover, the tissue tropism of the AAB and BBA recombinants was not affected when compared with the parental viruses. However, minor differences in overall mouse lethality, which may be due to alterations in RNA–protein interactions, were observed, as the AAB and BBA recombinants exhibited somewhat reduced lethality (Table 1Up). In contrast, the BAA construct had apparently increased virulence, indicating that the 5'NCR/3CD interaction is not necessarily impaired in this construct. An alternative explanation for these differences in lethality is that structural region processing, known to be achieved by 3CD, is impaired in constructs such as BBA and AAB, where structural proteins and 3CD have different origins. A similar difference in mouse lethality is seen between BAA (high mouse lethality), which has structural and non-structural proteins from the same source, and BBA (lower mouse lethality), which has them from different sources.

In previous studies, recombination has been shown to occur between different enteroviruses in nature and recombination breakpoints in the genome have been suggested to include the junction between the 5'NCR and the structural genes, as well as sequences in the non-structural region (Santti et al., 1999Down ). Our results give further support for the biological potential of recombination events, at least amongst closely related viruses such as CAV9 and CBV3, since replacing the 5'NCR, the structural or the non-structural genes of CAV9 with the corresponding sequences from CBV3 yielded viable viruses. In some cases this caused altered tropism, suggesting that recombination in nature could be an important source of pathogenic variants.

In conclusion, the present study was carried out to localize genomic regions responsible for different tissue tropisms between coxsackie A and B viruses in newborn mice. Mouse pancreo- and liver tropism was shown to map mainly to the CBV3 sequences within the structural genes, evidently due to the receptor recognition. Although the major neurotropism determinant in CBV3 genome was in the capsid region, viruses containing the CAV9 capsid were also able to initiate infection in the central nervous system. Infection of skeletal muscle was clearly enhanced by the 5'NCR of CAV9. In addition, the viability of chimeric viruses constructed between CAV9 and CBV3 suggested that recombination could take place in nature, partly explaining the genetic diversity and pathogenetic variation among human coxsackieviruses.


   Acknowledgments
 
We thank Mrs Liisa Lempiäinen, Mrs Marita Maaronen, Mrs Marja-Leena Mattila, Mrs Seija Linqvist and Dr Abdolrahman Nateri for assistance. This study was supported by grants from the Academy of Finland, the Finnish Foundation for Research on Viral Diseases, the Sigrid Juselius Foundation, Turku Graduate School of Biomedical Sciences and by EVO research fund (No. 13475) of Turku University Hospital.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Andino, R., Böddeker, N., Silvera, D. & Gamarnik, A. V. (1999). Intracellular determinants of picornavirus replication. Trends in Microbiology 7, 76-82.[Medline]

Arola, A., Kalimo, H., Ruuskanen, O. & Hyypiä, T. (1995). Experimental myocarditis induced by two different coxsackievirus B3 variant: aspects of pathogenesis and comparison of diagnostic methods. Journal of Medical Virology 47, 251-259.[Medline]

Bergelson, J. M., Mohanty, J. G., Crowell, R. L., St John, N. F., Lublin, D. M. & Fingerg, R. W. (1995). Coxsackievirus B3 adapted to growth in RD cells binds to decay-accelerating factor (CD55). Journal of Virology 69, 1903-1906.[Abstract]

Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L. & Finberg, R. W. (1997). Isolation of common receptor for coxsackie B viruses and adenovirus 2 and 5. Science 275, 1320-1323.[Abstract/Free Full Text]

Bergelson, J. M., Krithivas, A., Celi, L., Droguett, G., Horwitz, M. S., Wickham, T., Crowell, R. L. & Finberg, R. W. (1998). The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. Journal of Virology 72, 415-419.[Abstract/Free Full Text]

Caggana, M., Chan, P. & Ramsingh, A. (1993). Identification of a single amino acid residue in the capsid protein VP1 of coxsackievirus B4 that determines the virulent phenotype. Journal of Virology 67, 4797-4803.[Abstract/Free Full Text]

Chang, K. H., Auvinen, P., Hyypiä, T. & Stanway, G. (1989). The nucleotide sequence of coxsackievirus A9 – implication for receptor binding and enterovirus classification. Journal of General Virology 70, 3269-3280.[Abstract/Free Full Text]

Chapman, N. M., Ragland, A., Leser, J. S., Höfling, K., Willian, S., Semler, B. L. & Tracy, S. (2000). A group B coxsackievirus/poliovirus 5' nontranslated region chimera can act as an attenuated vaccine strain in mice. Journal of Virology 74, 4047-4056.[Abstract/Free Full Text]

Dalldorf, G. & Melnick, J. L. (1965). Coxsackieviruses. In Viral and Rickettsial Infections on Man , pp. 472-512. Edited by F. L. Horsfall & I. Tamm. Philadelphia:Lippincott.

Dunn, J. J., Chapman, N. M., Tracy, S. & Romero, J. R. (2000). Genomic determinants of cardiovirulence in coxsackievirus B3 clinical isolates: localization to the 5' nontranslated region. Journal of Virology 74, 4787-4794.[Abstract/Free Full Text]

Evans, D. M. A., Dunn, G., Minor, P. D., Schild, G. C., Cann, A. J., Stanway, G., Almond, J. W., Currey, K. & Maizel, J. V. (1985). A single nucleotide change in the 5' non-coding region of the genome of the Sabin type 3 poliovaccine is associated with increased neurovirulence. Nature 314, 548-550.[Medline]

Evans, J. D. & Almond, W. J. (1998). Cell receptors for picornaviruses as determinants of cell tropism and pathogenesis. Trends in Microbiology 6, 198-202.[Medline]

Freistadt, M. S., Fleit, H. B. & Wimmer, E. (1993). Poliovirus receptor on human blood cells: a possible extraneural site of poliovirus replication. Virology 195, 798-803.[Medline]

Gamarnik, A. V. & Andino, R. (2000). Interactions of viral protein 3CD and poly(rC) binding protein with the 5' untranslated region of the poliovirus genome. Journal of Virology 74, 2219-2226.[Abstract/Free Full Text]

Grist, N. R., Bell, E. J. & Assaad, F. (1978). Enteroviruses in human disease. Progress in Medical Virology 24, 114-157.[Medline]

Gromeier, M., Bossert, B., Arita, M., Nomoto, A. & Wimmer, E. (1999). Dual stem loops within the poliovirus internal ribosomal entry site control neurovirulence. Journal of Virology 73, 958-964.[Abstract/Free Full Text]

Gromeier, M., Solecki, D., Patel, D. D. & Wimmer, E. (2000). Expression of the human poliovirus receptor/CD155 gene during development of the central nervous system: implications for the pathogenesis of poliomyelitis. Virology 273, 248-257.[Medline]

Hovi, T., Stenvik, M. & Rosenlew, M. (1996). Relative abundance of enterovirus serotypes in sewage differs from that in patients: clinical and epidemiological implications. Epidemiology and Infection 116, 91-97.[Medline]

Hughes, P., Horsnell, C., Hyypiä, T. & Stanway, G. (1995). The coxsackievirus A9 RGD motif is not essential for virus viability. Journal of Virology 69, 8035-8040.[Abstract]

Hyypiä, T., Kallajoki, M., Maaronen, M., Stanway, G., Kandolf, R., Auvinen, P. & Kalimo, H. (1993). Pathogenetic differences between coxsackie A and B virus infections in newborn mice. Virus Research 27, 71-78.[Medline]

Hyypiä, T., Hovi, T., Knowles, N. J. & Stanway, G. (1997). Classification of enteroviruses based on molecular and biological properties. Journal of General Virology 78, 1-11.[Medline]

Kandolf, R. & Hofschneider, P. H. (1985). Molecular cloning of the genome of a cardiotropic coxsackie B3 virus: full-length reverse-transcribed recombinant cDNA generates infectious virus in mammalian cells. Proceedings of the National Academy of Sciences, USA 82, 4818-4822.[Abstract/Free Full Text]

King, A. M. Q., Brown, F., Christian, P., Hovi, T., Hyypiä, T., Knowles, N. J., Lemon, S. P., Minor, P. D., Palmenberg, A. C., Skern, T. & Stanway, G. (2000). Picornaviridae. In Virus taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 657-673. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.

Klump, W. M., Bergmann, I., Muller, B. C., Ameis, D. & Kandolf, R. (1990). Complete nucleotide sequence of infectious coxsackievirus B3 cDNA: two initial 5' uridine residues are regained during plus-strand RNA synthesis. Journal of Virology 64, 1573-1583.[Abstract/Free Full Text]

Knowlton, K. U., Jeon, E. S., Berkley, N., Wessely, R. & Huber, S. (1996). A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3. Journal of Virology 70, 7811-7818.[Abstract]

Koike, S., Taya, S., Kurata, T., Abe, S., Ise, I., Yonekawa, H. & Nomoto, A. (1991). Transgenic mice susceptible to poliovirus. Proceedings of the National Academy of Sciences, USA 88, 951-955.[Abstract/Free Full Text]

Lindberg, A. M., Crowell, R. L., Zell, R., Kandolf, R. & Petterson, U. (1992). Mapping of the RD phenotype of the Nancy strain of coxsackievirus B3. Virus Research 24, 187-196.[Medline]

Mena, I., Fischer, C., Gebhard, J. R., Perry, C. M., Harkins, S. & Whitton, J. L. (2000). Coxsackievirus infection of the pancreas: evaluation of receptor expression, pathogenesis, and immunopathology. Virology 271, 276-288.[Medline]

Minor, D. P. (1992). The molecular biology of poliovaccines. Journal of Virology 73, 3065-3077.

Moore, M. & Morens, D. M. (1984). Enteroviruses, including polioviruses. In Textbook of Virology , pp. 407-483. Edited by R. B. Belshe. Massachusetts:PGS Publishing Company.

Pulli, T., Koskimies, P. & Hyypiä, T. (1995). Molecular comparison of coxsackie A virus serotypes. Virology 212, 30-38.[Medline]

Ramsingh, A. & Collins, D. N. (1995). A point mutation in the VP4 coding sequence of coxsackievirus B4 influences virulence. Journal of Virology 69, 7278-7281.[Abstract]

Ren, R. & Racaniello, V. (1992). Human poliovirus receptor gene expression and poliovirus tissue tropism in transgenic mice. Journal of Virology 66, 296-304.[Abstract/Free Full Text]

Ren, R., Constantini, F., Gorgacz, E. J., Lee, J. J. & Racaniello, V. R. (1990). Transgenic mice expressing a human poliovirus receptor: a new model for poliomyelitis. Cell 63, 353-362.[Medline]

Ren, R., Ross, E. G. & Racaniello, V. R. (1991). Identification of two determinants that attenuate vaccine-related type 2 poliovirus. Journal of Virology 65, 1377-1380.[Abstract/Free Full Text]

Rinehart, J. E., Gómez, R. M. & Roos, R. P. (1997). Molecular determinants for virulence in coxsackievirus B1 infection. Journal of Virology 71, 3986-3991.[Abstract]

Roivainen, M., Hyypiä, T., Piirainen, L., Kalkkinen, N., Stanway, G. & Hovi, T. (1991). RGD-dependent entry of coxsackievirus A9 into host cell and its bypass after cleavage of VP1 protein by intestinal proteases. Journal of Virology 65, 4735-4740.[Abstract/Free Full Text]

Roivainen, M., Piirainen, L., Hovi, T., Virtanen, I., Riikonen, T., Heino, J. & Hyypiä, T. (1994). Entry of coxsackievirus A9 into host cells: specific interactions with {alpha}v{beta}3 integrin, the virtonectin receptor. Virology 203, 357-365.[Medline]

Santti, J., Hyypiä, T., Kinnunen, L. & Salminen, M. (1999). Evidence of recombination among enteroviruses. Journal of Virology 73, 8741-8749.[Abstract/Free Full Text]

Santti, J., Harvala, H., Kinnunen, L. & Hyypiä, T. (2000). Molecular epidemiology and evolution of coxsackievirus A9. Journal of General Virology 81, 1361-1372.[Abstract/Free Full Text]

Schmidtke, M., Selinka, H. C., Heim, A., Jahn, B., Tonew, M., Kandolf, R., Stelzner, A. & Zell, R. (2000). Attachment of coxsackievirus B3 variants to various cell lines: mapping of phenotype differences to capsid protein VP1. Virology 275, 77-88.[Medline]

Svitkin, Y. V., Cammack, N., Minor, P. D. & Almond, J. (1990). Translation deficiency of the Sabin type 3 poliovirus genome: association with an attenuating mutation C472->U. Virology 175, 103-109.[Medline]

Tu, Z., Chapman, N. M., Hufnagel, G., Tracy, S., Romero, J. R., Barry, W. H., Zhao, L., Currey, K. & Shapiro, B. (1995). The cardiovirulent phenotype of coxsackievirus B3 is determined at a single site in the genomic 5' nontranslated region. Journal of Virology 69, 4607-4618.[Abstract]

Waris, M., Ziegler, T., Kivivirta, M. & Ruuskanen, O. (1990). Rapid detection of respiratory syncytial virus and influenza A virus in cell cultures by immunoperoxidase staining with monoclonal antibodies. Journal of Clinical Microbiology 28, 1159-1162.[Abstract/Free Full Text]

Received 30 October 2001; accepted 30 January 2002.


This article has been cited by other articles:


Home page
J. Virol.Home page
P. Simmonds
Recombination and Selection in the Evolution of Picornaviruses and Other Mammalian Positive-Stranded RNA Viruses
J. Virol., November 15, 2006; 80(22): 11124 - 11140.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. T. Gay, S. Belisle, M. A. Beck, and S. N. Meydani
An aged host promotes the evolution of avirulent coxsackievirus into a virulent strain
PNAS, September 12, 2006; 103(37): 13825 - 13830.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Simmonds and J. Welch
Frequency and Dynamics of Recombination within Different Species of Human Enteroviruses
J. Virol., January 1, 2006; 80(1): 483 - 493.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Harvala, H. Kalimo, J. Bergelson, G. Stanway, and T. Hyypia
Tissue tropism of recombinant coxsackieviruses in an adult mouse model
J. Gen. Virol., July 1, 2005; 86(7): 1897 - 1907.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Stadnick, M. Dan, A. Sadeghi, and J. K. Chantler
Attenuating Mutations in Coxsackievirus B3 Map to a Conformational Epitope That Comprises the Puff Region of VP2 and the Knob of VP3
J. Virol., December 15, 2004; 78(24): 13987 - 14002.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Simmonds
Genetic diversity and evolution of hepatitis C virus - 15 years on
J. Gen. Virol., November 1, 2004; 85(11): 3173 - 3188.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. H. Williams, T. Kajander, T. Hyypia, T. Jackson, D. Sheppard, and G. Stanway
Integrin {alpha}v{beta}6 Is an RGD-Dependent Receptor for Coxsackievirus A9
J. Virol., July 1, 2004; 78(13): 6967 - 6973.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. Feuer, I. Mena, R. R. Pagarigan, S. Harkins, D. E. Hassett, and J. L. Whitton
Coxsackievirus B3 and the Neonatal CNS: The Roles of Stem Cells, Developing Neurons, and Apoptosis in Infection, Viral Dissemination, and Disease
Am. J. Pathol., October 1, 2003; 163(4): 1379 - 1393.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Harvala, H. Kalimo, G. Stanway, and T. Hyypia
Pathogenesis of coxsackievirus A9 in mice: role of the viral arginine-glycine-aspartic acid motif
J. Gen. Virol., September 1, 2003; 84(9): 2375 - 2379.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harvala, H.
Right arrow Articles by Stanway, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harvala, H.
Right arrow Articles by Stanway, G.
Agricola
Right arrow Articles by Harvala, H.
Right arrow Articles by Stanway, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS