J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hötzel, I.
Right arrow Articles by Cheevers, W. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hötzel, I.
Right arrow Articles by Cheevers, W. P.
Agricola
Right arrow Articles by Hötzel, I.
Right arrow Articles by Cheevers, W. P.
Journal of General Virology (2002), 83, 1759-1764.
© 2002 Society for General Microbiology


Animal: RNA Viruses

A maedi–visna virus strain K1514 receptor gene is located in sheep chromosome 3p and the syntenic region of human chromosome 2

Isidro Hötzel1 and William P. Cheevers1

Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164-7040, USA1

Author for correspondence: Isidro Hötzel. Fax +1 509 335 8529. e-mail ihe{at}vetmed.wsu.edu


   Abstract
TOP
Abstract
Main text
References
 
The maedi–visna lentivirus (MVV) induces encephalitis, interstitial pneumonia, arthritis and mastitis in sheep. While some MVV strains can enter cells of ruminant species only, others can enter cells from many species, including human, but not Chinese hamster cells. However, the identity of the receptor(s) used by MVV for entry is unknown. The MVV-K1514 receptor gene was localized in sheep and human chromosomes using hamsterxsheep and hamsterxhuman hybrid cell lines. Based on entry by a vector pseudotyped with the MVV-K1514 envelope, the MVV-K1514 receptor gene was mapped to sheep chromosome 3p and to a region of human chromosome 2 (2p25>q13), which has conserved synteny with sheep chromosome 3p. These regions do not include any known lentivirus receptor or coreceptor gene, indicating that MVV-K1514 uses a new lentivirus receptor to infect human cells.


   Main text
TOP
Abstract
Main text
References
 
The ovine maedi–visna lentivirus (MVV) causes encephalitis, interstitial pneumonia, mastitis and arthritis in sheep (Narayan et al., 1993Down ). Although productive MVV replication in vivo is restricted to cells of the monocyte/macrophage lineage and dendritic cells, many cell types express MVV receptors in vitro and possibly in vivo (Brodie et al., 1995Down ; Gendelman et al., 1985Down , 1986Down ; Georgsson et al., 1989Down ; Gorrell et al., 1992Down ; Ryan et al., 2000Down ). MVV strains can be segregated into two groups according to recognition of receptors from different species: the Icelandic and British MVV strains K1514 and EV1 can enter cells from a wide range of species, including human, but not Chinese hamster (Cricetulus griseus) cells, while entry of North American MVV strains is restricted to cells of ruminant species (Bruett & Clements, 2001Down ; Hötzel & Cheevers, 2001Down ; Lyall et al., 2000Down ; MacIntyre et al., 1972Down ). However, the identity of the MVV receptor(s) is not known. Here, we mapped the MVV-K1514 receptor gene in sheep and human chromosomes to determine whether it is located in the same chromosome region as any other lentivirus receptor or coreceptor gene.

As ruminants and humans share extensive synteny (regions of conserved physical association of genes in chromosomes) (Band et al., 2000Down ), we first mapped the MVV-K1514 receptor gene in chromosomes of sheep, the natural host of MVV-K1514, and then tested if any of the syntenic regions of the human genome also encoded a receptor for MVV-K1514. A hamsterxsheep somatic cell hybrid panel was tested for susceptibility to infection by the caprine arthritis–encephalitis virus (CAEV) vector CAEVneo (Hötzel & Cheevers, 2001Down ) pseudotyped with the MVV-K1514 envelope [CAEVneo(K1514)], which induces resistance of infected cells to the antibiotic G418. The hamsterxsheep hybrid cell panel used in this study was produced by fusing Chinese hamster CHO cell auxotrophs with sheep lymphocytes (Burkin et al., 1998Down ). Cells were obtained from Dr James DeMartini (Colorado State University, Fort Collins, CO, USA) and grown in Ham's F12 medium with 5% foetal bovine serum (FBS) (growth medium) for only one passage after receipt to minimize sheep chromosome loss. The hybrid panel available included all sheep chromosomes (OAR) except OAR-20, -23 and -26. Pseudotyped CAEVneo was produced and titrated as described previously (Hötzel & Cheevers, 2001Down ). Briefly, human 293T cells in 60 mm plates (106 cells per plate) growing in Dulbecco's modified Eagle's medium with 10% FBS were cotransfected with plasmids pCAEVneo10 and pCMV1514 or pMEVSV-G (6 µg each) using the calcium phosphate procedure. Culture medium was changed 18 h post-transfection and the supernatants containing pseudotyped virus were harvested 40 h post-transfection. Hybrid cells in 6-well plates (2x105 cells per well) were infected with 100 µl of clarified virus supernatant in 1 ml of growth medium, trypsinized 24 h post-infection and plated in 100 mm plates at 1:2 and 1:10 dilutions in growth medium containing 1 mg/ml G418 (Gibco BRL). Colonies were stained with crystal violet 8 days post-plating and counted. As CHO-K1 cells are resistant to CAEVneo(K1514) infection (Hötzel & Cheevers, 2001Down ), susceptibility of a hybrid clone to CAEVneo(K1514) infection indicates the presence of a receptor gene in the sheep chromosome retained by the cell clone.

All clones tested were susceptible to CAEVneo pseudotyped with the vesicular stomatitis virus (VSV) envelope (data not shown), indicating a lack of post-entry blocks for CAEVneo in hybrid cell lines. In addition, none of the cell lines tested was susceptible to CAEVneo without the envelope (data not shown). Clones R612-3H9 and R891-29 were susceptible to CAEVneo(K1514), with titres about tenfold lower than the titre of CAEVneo(K1514) in goat synovial membrane (GSM) cells (Table 1Down). CAEVneo(K1514) titres in other clones were low, similar to the background levels of infectivity of this pseudotype in CHO-K1 cells (Hötzel & Cheevers, 2001Down ), or below the level of detection. That the susceptibility of clones R612-3H9 and R891-29 was conferred by sheep chromosomes and not due to susceptibility of the parental auxotroph cell lines was indicated by the inability of CAEVneo(K1514) to infect clones R612-3H39, R891-5A1, R891-29R8A and R891-27R1B, which were derived from the same parental auxotrophs as susceptible clones R612-3H9 and R891-29 (Burkin et al., 1998Down ). The only chromosomes shared by susceptible hybrid clones R612-3H9 and R891-29 are OAR-3 and -7 (Table 1Down). However, clone R612-3H39 retaining OAR-7, but not OAR-3, in the same background as susceptible cell line R612-3H9 was resistant to CAEVneo(K1514) infection (Table 1Down), indicating that the MVV-K1514 receptor gene is located in OAR-3. This is supported by the fact that clone R612-3H9 is nearly as permissive to CAEVneo(K1514) infection as clone R891-29, despite having OAR-7 in only a minority of cells (Burkin et al., 1998Down ). In addition, clone Q576-15BX, retaining OAR-3q (the long arm of OAR-3), was resistant to CAEVneo(K1514) (Table 1Down), indicating that the MVV-K1514 receptor gene is located in OAR-3p (the short arm of OAR-3).


View this table:
[in this window]
[in a new window]
 
Table 1. Infectivity of CAEVneo(K1514) to hamsterxsheep somatic cell hybrids

 
Many markers are shared between OAR-3p and human chromosomes (HSA)-2 and -9. This has been determined both directly, by mapping markers in sheep chromosomes, and indirectly, by mapping markers in bovine chromosome 11, the bovine equivalent of OAR-3p (Band et al., 2000Down ; Broad et al., 1995Down ; Lopez-Corrales et al., 1998Down , 1999Down ). Hamsterxhuman hybrid cell lines retaining HSA-2 and -9, as well as HSA-12 and -22, the human equivalents of OAR-3q (Band et al., 2000Down ; Broad et al., 1993Down ), were obtained from Coriell Cell Repositories (Camden, NJ, USA) and tested for susceptibility to CAEVneo(K1514). Again, all cell lines were susceptible to CAEVneo(VSV), none of the cell lines had spontaneous G418-resistant clones and none of the cell lines was infected by CAEVneo without viral envelope glycoproteins (data not shown). Of the four cell lines tested, only cell line GM10826, retaining HSA-2, was permissive to CAEVneo(K1514) entry (Table 2Down), indicating the presence of an MVV-K1514 receptor gene in HSA-2.


View this table:
[in this window]
[in a new window]
 
Table 2. Infectivity of CAEVneo(K1514) to hamsterxhuman somatic cell hybrids

 
To confirm the presence of an MVV-K1514 receptor gene in HSA-2, we tested hybrid cell line GM12515, also from Coriell, for susceptibility to CAEVneo(K1514). GM12515 is a Chinese hamster RJK88xhuman hybrid cell line that retains HSA-2p25>q13 fused to HSA-Xqter>q22, selectively maintained in medium containing azaserine and hypoxanthine. The HSA-2 fragment retained by GM12515 contains most of the HSA-2 regions of extensive synteny with OAR-3p (Fig. 1Down). The GM12515 cell line was highly susceptible to CAEVneo(K1514), with titres of at least 1·9x103 c.f.u./ml in different experiments, similar or higher than titres of the same CAEVneo(K1514) stocks in human HeLa-S3 cells (Table 2Up). In contrast, control cell line GM12510, also a Chinese hamster RJK88-derived hybrid cell line retaining HSA-Xqter>q22 and other human chromosome fragments, but not HSA-2, was resistant to CAEVneo(K1514), with titres below the level of detection (Table 2Up). The failure of CAEVneo(K1514) to infect two independent RJK88-derived cell lines, GM12510 and GM10888 (Table 2Up), indicates that the parental RJK88 cell line is not susceptible to CAEVneo(K1514) and that the susceptibility of GM12515 to CAEVneo(K1514) is induced by a gene in HSA-2p25>q13.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1. Ideogram of HSA-2 showing the regions retained in the MVV-K1514-susceptible cell line GM12515 (thick line). The short and long arms of HSA-2 are marked by ‘p' and ‘q', respectively. The dotted line indicates the region of HSA-2 of conserved synteny with OAR-3p.

 
Mapping of the MVV-K1514 receptor gene to regions of the sheep and human genomes of conserved synteny, HSA-2p25>q13 and OAR-3p, respectively, indicates that MVV-K1514 probably uses the same receptor for entry in human and sheep cells. MVV-K1514 receptor genes did not map to any other sheep chromosomes, except perhaps OAR-20, -23 and -26, as these were not present in the hybrid cells tested. Therefore, although we cannot exclude the possibility that MVV-K1514 receptor genes are present in other sheep chromosomes but not expressed in the hybrid cell lines, it is unlikely that additional MVV-K1514 receptor genes are present in other human chromosomes not tested here, except in those regions of human chromosomes corresponding to OAR-20, -23 and -26.

Most human and simian immunodeficiency virus (HIV and SIV, respectively) strains use a two-component receptor for entry: CD4, as the main receptor, and a coreceptor that varies between strains (Peden & Farber, 2000Down ; Sommerfelt, 1999Down ). All HIV and SIV strains use the chemokine receptors CCR5 and/or CXCR4 as coreceptors. However, many other coreceptors can also be used by different HIV or SIV strains in vitro (Peden & Farber, 2000Down ). A screening of surface molecules as possible receptor candidates for feline immunodeficiency virus (FIV) demonstrated that FIV also uses CXCR4 as a receptor (Willett et al., 1997aDown , bDown ). Shared use of CXCR4 occurs even though little sequence similarity is shared between FIV and HIV envelope surface glycoproteins. This indicates that distantly related lentiviruses can share receptor usage and suggests the possibility that one of the HIV/SIV coreceptors could also function as an MVV receptor. In this regard, a previous report mapped the MVV-EV1 receptor gene to mouse chromosomes (MMU)-2 and/or -4 and, by assuming a one-component receptor, excluded some HIV and SIV coreceptors, such as CXCR2, CXCR4, CCR1, CCR2, CCR4, CCR5, CCR8 and RDC1, as the receptor used by MVV-EV1 to infect mouse cells (Lyall et al., 2000Down ). The MVV-K1514 receptor gene mapped here may represent a one-component receptor, one component of a two-component receptor with the other component expressed by a hamster gene, or two genes in OAR-3p and HSA-2p25>q13, respectively, forming a two-component receptor. Also assuming a one-component receptor for MVV-K1514, our results suggest that MVV-K1514 uses a novel lentivirus receptor for entry in human cells, as none of the known HIV/SIV coreceptors (including CCR1, CCR2B, CCR3, CCR4, CCR5, CCR8, CCR9/D6, CX3CR1, CXCR2, CXCR4, CXCR5, CXCR6/Bonzo, CCBP2, GPR1, GPR15, RDC1, APj, BLTR and CMKLR1/ChemR23) are encoded by genes mapping to the HSA-2p25>q13 region (Peden & Farber, 2000Down ; Sommerfelt, 1999Down ; http://www.ncbi.nlm.nih.gov/LocusLink).

In addition to lentivirus receptors and coreceptors, the only other known retrovirus receptor genes mapping to HSA-2p25>q13 are the baboon endogenous retrovirus auxiliary receptor ASCT1, encoded by the SLC1A4 gene in the 2p15>p13 region, and the gibbon ape leukaemia virus receptor Pit1/Glvr, encoded by the SLC20A1 gene in HSA-2q11>q14 (Marin et al., 2000Down ; Sommerfelt, 1999Down ; http://www.ncbi.nlm.nih.gov/LocusLink). However, the GM12515 cell line susceptible to CAEVneo(K1514) does not retain the human SLC20A1 gene, as determined by PCR using primers specific for the first exon of the human (5' ATGGCAACGCTGATTACCAGTACTACAG 3' and 5' CGGCCATCAGCAGCCCTTGAGTCGA 3') and hamster (5' GTGGCACCGATTACTAATACTCTAGCTA 3' and 5' CCAGCCATGAGCAAGTCTTGAGTTTC 3') genes (data not shown), excluding Pit1 as a possible MVV-K1514 receptor. The possible role of ASCT1 or any other solute carrier encoded by HSA-2 in MVV-K1514 entry remains to be determined.

Three proteins, with apparent molecular masses of 45, 30 and 15 kDa, have been implicated in the binding of MVV-K1514 to susceptible cells (Crane et al., 1991Down ). Although the identity of these proteins is unknown, some of their biochemical properties have been described. The 30 kDa protein is a chondroitin sulfate proteoglycan, whereas the 45 kDa protein has serine/threonine kinase activity (Barber et al., 2000Down ; Bruett et al., 2000Down ). Scanning of the public human genome sequence database (http://genome.ucsc.edu/) for genes encoding surface proteins of known function, matching both apparent molecular mass and biochemical properties of these MVV-K1514 binding proteins, failed to indicate any candidate receptors. Therefore, the relationship between the receptor gene mapped here and these binding proteins remains unknown.

Whether MVV-K1514 and EV1 use the same receptor is not known. In addition, the location of the MVV-EV1 receptor gene in sheep or human chromosomes is not known. However, if these two strains use the same receptor, the number of candidate receptors would be greatly decreased, as not many genes are shared between HSA-2p25>q13 and MMU-2 or MMU-4. It is possible, however, that different receptors are used by MVV-K1514 and EV1. In fact, the hamsterxsheep hybrid cell lines R612-3H9 and R891-29 permissive to MVV-K1514 entry, as well as other hybrid cell lines, were completely resistant (<20 c.f.u./ml) to CAEVneo pseudotyped with the envelope of the North American ruminant-tropic MVV strain 85/34. The failure of CAEVneo(85/34) to infect hamsterxsheep hybrid cell lines could be due to the poor expression of the MVV-85/34 receptor in the hybrid cell lines or the requirement of more than one receptor component for infection by this strain. In addition, an MVV-85/34 receptor could be present in sheep chromosomes 20, 23 or 26, which were not present in any of the available cell lines. In any case, this is consistent with the differential host range of MVV-85/34 and MVV-K1514 (Hötzel & Cheevers, 2001Down ) and with previous results showing that North American MVV strains and MVV-K1514 belong to two distinct interference groups in sheep cells (unpublished data), indicating a differential receptor usage of MVV-85/34 and MVV-K1514. Although the receptor used by MVV-K1514 may be a consequence of the long passage history of this strain and selection for neurovirulence (Andresson et al., 1993Down ), it is possible that other European MVV strains with a wide host cell tropism and more closely related to MVV-K1514 also use the MVV-K1514 receptor. Mapping of the MVV-K1514 receptor gene in sheep and human chromosomes should aid in the identification of MVV strains that use the MVV-K1514 receptor and the identity of this receptor.


   Acknowledgments
 
We thank Dr James DeMartini (Colorado State University, Fort Collins, CO, USA) and the Eleanor Roosevelt Research Institute (Denver, CO, USA) for the hamsterxsheep somatic cell hybrid panel. We also thank Kathy Pretty On Top for technical assistance. This work was supported by NIH grants RO1 AR 43718 and R21 AI 42690.


   References
TOP
Abstract
Main text
References
 
Andresson, O. S., Elser, J. E., Tobin, G. J., Greenwood, J. D., Gonda, M. A., Georgsson, G., Andrésdóttir, V., Benediktsdóttir, E., Carlsdóttir, H. M., Mäntylä, E. O., Rafnar, B., Pálsson, P. A., Casey, J. W. & Pétursson, G. (1993). Nucleotide sequence and biological properties of a pathogenic proviral molecular clone of neurovirulent visna virus. Virology 193, 89-105.[Medline]

Band, M. R., Larson, J. H., Rebeiz, M., Green, C. A., Heyen, D. W., Donovan, J., Windish, R., Steining, C., Mahyuddin, P., Womack, J. E. & Lewin, H. A. (2000). An ordered comparative map of the cattle and human genomes. Genome Research 10, 1359-1368.[Abstract/Free Full Text]

Barber, S. A., Bruett, L. & Clements, J. E. (2000). Involvement of a membrane-associated serine/threonine kinase complex in cellular binding of visna virus. Virology 274, 321-330.[Medline]

Broad, T. E., Burkin, D. J., Jones, C., Lewis, P. E., Ansari, H. A. & Pearce, P. D. (1993). Mapping of MYF5, C1R, MYHL, TPI1, IAPP, A2MR and RNR onto sheep chromosome 3q. Animal Genetics 24, 415-419.[Medline]

Broad, T. E., Burkin, D. J., Cambridge, L. M., Jones, C., Lewis, P. E., Morse, H. G., Geyer, D., Pearce, P. D., Ansari, H. A. & Maher, D. W. (1995). Six loci mapped on to human chromosome 2p are assigned to sheep chromosome 3p. Animal Genetics 26, 85-90.[Medline]

Brodie, S. J., Pearson, L. D., Zink, M. C., Bickle, H. M., Anderson, B. C., Marcom, K. A. & DeMartini, J. C. (1995). Ovine lentivirus expression and disease. Virus replication, but not entry, is restricted to macrophages of specific tissues. American Journal of Pathology 146, 250-263.[Abstract]

Bruett, L. & Clements, J. E. (2001). Functional murine leukemia virus vectors pseudotyped with the visna envelope show expanded visna virus cell tropism. Journal of Virology 75, 11464-11473.[Abstract/Free Full Text]

Bruett, L., Barber, S. A. & Clements, J. E. (2000). Characterization of a membrane-associated protein implicated in visna virus binding and infection. Virology 271, 132-141.[Medline]

Burkin, D. J., Broad, T. E., Lambeth, M. R., Burkin, H. R. & Jones, C. (1998). New gene assignments using a complete, characterized sheep–hamster somatic cell hybrid panel. Animal Genetics 29, 48-54.[Medline]

Crane, S. E., Buzy, J. & Clements, J. E. (1991). Identification of cell membrane proteins that bind visna virus. Journal of Virology 65, 6137-6143.[Abstract/Free Full Text]

Gendelman, H. E., Narayan, O., Molineaux, S., Clements, J. E. & Ghotbi, Z. (1985). Slow, persistent replication of lentiviruses: role of tissue macrophages precursors in bone marrow. Proceedings of the National Academy of Sciences, USA 82, 7086-7090.[Abstract/Free Full Text]

Gendelman, H. E., Narayan, O., Kennedy-Stoskopf, S., Kennedy, P. G. E., Ghotbi, Z., Clements, J. E., Stanley, J. & Pezeshkpour, G. (1986). Tropism of sheep lentiviruses for monocytes: susceptibility to infection and virus gene expression increase during maturation of monocytes to macrophages. Journal of Virology 58, 67-74.[Abstract/Free Full Text]

Georgsson, G., Houwers, D. J., Pálsson, P. A. & Pétursson, G. (1989). Expression of viral antigens in the central nervous system of visna-infected sheep: an immunohistochemical study on experimental visna induced by virus strains of increased neurovirulence. Acta Neuropathologica 77, 299-306.[Medline]

Gorrell, M. D., Brandon, M. R., Sheffer, D., Adams, R. J. & Narayan, O. (1992). Ovine lentivirus is macrophagetropic and does not replicate productively in T lymphocytes. Journal of Virology 66, 2679-2688.[Abstract/Free Full Text]

Hötzel, I. & Cheevers, W. P. (2001). Host range of small-ruminant lentivirus cytopathic variants determined with a selectable caprine arthritis–encephalitis virus pseudotype system. Journal of Virology 75, 7384-7391.[Abstract/Free Full Text]

Lopez-Corrales, N. L., Sonstegard, T. S. & Smith, T. P. (1998). Comparative gene mapping: cytogenetic localization of PROC, EN1, ALPI, TNP1, and IL1B in cattle and sheep reveals a conserved rearrangement relative to the human genome. Cytogenetics and Cell Genetics 83, 35-38.[Medline]

Lopez-Corrales, N. L., Sonstegard, T. S. & Smith, T. P. (1999). Physical mapping of the bovine, caprine and ovine homologues of the paired box gene PAX8. Cytogenetics and Cell Genetics 84, 179-181.[Medline]

Lyall, J. W., Solansky, N. & Tiley, L. S. (2000). Restricted species tropism of maedi–visna virus strain EV-1 is not due to limited receptor distribution. Journal of General Virology 81, 2919-2927.[Abstract/Free Full Text]

MacIntyre, E. H., Wintersgill, C. J. & Thormar, H. (1972). Morphological transformation of human astrocytes by visna virus with complete virus production. Nature New Biology 237, 111-113.[Medline]

Marin, M., Tailor, C. S., Nouri, A. & Kabat, D. (2000). Sodium-dependent neutral amino acid transporter type 1 is an auxiliary receptor for baboon endogenous retrovirus. Journal of Virology 74, 8085-8093.[Abstract/Free Full Text]

Narayan, O., Zink, M., Gorrell, M., Crane, S., Huso, D., Jolly, P., Saltarelli, M., Adams, R. & Clements, J. (1993). The lentiviruses of sheep and goats. In The Retroviridae , pp. 229-256. Edited by J. A. Levy. New York:Plenum.

Peden, K. W. C. & Farber, J. M. (2000). Coreceptors for human immunodeficiency virus and simian immunodeficiency virus. Advances in Pharmacology 48, 409-478.[Medline]

Ryan, S., Tiley, L., McConnell, I. & Blacklaws, B. (2000). Infection of dendritic cells by the maedi–visna lentivirus. Journal of Virology 74, 10096-10103.[Abstract/Free Full Text]

Sommerfelt, M. A. (1999). Retrovirus receptors. Journal of General Virology 80, 3049-3064.[Free Full Text]

Willett, B. J., Hosie, M. J., Neil, J. C., Turner, J. D. & Hoxie, J. A. (1997a). Common mechanism of infection by lentiviruses. Nature 385, 587.[Medline]

Willett, B. J., Picard, L., Hosie, M. J., Turner, J. D., Adema, K. & Clapham, P. R. (1997b). Shared usage of the chemokine receptor CXCR4 by the feline and human immunodeficiency viruses. Journal of Virology 71, 6407-6415.[Abstract]

Received 4 January 2002; accepted 18 March 2002.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hötzel, I.
Right arrow Articles by Cheevers, W. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hötzel, I.
Right arrow Articles by Cheevers, W. P.
Agricola
Right arrow Articles by Hötzel, I.
Right arrow Articles by Cheevers, W. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS