J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Agricola
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Journal of General Virology (2002), 83, 1875-1885.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Complete genome sequence of Montana Myotis leukoencephalitis virus, phylogenetic analysis and comparative study of the 3' untranslated region of flaviviruses with no known vector

Nathalie Charlier1, Pieter Leyssen1, Cornelis W. A. Pleij3, Philippe Lemey2, Frédérique Billoir4, Kristel Van Laethem2, Anne-Mieke Vandamme2, Erik De Clercq1, Xavier de Lamballerie4 and Johan Neyts1

Laboratory of Virology and Chemotherapy1 and Laboratory of Clinical and Epidemiological Virology2, Rega Institute for Medical Research, Minderbroedersstraat 10, B-3000 Leuven, Belgium
Leiden Institute of Chemistry, Leiden University, PO Box 9502, 2300 RA Leiden, The Netherlands3
Unité des Virus Emergents, Faculté de Médecine de Marseille, 27 Boulevard Jean Moulin, 13005 Marseille cedex 5, France4

Author for correspondence: Johan Neyts. Fax +32 16 33 73 40. e-mail johan.neyts{at}rega.kuleuven.ac.be


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Montana Myotis leukoencephalitis virus (MMLV), a virus isolated from bats, causes an encephalitis in small rodents reminiscent of flavivirus encephalitis in humans. The complete MMLV genome is 10690 nucleotides long and encodes a putative polyprotein of 3374 amino acids. The virus contains the same conserved motifs in genes that are believed to be interesting antiviral targets (NTPase/helicase, serine protease and RNA-dependent RNA polymerase) as flaviviruses of clinical importance. Phylogenetic analysis of the entire coding region has confirmed the classification of MMLV in the clade of the flaviviruses with no known vector (NKV) and within this clade to the Rio Bravo branch (both viruses have the bat as their vertebrate host). We have provided for the first time a comparative analysis of the RNA folding of the 3' UTR of the NKV flaviviruses (Modoc, Rio Bravo and Apoi viruses, in addition to MMLV). Structural elements in the 3' UTR that are preserved among other flaviviruses have been revealed, as well as elements that distinguish the NKV from the mosquito- and tick-borne flaviviruses. In particular, the pentanucleotide sequence 5' CACAG 3', which is conserved in all mosquito- and tick-borne flaviviruses, is replaced by the sequence 5' C(C/U)(C/U)AG 3' in the loop of the 3' long stable hairpin structure of all four NKV flaviviruses. The availability of this latter sequence motif allows us to designate a virus as either an NKV or a vector-borne flavivirus.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The Flavivirus genus (family Flaviviridae) consists of nearly 80 viruses, which can be grouped into vector-borne (mosquito-and tick-borne) flaviviruses and flaviviruses with no known arthropod vector (NKV) (Chambers et al., 1990Down ; Monath & Heinz, 1996Down ). Several flaviviruses cause severe encephalitis in humans. These include Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV), West Nile virus (WNV) and others (Han et al., 1999Down ; Heinz & Mandl, 1993Down ). In recent years, the genomic sequences of an increasing number of flaviviruses have been determined. Almost all of the sequence data available, however, are from mosquito-borne and tick-borne flaviviruses. Recently, the sequences of the NKV flaviviruses Apoi virus (APOIV), Rio Bravo virus (RBV) and Modoc virus (MODV) have been reported (Billoir et al., 2000Down ; Leyssen et al., 2002Down ). Montana Myotis leukoencephalitis virus (MMLV) was first isolated in 1958 from a mouse bitten by a naturally infected little brown bat (Myotis lucifugus) captured in western Montana. The virus was subsequently isolated from saliva, brain and various other tissues from other bats of the same species. The biological and serological properties of the virus suggested that it belonged to the flaviviruses (Bell & Thomas, 1964Down ). Based on both antigenic and molecular relationships (Kuno et al., 1998Down ), it is currently classified in the Rio Bravo virus group within the genus Flavivirus (Heinz et al., 2000Down ). We have used this virus to establish a small animal model of flavivirus encephalitis (accompanying paper: Charlier et al., 2002Down ).

We present here: (i) the complete genome sequence (coding and non-coding regions) of MMLV; (ii) the particular characteristics (including the phylogeny) of this genome; and (iii) a detailed and comparative study of the organization and the secondary structure of the 3' UTRs of MMLV and three other NKV flaviviruses (RBV, MODV and APOIV). Furthermore, we report that the pentanucleotide sequence CACAG, which is conserved in the 3' UTR of all arboflaviviruses, is replaced by the sequence C(C/U)(C/U)AG in NKV flaviviruses.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus.
The original MMLV strain (Montana, 1958) was obtained from the ATCC (ATCC VR-537) and grown in Vero cells.

{blacksquare} Generation of PCR fragments.
Viral RNA was extracted from 140 µl of supernatant medium of virus-infected cells, using the QIAamp Viral RNA kit (Qiagen). A reverse transcription (RT) reaction was designed employing the reverse primer 5' GGGTCTCCTCTAACCTCTAG 3'. Three sets of degenerated primers were designed based on the alignment of full-length genome sequences of different flaviviruses (Table 1Down). Other primers were designed based on: (i) the sequence of the amplicons generated by the first primer sets (a list of the primers is available upon request); and (ii) the sequence of a fragment of MMLV of approximately 1 kb (nt 8929–9939; Kuno et al., 1998Down ) (Fig. 1Down). All PCR amplifications were achieved under standard conditions using Taq polymerase (HT Biotechnology) and 30 cycles including long polymerization steps (1–2 min depending on the expected size of the amplicons).


View this table:
[in this window]
[in a new window]
 
Table 1. Flaviviruses included in the phylogenetic analysis

 


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1. Strategy employed for the sequencing of the MMLV genome. The locations of PCR fragments (dotted lines), specific primers (solid arrows) and random primers (open arrows) are indicated, along with the genomic organization of the virus.

 
{blacksquare} Amplification of genomic termini.
The genomic 5' and 3' ends of MMLV RNA were determined by RACE (rapid amplification of cDNA ends). Amplification of the 3' UTR was achieved by the following method. An RNA oligonucleotide (5' AAGGAAAAAAGCGGCCGCAAAAGGAAAA 3') was ligated to the 3' end in a reaction mixture containing 50 µl total RNA (10 µg), 15 µl 10x T4 RNA ligase buffer (Roche Molecular Biochemicals), 150 U T4 RNA ligase (Roche Molecular Biochemicals), 6 µl RNA oligonucleotide (2 µg), 142·5 U human placenta RNase inhibitor (HPRI; Amersham) and 62·5 µl RNase-free water. Fifty µl of the reaction product was denaturated at 65 °C for 10 min (to remove secondary structures) in the presence of 150 pmol of reverse primer (5' TTTTCCTTTTGCGGCCGCTTTTTTCCTT 3') and 14 µl RNase-free water, and chilled on ice. For the RT reaction, the following were then added: 20 µl 5x RT buffer (Amersham), 1 mM each of dATP, dTTP, dGTP and dCTP, 95 U HPRI and 40 U RAV-2 reverse transcriptase (Amersham). The mixture was incubated at 45 °C for 1·5 h and immediately chilled on ice. The resulting cDNA was used in a 50 µl PCR reaction with 60 pmol reverse primer (5' TTTTCCTTTTGCGGCCGCTTTTTTCCTT 3') and 60 pmol forward primer (5' CAGCAGTTCCAGCCAACTGGGTT 3'). The 5' RACE was performed with the GeneRacer kit (Invitrogen).

{blacksquare} Cloning and sequence analysis.
PCR products were cloned into the TOPO Cloning vector (Invitrogen) or the pGEM-T Vector System I (Promega) and One Shot competent E. coli cells (Invitrogen) were used for transformation. The cloned inserts were sequenced in a cycle sequencing reaction with fluorescent dye terminators and analysed using an ABI 373 automatic sequencer (Perkin–Elmer).

{blacksquare} Prediction of RNA secondary structure.
The RNA secondary structure of the 3' UTRs of MMLV and of the three other NKV flaviviruses (MODV, RBV and APOIV) was analysed using the STAR program (Gultyaev et al., 1995Down ). After folding each of the four sequences separately, the resulting structures were searched for common structural elements as shown by the occurrence of covariations in the stem regions in one or more of the other three sequences. These sequences, containing proven structures, were excised and replaced by five non-pairing nucleotides. The shortened sequences were then submitted to a new cycle of folding and this was repeated until no further common elements were detected.

{blacksquare} Alignments and phylogenetic analysis.
The complete amino acid sequences of the flaviviruses listed above were aligned using the ClustalW (1.74) software (Monath & Lipman, 1988Down ) and default alignment parameters, and manually edited in McClade (Maddison & Maddison, 1989Down ). Conserved motifs allowed an unambiguous control of validity for alignment as previously reported (Billoir et al., 2000Down ).

Genetic distances were estimated using maximum-likelihood calculation in TreePuzzle-5.0 (Strimmer & Von Haeseler, 1996Down ) based on the Blosum62 (Henikoff & Henikoff, 1992Down ) model of substitution and taking into account a rate heterogeneity among sites with a discrete gamma distribution of eight categories. An unrooted phylogenetic tree based on the inferred distance matrix was constructed with NEIGHBOR in PHYLIP 3.5. Bootstrap analysis was performed according to the following algorithm: 1000 replicates were generated by SEQBOOT (PHYLIP) and redirected with Puzzleboot to TreePuzzle 5.0 where distance matrices were estimated. These distance matrices were subsequently used to infer phylogenetic trees in NEIGHBOR (PHYLIP) and a bootstrap consensus tree was generated with CONSENSE (PHYLIP).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Genome and amino acid sequence
The entire genome of MMLV (EMBL accession no. AJ299445) is 10690 nucleotides long and encodes one long ORF extending from the AUG start codon at nt 109 to the first in-frame stop codon at position 10231, thereby encoding a 3374 amino acid long polyprotein (10122 nucleotides). The ORF is flanked by 5' and 3' UTRs that are, respectively, 108 and 457 nucleotides long.

Comparison of the amino acid sequence of MMLV with that of other flaviviruses revealed the presence of homologous protease cleavage sites (Table 2Down), internal signal sequences and transmembrane sequences (the C-terminal domains of the C, M, E and NS4A proteins are hydrophobic). As is the case for APOIV and RBV, the mature MMLV virion C protein, envelope and NS4A genes are markedly shorter than the corresponding genes of arthropod-borne flaviviruses (Table 3Down).


View this table:
[in this window]
[in a new window]
 
Table 2. Predicted protease cleavage sites in MMLV as compared with another NKV virus (RBV), a mosquito-borne virus (YFV) and a tick-borne virus (TBEV)

 

View this table:
[in this window]
[in a new window]
 
Table 3. Putative processing of viral polyproteins of MMLV as compared with another NKV virus (RBV), a mosquito-borne virus (YFV) and a tick-borne virus (TBEV)

 
We identified sequence motifs in the MMLV virus NS3 sequence that are known to be associated with RNA helicase activity (1748-DEAH-1751) and nucleoside triphosphate (NTP)-binding activity (1661-GSGKT-1665) (Pletnev et al., 1990Down ). The locations of these motifs proved to be perfectly conserved among the flaviviruses and identical to the motifs found in APOIV and RBV. The NS3 proteins of flaviviruses also possess the active components of a serine protease (Chambers et al., 1990Down ). The location of such sequences is also conserved in the NS3 protein of MMLV (1506-EGSFHTMWHVTRG-1518, 1532-WANITEDLISYNGG-1545, 1590-PLDFPPGTSGSPIITSSG-1609).

The flavivirus NS5 protein (the largest of the flavivirus-encoded proteins) encodes an RNA-dependent RNA polymerase and also contains a putative methyltransferase domain (Koonin, 1993Down ). A heptapeptide sequence, containing the characteristic GDD sequence motif (Kamer & Argos, 1984Down ; Poch et al., 1989Down ), is also conserved in the MMLV NS5 gene (3136-SGDDCVV-3142). The same heptapeptide motif is also present in APOIV and RBV.

Predicted cleavage sites in the MMLV polyprotein
The N-termini of the proteins were defined, based on the position of the cleavage sites of other flaviviruses. Cleavage by the viral protease generally occurs following two dibasic residues and before an amino acid with a short side chain, whereas processing with a host protease occurs at sites obeying the (-3,-1) rule (Von Heijne, 1984Down ). Table 2Up summarizes the cleavage sites for the processing of the MMLV polyprotein. At the N-termini of prM, E and NS1 of MMLV, predicted signalase cleavage sites are detected, which are also contributed by the C-terminal hydrophobic regions of anchored C, prM and E, respectively. A signal sequence also precedes the N-terminus of NS4B, suggesting that this hydrophobic protein is processed in association with endoplasmic membranes. The N-terminus of NS2A follows a cleavage site defined by the sequence Val–X–Ala (where X is Ser, Thr, Gln, Asn or Asp) (Cammisa-Parks et al., 1992Down ; Von Heijne, 1984Down ). In the case of MMLV, the sequence consists of Val–Ser–Ala.

Five of the flavivirus polyprotein cleavages take place after two basic amino acids (either Lys–Arg or Arg–Arg or Arg–Lys) (Chambers et al., 1990Down ): i.e. anchored C–virion C, NS2A–NS2B, NS2B–NS3, NS3–NS4A and NS4B–NS5. In the case of MMLV, an Arg–Arg sequence is present at the C-termini of NS2B, NS3 and NS4B. For the other two cleavages (anchored C–virion C and NS2A–NS2B), suitable dibasic sequences could not be identified. For anchored C–virion C, we suggest a cleavage site following a Gln–Arg pair. For NS2A–NS2B cleavage may take place immediately after Gln–Pro (Gln is also present in the DEN2 and DEN4 NS2A–NS2B cleavage site) (Mandl et al., 1998Down ). These sites were chosen based on the sequence alignment with the polyproteins of other flaviviruses (Table 1Up) and on the notion that the dibasic sequences are usually flanked by amino acids with short side-chains, most commonly Gly, Ser or Ala. The prM protein is a glycoprotein precursor, which undergoes delayed cleavage to form M and the N-terminal ‘pr’ segment. Akin to all flavivirus sequences, the N-terminus of the M protein of MMLV immediately follows a pair of basic amino acids believed to represent a cleavage site for either a viral or a host protease. The two amino acids are flanked by an amino acid with a short side-chain (Chambers et al., 1990Down ).

Characteristics of the 5'- and 3'-terminal nucleotide sequences
The ORF of the flavivirus genome is flanked by short non-coding regions, which may contain elements involved in the regulation of essential functions such as translation, replication or encapsidation of the genome (Cammisa-Parks et al., 1992Down ). The 5' UTR of MMLV is 108 nucleotides long. The MMLV 3' UTR contains 460 nucleotides. As in other flaviviruses, the 3' UTR is not extended by a poly(A) tract. At each end of the genome, two terminal nucleotides, which are conserved among members of the whole Flavivirus genus, were detected, i.e. 5' AG and CU 3'. Besides these conserved terminal nucleotides, there is only one nucleotide sequence motif conserved among the mosquito- and tick-borne flaviviruses described. This conserved motif is a pentanucleotide sequence (5' CACAG 3') located approximately 45–61 nucleotides from the 3' terminus (Wengler & Castle, 1986Down ). It is predicted that it is located on a side-loop of a conserved 3'-terminal secondary structure, suggesting that this motif would induce the formation of a circular RNA molecule, which could be important during replication or encapsidation (Chambers et al., 1990Down ; Khromykh et al., 2001Down ). From all 21 vector-borne flaviviruses (Table 4Down) that were analysed, only Murray Valley encephalitis virus (MVEV) had a different pentanucleotide sequence, i.e. an A->C change at position 4 (CACCG). We confirmed the presence of this deviating pentanucleotide sequence in the MVEV genome by sequencing this particular area of the genome of this virus. An A->C change was also noted at position 4 of this pentanucleotide sequence in the genome of cell fusing agent virus. The second position of this pentanucleotide (at an analogous position, i.e. within the loop of a 3'-terminal stem and loop structure) was either a U or a C instead of an A for all four NKV flaviviruses. APOIV had, in addition, a C->U change at position 3. This pentanucleotide motif thus allows us to discriminate between NKV and vector-borne flaviviruses.


View this table:
[in this window]
[in a new window]
 
Table 4. The conserved pentanucleotide sequence (5' CACAG 3') in the last 61 nucleotides of the 3' UTR of mosquito- and tick-borne flaviviruses is a C(C/U)(C/U)AG sequence for NKV flaviviruses

 
Comparative study of the folding of the 3'-terminal sequences of four NKV flaviviruses
Strong support was found for the presence of four different RNA regions (designated I, II, III and IV) in the 3' UTR of MMLV, MODV and RBV, but not in the 3' UTR of APOIV (Fig. 2Down). The latter is assumed not to have a region I equivalent.




View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. Proposed secondary structure of the 3' UTR of four NKV flaviviruses. The four regions (labelled I to IV) are delineated by boxes. Conserved motifs are shown in bold and boxed. For MMLV and RBV, the predicted pseudoknot is shown by connecting boxes. For MMLV and MODV, possible stem–loops are connected by dotted/dashed lines.

 
Region I of MMLV, RBV and MODV consists of a long hairpin with a branching stem–loop structure. At the 3' end of region I of MMLV, RBV and MODV, a conserved motif of 22 nucleotides [5' UUGUAAAUA(C/A)UU(U/G)(G/A)GCCAGUCA 3'] (labelled in bold in Fig. 2UpDown) was observed. MMLV and RBV contain exactly the same sequence, whereas MODV has A->C, G->U and A->G changes at positions 10, 13 and 14 of this sequence, respectively. This motif is not present in APOIV, which lacks region I.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. Phylogenetic tree based on the complete coding region of 20 flaviviruses by the neighbour-joining method. Bootstrap statistical analysis was applied with 1000 bootstrap samples (only bootstrap values below 100% are marked). The main vectors or hosts from which viruses were isolated are indicated.

 
The region between the stop codon and region I of the 3' UTRs of NKV flaviviruses is variable in length and is most probably single-stranded.

Region II of the 3' UTR is predicted to form a Y-shaped structure. The 3' arm of the Y structure contains the CS2 sequence [5' G(A/U)CUAGAGGUUAGAGGAGACCC 3'], which was present in all four of the NKV viruses studied. The 5' hairpin on the main stem of region II varies considerably in length for the four NKV viruses, in contrast with other flaviviruses. Upstream from region II, a repeated structure (IIbis) is formed in the 3' UTR of APOIV, which contains the repeated conserved sequence 2 (RCS2) [5' GACUAG(A/C)GGUUAGAGGAGACCC 3']. Except for the CS2 sequence, the primary structure of region IIbis is not identical to the sequence of region II; however, the secondary structure is well conserved.

Three very similar hairpins (a, b and c) are predicted between regions I and II for MMLV and RBV, the two NKV flaviviruses that are also, according to the phylogenetic analysis (see below), most related. These consist of a stem–loop (b), flanked by two shorter stem–loops (a and c); loop b may form a pseudoknot at the 5' side. The existence of this pseudoknot is not only supported by its prediction with the STAR program but also by the presence of one covariation in each of the two stems of the pseudoknot.

Region III folds into a Y shape for all four NKV viruses studied. The two loops of the Y structure of region III of the 3' UTRs are formed by a conserved stretch of nucleotides. However, the sequences of the stems carrying these loops are not conserved, but rather show a large number of compensatory base changes, strongly supporting the proposed secondary structure.

In region IV, the 3'-terminal nucleotides of the 3' UTR of the NKV flaviviruses form a long stable hairpin structure (3' LSH), which preserves its shape despite significant differences in sequence. This 3' LSH was calculated to fold in the genome of the four NKV flaviviruses with a similar position of the conserved C(C/U)(C/U)AG motif (45–61 nucleotides from the 3' terminus). At the 5' side of the 3' LSH, a small stem–loop (belonging to region IV and probably coaxially stacking with the long 3'-terminal hairpin) is calculated for the four NKV flaviviruses.

Inspection of the 3' UTRs revealed the existence of a 69–79 nucleotide long sequence motif (e.g. 5' GCUUUUGCUCCCGC G U U U U U C AA A U U G C C U C A U C U U G A A U G G - G G GGCGGCGUGGAUAUAUACUCCAGCC 3' for MMLV) located approximately 50 nucleotides away from the 3' terminus and representing an inverted repeat of another conserved sequence element located approximately 54 nucleotides from the 5' terminus (including the last 40 nucleotides of the 5' UTR and the first 29 nucleotides of the coding region). This may suggest a role in genome circularization. A similar but much smaller cyclization sequence has been observed for the tick-borne flaviviruses (Khromykh et al., 2001Down ). The predicted folding of the four regions in the 3' UTR as reported here is supported by the fact that a large number of covariant and semi-covariant sites occur in base-paired regions.

Phylogenetic analysis
A phylogenetic analysis was performed using complete coding sequences (Fig. 3Up). Compared with the other flaviviruses, CFAV showed a similarity below 30% and was therefore unreliable as an outgroup for phylogenetic analysis of the complete genome of the flaviviruses. An unrooted phylogenetic tree including the complete ORF sequences of 19 flaviviruses, and constructed with the neighbour-joining method, was supported by high bootstrap values (ranging from 99·2 to 100%). Three major branches were observed: (i) the mosquito-borne virus branch; (ii) the tick-borne virus branch; and (iii) the NKV virus branch. This confirms the presence of MMLV in the group of the NKV viruses, as predicted by Kuno et al. (1998)Down using a 1 kb fragment in NS5. The bootstrap value of 100% allows us to conclude that MMLV belongs to the RBV branch, which is consistent with the fact that both viruses have the bat as their vertebrate host.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We have determined the complete sequence of MMLV, a flavivirus with no known vector. The analysis of specific amino acid or nucleotide patterns and the phylogenetic reconstructions based on the entire flavivirus polyprotein confirmed the taxonomic assignment of MMLV to the flaviviruses with no known vector, as previously suggested by the analysis of a 1 kb fragment of the NS5 gene (Kuno et al., 1998Down ).

Moreover, the maximum bootstrap value allowed us to conclude that MMLV belongs to the RBV branch, which is consistent with the fact that both viruses have the bat as their vertebrate host. APOIV and MODV (both isolated from rodents) are located in two distinct evolutionary branches, MODV being more closely related to MMLV and RBV than to APOIV.

The deduced amino acid sequence of MMLV revealed conservation of the main features of flaviviruses, i.e. cleavage and glycosylation sites of virus-specific proteins, and the presence of highly conserved motifs important for protease, helicase, methyltransferase and RNA-dependent RNA polymerase activity (Monath & Heinz, 1996Down ). The fact that the genome of MMLV has the same organization as flaviviruses that are infectious to humans, as well as the same conserved regions in genes that can be considered as antiviral targets, further points to the relevance of this model in antiviral studies. Indeed, using MMLV we have established a convenient infection model for flavivirus encephalitis in SCID mice. This model may be particularly attractive for the in vivo evaluation of agents with anti-flavivirus activity (accompanying paper: Charlier et al., 2002Down ).

We have studied the particular characteristics of the 3' UTR of NKV flaviviruses and therefore also included the 3' UTR secondary structures of MODV, RBV and APOIV in our analysis. The 3' UTR structures of flaviviruses have previously been suggested to be organized into two distinct regions: (i) the 3'-terminal core element (approximately 330–400 nucleotides in length for mosquito- and tick-borne flaviviruses), which is, within the different serogroups, highly conserved in its primary sequence and RNA folding pattern (Wallner et al., 1995Down ; Proutski et al., 1999Down ); and (ii) the variable region, which is inserted between the core element and the coding region of the genome. This distinction corresponds with functional differences between these two regions (Proutski et al., 1999Down ). It was suggested that the variable region could possibly act as a spacer separating the folded 3' UTR structure from the rest of the genome (Blackwell & Brinton, 1995Down ). Mandl et al. (1998)Down showed that deletion mutants of TBEV, which lack the entire variable region, replicate as efficiently as wild-type virus in cell culture and mice. Akin to the situation in mosquito- and tick-borne flaviviruses, the NKV flaviviruses also contain a variable region in their 3' UTR, and this region also varies substantially in length. Most of this variability is probably due to deletions or duplications in the region immediately following the NS5 stop codon, as suggested for the mosquito-borne flaviviruses (Shurtleff et al., 2001Down ). The core element, with its stems and loops, would constitute specific binding sites recognized by the virus-encoded replicase, cellular proteins or viral capsid proteins, and would play an important role in virus-specific transcription, translation and encapsidation (Mandl et al., 1998Down ; Gritsun et al., 1997Down ; Proutski et al., 1997bDown ; Blackwell & Brinton, 1995Down , 1997Down ; Chen et al., 1997Down ). Using deletion mutants of DEN4, Proutski et al. (1999)Down proposed two parts within the core element: (i) the most 3'-terminal structures/sequences that would act as a viral promoter critical for the initiation of minus-strand RNA synthesis; and (ii) more 5' proximal structures/sequences that may function as enhancers of viral RNA replication. MODV has the shortest 3' UTR (366 nucleotides) of the NKV flaviviruses discussed here and of all flaviviruses sequenced so far. The folding pattern of this virus contains possibly the (almost) basic 3' UTR pattern that is necessary for replication of an NKV flavivirus.

The phylogenetic tree based on the UTRs of NKV flaviviruses showed similar topology to those constructed from the coding regions (data not shown), indicating that the genetic information in these regions reflects the evolutionary history of MMLV and the other NKV flaviviruses. Analysis of the folding of the 3' UTR points to the relatedness of MMLV, MODV and RBV through a common folding pattern. Folding of the 3' UTR of these three viruses revealed four conformationally conserved structural elements (regions I–IV) that are supported by compensatory mutations, which is suggestive for their functional importance. Six of the eight loops expose conserved sequence motifs. Furthermore, at the 3' end of region I, a conserved motif of 22 nucleotides [5' UUGUAAAUA(C/A)UU(U/G)(G/A)GCCAGUCA 3'] was observed. This motif has not been described for the mosquito- or the tick-borne flaviviruses and may be a particular characteristic of New World NKV flaviviruses (MMLV, MODV, RBV). APOIV, which can be considered an NKV flavivirus of the Old World, lacks region I and thus this motif. Phylogenetically, APOIV is the most distantly positioned flavivirus within the NKV flavivirus cluster. The particular characteristics of the secondary structure of the 3' UTR of APOIV (absence of region I and presence of a duplicated region II) corroborates this observation. Interestingly, MMLV and RBV, which both have the bat as their natural host, share a common pseudoknot structure (located between regions I and II). Moreover, the sequence of region I in the 3' UTR of MMLV and RBV is very similar, whereas the stems contain compensatory mutations.

Several characteristics of the 3' UTRs of the NKV flaviviruses are comparable with those of either mosquito-borne or tick-borne flaviviruses or both. A characteristic feature similar for mosquito-borne (with the exception of YFV), but not tick-borne, flaviviruses is the presence of duplicated conserved RNA sequences (called CS2 and RCS2) (Chambers et al., 1990Down ; Proutski et al., 1997bDown ). It was assumed that they play an important role in initiating viral transcription as cis-acting signals, either by virtue of their exact nucleotide sequence (Hahn et al., 1987Down ; Mangada & Igarashi, 1997Down ) or through the interaction of secondary RNA structures with cellular proteins (Blackwell & Brinton, 1995Down ). The CS2 sequence is present in region II of the 3' UTR folding pattern of NKV flaviviruses and is located in a loop, as in the mosquito-borne flaviviruses,. According to Proutski et al. (1999)Down , a single copy of either CS2 may be sufficient for normal virus replication of DENV4. However, deletion of both stem–loop structures containing CS2 and RCS2 sequences led to an inability of the mutants to replicate in mammalian cells. As is the case for the mosquito-borne flaviviruses, APOIV contains both CS2 and RCS2, whereas MMLV, MODV and RBV carry only one such sequence. This would be in line with the observation of Proutski et al. (1999)Down that only one CS2 sequence is required for the efficient replication of mosquito-borne flaviviruses. The mosquito-borne and NKV flaviviruses thus share a common factor that may possibly be important for replication in mammalian cells.

The 3' UTR of NKV flaviviruses share also particular characteristics with tick-borne flaviviruses. Like the tick-borne viruses, NKV flaviviruses lack the small stem–loop located in region I of the 3' UTR of mosquito-borne flaviviruses (Proutski et al., 1997bDown , 1999Down ). Deletion of this structure led to a reduced efficiency of replication of DENV4 in mosquito cells. It was suggested that this structure may function as an enhancer of virus replication in mosquito cells. The fact that NKV flaviviruses probably do not (or inefficiently) replicate in mosquito cells may reinforce this hypothesis.

Region III of the NKV flaviviruses folds into a structure similar to the one predicted in the 3' UTR of tick-borne flaviviruses [where it is part of a larger structure with three different branches of hairpins (Mandl et al., 1998Down ; Proutski et al., 1997bDown )], but that is not present in the 3' UTR of mosquito-borne flaviviruses (Hahn et al., 1987Down ; Shurtleff et al., 2001Down ). As for the tick-borne flaviviruses, the two loops of the Y structure of region III of the NKV 3' UTRs are formed by a conserved stretch of nucleotides. These can be detected at analogous positions (5' AUUGGC 3' and 5' (G/U)(G/U)UU 3') (Gritsun et al., 1997Down ; Mandl et al., 1993Down ; Proutski et al., 1997aDown , bDown ).

The very 3' terminus of the 3' UTR (region IV) folds in a manner typical for all flaviviruses, forming the 3' LSH structure and a small stem–loop (belonging to region IV and probably coaxially stacking with the long 3'-terminal hairpin). The pseudoknot, which is predicted between the small stem–loop and the 3' LSH of mosquito-borne but not tick-borne flaviviruses, is probably not formed in the 3' UTR of the NKV flaviviruses. The fact that the 3' LSH is detected in mosquito-, tick-borne (Grange et al., 1985Down ; Brinton et al., 1986Down ; Hahn et al., 1987Down ; Mohan & Padmanabhan, 1991Down ; Mandl et al., 1993Down ; Wallner et al., 1995Down ; Shi et al., 1996Down ; Proutski et al., 1997aDown , bDown ) and NKV flaviviruses strongly suggests that it plays a crucial role in the replication of all flaviviruses. In particular, the presence of the highly conserved pentanucleotide 5' CACAG 3' in the top loop has been suggested to play an important role in virus replication (Khromykh et al., 2001Down ). Analysis of the 3' UTRs of the NKV flaviviruses revealed a pentanucleotide sequence motif [5' C(C/U)(C/U)AG 3'] at an analogous position. However, this pentanucleotide sequence is, at positions 2 and 3, different from the 5' CACAG 3' motif of mosquito- and tick-borne flaviviruses and appears to be unique to NKV flaviviruses. Indeed, whereas the conserved CACAG motif was detected in all flaviviruses analysed so far [with the exception of MVEV (and CFAV), which carries an A/C change at position 4], all four NKV flaviviruses analysed carry a C(C/U)(C/U)AG pentanucleotide motif. From a taxonomic point of view, knowledge of the sequence of this pentanucleotide may thus be sufficient to allocate a flavivirus either to the vector-borne or to the NKV flaviviruses. It would be of interest to unravel whether this pentanucleotide sequence plays a role at the molecular level in the fact that NKV flaviviruses are not vector-borne. Construction of an infectious full-length clone, and the introduction of mutations within this pentanucleotide motif, may provide more insight into this fascinating observation. It would also be worth determining whether vector-borne viruses, in which the pentanucleotide sequence CACAG has been replaced by the pentanucleotide sequence that is typical for NKV flaviviruses, would have an altered efficiency of replication in either mosquito or tick cells.


   Acknowledgments
 
We thank L. Brullemans for excellent editorial assistance and S. Van Dooren and Y. Schrooten for their skilfull technical assistance. N. Charlier and P. Leyssen are Research Assistants from the Instituut voor Wetenschappelijk Onderzoek & Technologie (IWT/SB/991056/Charlier and IWT/SB/981025/Leyssen) and J. Neyts is supported by the Fonds voor Wetenschappelijk Onderzoek – Vlaanderen (FWO). This work was funded by a grant from the Geconcerteerde Onderzoeksacties – Vlaamse Gemeenschap (GOA: Project no 00/12) and the Fonds voor Wetenschappelijk Onderzoek – Vlaanderen (G. 0122-00).


   Footnotes
 
The MMLV sequence has been submitted to EMBL (accession no. AJ299445). The MODV sequence is available at accession no. AJ242984. The nucleotide sequences of the 3' UTR of APOIV and RBV are available at accession nos AF452049 and AF452050.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Bell, J. F. & Thomas, L. A. (1964). A new virus, ‘MML’, enzootic in bats (Myotis lucifungus) of Montana. American Journal of Tropical Medicine and Hygiene, 607–612.

Billoir, F., De Chesse, R., Tolou, H., De Micco, P., Gould, E. A. & De Lamballerie, X. (2000). Phylogeny of the genus Flavivirus using complete coding sequences of arthropod-borne viruses and viruses with no known vector. Journal of General Virology 81, 781-790.[Abstract/Free Full Text]

Blackwell, J. L. & Brinton, M. A. (1995). BHK cell proteins that bind to the 3' stem–loop structure of the West Nile virus genome RNA. Journal of Virology 69, 5650-5658.[Abstract]

Blackwell, J. L. & Brinton, M. A. (1997). Translation elongation factor-1 alpha interacts with the 3' stem–loop region of West Nile virus genomic RNA. Journal of Virology 71, 6433-6444.[Abstract]

Brinton, M. A., Fernandez, A. V. & Dispoto, J. H. (1986). The 3'-nucleotides of flavivirus genomic RNA form a conserved secondary structure. Virology 153, 113-121.[Medline]

Cammisa-Parks, H., Cisar, L. A., Kane, A. & Stollar, V. (1992). The complete nucleotide sequence of cell fusing agent (CFA): homology between the nonstructural proteins encoded by CFA and the nonstructural proteins encoded by arthropod-borne flaviviruses. Virology 189, 511-524.[Medline]

Chambers, T. J., Hahn, C. S., Galler, R. & Rice, C. M. (1990). Flavivirus genome organization, expression, and replication. Annual Review of Microbiology 44, 649-688.[Medline]

Charlier, N., Leyssen, P., Paeshuyse, J., Drosten, C., Schmitz, H., Van Lommel, A., De Clercq, E. & Neyts, J. (2002). Infection of SCID mice with Montana Myotis leukoencephalitis virus as a model for flavivirus encephalitis. Journal of General Virology 83, 1887-1896.[Abstract/Free Full Text]

Chen, C. J., Kuo, M. D., Chien, L. J., Hsu, S. L., Wang, Y. M. & Lin, J. H. (1997). RNA–protein interactions: involvement of NS3, NS5, and 3' noncoding regions of Japanese encephalitis virus genomic RNA. Journal of Virology 71, 3466-3473.[Abstract]

Grange, T., Bouloy, M. & Girard, M. (1985). Stable secondary structures at the 3'-end of the genome of yellow fever virus (17 D vaccine strain). FEBS Letters 188, 159-163.[Medline]

Gritsun, T. S., Venugopal, K., Zanotto, P. M., Mikhailov, M. V., Sall, A. A., Holmes, E. C., Polkinghorne, I., Frolova, T. V., Pogodina, V. V., Lashkevich, V. A. & Gould, E. A. (1997). Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs. Virus Research 49, 27-39.[Medline]

Gultyaev, A. P., Van-Batenburg, F. H. & Pleij, C. W. (1995). The computer simulation of RNA folding pathways using a genetic algorithm. Journal of Molecular Biology 250, 37-51.[Medline]

Hahn, C. S., Hahn, Y. S., Rice, C. M., Lee, E., Dalgarno, L., Strauss, E. G. & Strauss, J. H. (1987). Conserved elements in the 3' untranslated region of flavivirus RNAs and potential cyclization sequences. Journal of Molecular Biology 198, 33-41.[Medline]

Han, L. L., Popovici, F., Alexander, J. J., Laurentia, V., Tengelsen, L. A., Cernescu, C., Gary, J. H., Ion, N. N., Campbell, G. L. & Tsai, T. F. (1999). Risk factors for West Nile virus infection and meningoencephalitis, Romania, 1996. Journal of Infectious Diseases 179, 230-233.[Medline]

Heinz, F. X. & Mandl, C. W. (1993). The molecular biology of tick-borne encephalitis virus. Acta Pathologica, Microbiologica et Immunologica Scandinavica 101, 735-745.

Heinz, F. X., Collet, M. S., Purcell, R. H., Gould, E. A., Howard, C. R., Houghton, M., Moorman, R. J. M., Rice, C. M. & Thiel, H.-J. (2000). Flaviviridae. In Virus Taxonomy. Seventh Report of the International Committee for the Taxonomy of Viruses , pp. 859-878. Edited by M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.

Henikoff, S. & Henikoff, J. (1992). Amino acid substitution matrices for protein blocks. Proceedings of the National Academy of Sciences, USA 89, 10915-10919.[Abstract/Free Full Text]

Kamer, G. & Argos, P. (1984). Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Research 12, 7269-7282.[Abstract/Free Full Text]

Khromykh, A. A., Meka, H., Guyatt, K. J. & Westaway, E. G. (2001). Essential role of cyclization sequences in flavivirus RNA replication. Journal of Virology 75, 6719-6728.[Abstract/Free Full Text]

Koonin, E. V. (1993). Computer-assisted identification of a putative methyltransferase domain in NS5 protein of flaviviruses and lambda 2 protein of reovirus. Journal of General Virology 74, 733-740.[Abstract/Free Full Text]

Kuno, G., Chang, G. J., Tsuchiya, K. R., Karabatsos, N. & Cropp, C. B. (1998). Phylogeny of the genus Flavivirus. Journal of Virology 72, 73-83.[Abstract/Free Full Text]

Leyssen, P., Charlier, N., Lemey, P., Billoir, F., Van Damme, A.-M., De Clercq, E., De Lamballerie, X. & Neyts, J. (2002). Complete genome sequence, taxonomic assignment, and comparative analysis of the untranslated regions of the Modoc virus, a flavivirus with no known vector. Virology 293, 125-140.[Medline]

Maddison, W. P. & Maddison, D. R. (1989). Interactive analysis of phylogeny and character evolution using the computer program MacClade. Folia Primatologica 53, 190-202.

Mandl, C. W., Holzmann, H., Kunz, C. & Heinz, F. X. (1993). Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses. Virology 194, 173-184.[Medline]

Mandl, C. W., Holzmann, H., Meixner, T., Rauscher, S., Stadler, P. F., Allison, S. L. & Heinz, F. X. (1998). Spontaneous and engineered deletions in the 3' noncoding region of tick-borne encephalitis virus: construction of highly attenuated mutants of a flavivirus. Journal of Virology 72, 2132-2140.[Abstract/Free Full Text]

Mangada, M. N. & Igarashi, A. (1997). Sequences of terminal non-coding regions from four dengue-2 viruses isolated from patients exhibiting different disease severities. Virus Genes 14, 5-12.[Medline]

Mohan, P. M. & Padmanabhan, R. (1991). Detection of stable secondary structure at the 3' terminus of dengue virus type 2 RNA. Gene 108, 185-191.[Medline]

Monath, T. P. & Heinz, F. X. (1996). Flaviviruses. In Fields Virology , pp. 961-1034. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Monath, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences, USA 85, 2444-2448.[Abstract/Free Full Text]

Pletnev, A. G., Yamshchikov, V. F. & Blinov, V. M. (1990). Nucleotide sequence of the genome and complete amino acid sequence of the polyprotein of tick-borne encephalitis virus. Virology 174, 250-263.[Medline]

Poch, O., Sauvaget, I., Delarue, M. & Tordo, N. (1989). Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO Journal 8, 3867-3874.[Medline]

Proutski, V., Gaunt, M. W., Gould, E. A. & Holmes, E. C. (1997a). Secondary structure of the 3'-untranslated region of yellow fever virus: implications for virulence, attenuation and vaccine development. Journal of General Virology 78, 1543-1549.[Abstract]

Proutski, V., Gould, E. A. & Holmes, E. C. (1997b). Secondary structure of the 3'-untranslated region of flaviviruses: similarities and differences. Nucleic Acids Research 25, 1194-1202.[Abstract/Free Full Text]

Proutski, V., Gristun, T. S., Gould, E. A. & Holmes, E. C. (1999). Biological consequences of deletions within the 3' untranslated region of flaviviruses may be due to rearrangements of RNA secondary structure. Virus Research 64, 107-123.[Medline]

Shi, P. Y., Brinton, M. A., Veal, J. M., Zhong, Y. Y. & Wilson, W. D. (1996). Evidence for the existence of a pseudoknot structure at the 3' terminus of the flavivirus genomic RNA. Biochemistry 35, 4222-4230.[Medline]

Shurtleff, A. C., Beasley, D. W., Chen, J. J., Ni, H., Suderman, M. T., Wang, H., Xu, R., Wang, E., Weaver, S. C., Watts, D. M., Russell, K. L. & Barrett, A. D. (2001). Genetic variation in the 3' non-coding region of dengue viruses. Virology 281, 75-87.[Medline]

Strimmer, K. & Von Haeseler, A. (1996). Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Molecular Biology and Evolution 13, 964-969.

Von Heijne, G. (1984). How signal sequences maintain cleavage specificity. Journal of Molecular Biology 173, 243-251.[Medline]

Wallner, G., Mandl, C. W., Kunz, C. & Heinz, F. X. (1995). The flavivirus 3'-noncoding region: extensive size heterogeneity independent of evolutionary relationships among strains of tick-borne encephalitis virus. Virology 213, 169-178.[Medline]

Wengler, G. & Castle, E. (1986). Analysis of structural properties which possibly are characteristic for the 3'-terminal sequence of the genome RNA of flaviviruses. Journal of General Virology 67, 1183-1188.[Abstract/Free Full Text]

Received 14 December 2001; accepted 10 March 2002.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
P. A. G. C. Silva, R. Molenkamp, T. J. Dalebout, N. Charlier, J. H. Neyts, W. J. M. Spaan, and P. J. Bredenbeek
Conservation of the pentanucleotide motif at the top of the yellow fever virus 17D 3' stem-loop structure is not required for replication
J. Gen. Virol., June 1, 2007; 88(6): 1738 - 1747.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. S. Gritsun and E. A. Gould
Direct repeats in the 3' untranslated regions of mosquito-borne flaviviruses: possible implications for virus transmission.
J. Gen. Virol., November 1, 2006; 87(Pt 11): 3297 - 3305.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. S. Gritsun and E. A. Gould
The 3' untranslated regions of Kamiti River virus and Cell fusing agent virus originated by self-duplication
J. Gen. Virol., September 1, 2006; 87(9): 2615 - 2619.
[Abstract] [Full Text] [PDF]


Home page
Am J Trop Med HygHome page
A. DAVIS, M. BUNNING, P. GORDY, N. PANELLA, B. BLITVICH, and R. BOWEN
EXPERIMENTAL AND NATURAL INFECTION OF NORTH AMERICAN BATS WITH WEST NILE VIRUS
Am J Trop Med Hyg, August 1, 2005; 73(2): 467 - 469.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. E. Bryant, P. F. C. Vasconcelos, R. C. A. Rijnbrand, J. P. Mutebi, S. Higgs, and A. D. T. Barrett
Size Heterogeneity in the 3' Noncoding Region of South American Isolates of Yellow Fever Virus
J. Virol., March 15, 2005; 79(6): 3807 - 3821.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Charlier, P. Leyssen, J. Paeshuyse, C. Drosten, H. Schmitz, A. Van Lommel, E. De Clercq, and J. Neyts
Infection of SCID mice with Montana Myotis leukoencephalitis virus as a model for flavivirus encephalitis
J. Gen. Virol., August 1, 2002; 83(8): 1887 - 1896.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Agricola
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS