J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Agricola
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Journal of General Virology (2002), 83, 1887-1896.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Infection of SCID mice with Montana Myotis leukoencephalitis virus as a model for flavivirus encephalitis

Nathalie Charlier1, Pieter Leyssen1, Jan Paeshuyse1, Christian Drosten2, Herbert Schmitz2, Alfons Van Lommel3, Erik De Clercq1 and Johan Neyts1

Laboratory of Virology and Chemotherapy, Rega Institute for Medical Research, Minderbroedersstraat 10, B-3000 Leuven, Belgium1
Bernhard Nocht Institute of Tropical Medicine, Hamburg, Germany2
Division of Histopathology, University Hospitals, B-3000 Leuven, Belgium3

Author for correspondence: Johan Neyts. Fax +32 16 33 73 40. e-mail johan.neyts{at}rega.kuleuven.ac.be


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We have established a convenient animal model for flavivirus encephalitis using Montana Myotis leukoencephalitis virus (MMLV), a bat flavivirus. This virus has the same genomic organization, and contains the same conserved motifs in genes that encode potential antiviral targets, as flaviviruses that cause disease in man (N. Charlier et al., accompanying paper), and has a similar particle size (approximately 40 nm). MMLV replicates well in Vero cells and appears to be equally as sensitive as yellow fever virus and dengue fever virus to a selection of experimental antiviral agents. Cells infected with MMLV show dilation of the endoplasmic reticulum, a characteristic of flavivirus infection. Intraperitoneal, intranasal or direct intracerebral inoculation of SCID mice with MMLV resulted in encephalitis ultimately leading to death, whereas immunocompetent mice were refractory to either intranasal or intraperitoneal infection with MMLV. Viral RNA and/or antigens were detected in the brain and serum of MMLV-infected SCID mice, but not in any other organ examined: MMLV was detected in the olfactory lobes, the cerebral cortex, the limbic structures, the midbrain, cerebellum and medulla oblongata. Infection was confined to neurons. Treatment with the interferon-{alpha}/{beta} inducer poly(I)·poly(C) protected SCID mice against MMLV-induced morbidity and mortality, and this protection correlated with a reduction in infectious virus titre and viral RNA load. This validates the MMLV model for use in antiviral drug studies. The MMLV SCID model may, therefore, be attractive for the study of chemoprophylactic or chemotherapeutic strategies against flavivirus infections causing encephalitis.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Several flaviviruses such as Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV), West Nile virus (WNV), Murray Valley encephalitis virus (MVEV) (Hurrelbrink et al., 1999Down ) and others (Han et al., 1999Down ; Heinz & Mandl, 1993Down ) cause life-threatening neurological illness in humans. To date, most of the genetic and epidemiological studies on flaviviruses have focused on arboviruses, due to their impact on human health. An outbreak of WNV encephalitis in New York in the autumn of 1999 and 2000 with 79 cases of laboratory-confirmed WNV infection, nine of which were fatal, received much public attention (Asnis et al., 2000Down ; Briese et al., 1999Down ). Outbreaks of WNV encephalitis also occurred recently in southern Russia and Israel and previously in 1996 in Romania (Han et al., 1999Down ; Lvov et al., 2000Down ; Siegel-Itzkovich, 2000Down ). These outbreaks not only highlighted the risk of the emergence of flaviviruses in new ecosystems, but also the absence of any specific antiviral therapy for flavivirus encephalitis. One important reason for the latter situation is the lack of simple and convenient animal models (Leyssen et al., 2000Down ). Experimental infection of mice with JEV or TBEV by intracerebral or peripheral inoculation has been reported to cause morbidity and mortality (Chiba et al., 1999Down ; Hase et al., 1990Down ). However, the study of these viruses, which are highly pathogenic towards humans [BSL-3 for JEV, louping ill virus (LIV), WNV and St Louis encephalitis virus (SLEV) and BSL-4 for the TBEV complex, according to the American Committee on Arthropod-borne Viruses (ACAV); Subcommittee on Arbovirus Laboratory Safety (SALS)] requires special laboratory facilities. Interestingly, a neuroadapted yellow fever virus (YFV 17D) has recently been reported (Chambers & Nickells, 2001Down ).

We report here a convenient model for studying flavivirus encephalitis, and the therapy thereof, using the Montana Myotis leukoencephalitis virus (MMLV) (BSL-2 according to the ACAV; SALS). MMLV was first isolated in 1958 from a mouse bitten under laboratory conditions by a naturally infected little brown bat (Myotis lucifugus) captured in western Montana. The virus was subsequently isolated from saliva, brain and various other tissues from other bats of the same species. Serological studies suggested that the virus belonged to the flaviviruses (Bell & Thomas, 1964Down ). However, the virus was subsequently ‘forgotten’ by the scientific community.

The genus Flavivirus contains both viruses that are transmitted by mosquitoes or ticks (arboviruses) and viruses with no known vector (NKV) (Chambers et al., 1990Down ). In the accompanying manuscript we have described the complete genomic sequence of MMLV. Phylogenetic analysis has confirmed the classification of MMLV in the cluster of the NKV flaviviruses, as was suggested previously by Kuno et al. (1998)Down based on the sequence of a fragment of the NS5 gene of approximately 1 kb. We have also demonstrated that: (i) MMLV has the same genomic organization as other flaviviruses, and (ii) in the genes that encode the serine protease/helicase and RNA-dependent RNA polymerase (which are important targets for antiviral therapy), the virus contains the same conserved motifs for enzymatic activity as those flaviviruses that are pathogenic to humans. The animal model presented here may be attractive for the study of antiviral strategies against flavivirus infections, in particular flavivirus encephalitis.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus propagation and RNA isolation.
The original MMLV strain (Montana, 1958) was purchased from the ATCC (ATCC VR-537) and grown in Vero cells at 37 °C in minimum essential medium (MEM; Gibco) supplemented with 10% inactivated fetal calf serum (FCS), 1% L-glutamine and 0·3% bicarbonate. The viral RNA was extracted using the QIAamp Viral RNA kit (Qiagen), according to the manufacturer's instructions.

{blacksquare} Animals.
Eight- to twelve-week-old SCID mice and immunocompetent NMRI (Naval Medical Research Institute) mice weighing 16–20 g were used for all experiments. All animals were bred at the Rega Institute under specific pathogen-free conditions. Experiments on animals have been approved by and were in accordance with the guidelines of the Ethical Committee on Vertebrate Animal Experiments of the Katholieke Universiteit Leuven.

{blacksquare} Compounds.
Mycophenolic acid (MPA) was purchased from Sigma and ribavirin [1-({beta}-D-ribofuranosyl)-1,2,4-triazole-3-carboxamide] was from ICN. EICAR (5-ethynyl-1-{beta}-D-ribofuranosylimidazole-4-carboxamide) was synthesized by Dr A. Matsuda (Hokkaido University, Sapporo, Japan). Tiazofurin and selenazofurin were provided by Dr R. Cooney and Dr D. G. Johns (National Cancer Institute, NIH, Bethesda, MD). Polyinosinic–polycytidylic acid [poly(I)·poly(C)] was purchased from Sigma–Aldrich.

{blacksquare} Plaque reduction assay.
Serial dilutions of the test compounds were added to confluent Vero cell cultures grown in 96-well microtitre plates. Cells were infected with approximately 50 p.f.u. of either YFV, dengue fever virus (DENV), or MMLV. Cultures were further incubated at 37 °C for 7 days, after which they were fixed with 70% ethanol and stained with 2% Giemsa solution. Plaques were then counted under an inverted microscope. The antiviral activity of the compounds was expressed as the 50% effective concentration (EC50), i.e. the concentration required to reduce plaque formation by 50%.

{blacksquare} Titration for infectious virus content.
MMLV-infected mice were sacrified at various days after infection by ether anaesthesia. Brains were dissected aseptically, and 10% (w/v) tissue homogenates were prepared in MEM supplemented with 2% FCS. Confluent Vero cell cultures grown in 96-well plates were infected with 10-fold serial dilutions of the tissue homogenates and incubated at 37 °C for 1 h, after which the inoculum was removed. Cultures were then washed twice with warm medium and further incubated at 37 °C for 7–9 days, after which the cultures were evaluated for virus-induced CPE. The titre was expressed as the 50% cell culture infective dose (CCID50), i.e. the infectious dose required to infect 50% of the cells.

{blacksquare} RT–PCR.
Viral RNA was extracted from 140 µl of either the cell culture supernatant, or the serum, lymphocytes or macrophages of infected animals using the QIAamp Viral RNA kit (Qiagen). For the isolation of RNA from cell cultures, cell debris was first spun down with two consecutive centrifugation steps at 1500 g in a Minifuge-T. For the isolation of RNA from tissue samples, the RNeasy Mini kit (Qiagen) was used. Prior to reverse transcription (RT), 31·5 µl purified viral RNA was mixed with 10 µl 5x RT buffer (Amersham Pharmacia Biotech), 0·5 mM each of dATP, dTTP, dGTP and dCTP, and 1·2 µM of reverse primer (5' GGGAGGCTGAGTAAGCATACACAAGC 3', nt 3834–3859) and denaturated at 92 °C for 1 min followed by chilling on ice. RT reaction mixtures contained this denatured RNA plus 95 U human placenta RNase inhibitor (HPRI; Amersham Pharmacia Biotech), 2·4 U RAV-2 reverse transcriptase (Amersham Pharmacia Biotech) and RNase-free water added to give a final volume of 50 µl. The reaction mixture was incubated at 45 °C for 1·5 h. The PCR reaction mixture was prepared as follows: 5 µl cDNA, 5 µl 10x PCR buffer, 2 µl dNTP mix (100 µM of each dNTP), 1·2 µM forward primer (5' CGAGGTCAAAAACCCAAGGAGG 3'), 1·2 µM reverse primer (5' CCACAGCATGGGCTCAGATGTT 3') and 3·5 U Super Taq (HT Biotechnology). The following PCR programme was run: 10 min at 95 °C, 30 cycles of 30 s at 94 °C, 30 s at 60 °C, 1 min at 72 °C and, for the final extension, 10 min at 72 °C. The primers were specific MMLV primers that anneal in the NS1–NS2A genes (forward primer at nt 3281–3302 and reverse primer at nt 3639–3660).

{blacksquare} Semi-quantitative RT–PCR.
A calculated amount of 5 ng of total RNA isolated from tissue fragments was used in a 50 µl semi-quantitive RT–PCR assay using the OneStep RT–PCR kit (Qiagen). GAPDH (glyceraldehyde phosphate dehydrogenase) served as an internal control and a primer ratio MMLV/GAPDH of 2/1 was used. Amplification primers were GAPDH forward primer: 5' GGTGAAGGTCGGTGTGAACG 3'; GAPDH reverse primer: 5' ATGTTCTGGACAACCCCACG 3'; MMLV forward primer: 5' GCACGAAGCTGCTGAGAGTGCC 3'; MMLV reverse primer: 5' TGAAAGCTGTGTAGGCGCTCCA 3'. After amplification (annealing at 60 °C, 30 cycles) and separation of the amplicons (GAPDH 609 bp, MMLV 978 bp) by agarose gel electrophoresis, the gel was scanned and the two bands were quantified using the ImageMaster software (Hoeffer Pharmacia Biotech).

{blacksquare} Quantification of MMLV RNA by 5' nuclease real-time RT–PCR.
RNA preparation was performed using the QIAamp Viral RNA kit (Qiagen), according to the manufacturer's instructions. For elution of RNA, the columns were incubated with 50 µl of RNase-free water at 80 °C. Primers MMLVS2 (5' TCCGTAGGAAGCGTTGGTGT 3') and MMLVAs1 (5' ATTCCATTACTTCTGCCACTTCGA 3') were used to amplify a 170 bp segment in the 5' non-coding/core region of MMLV. For detection of PCR products, probe MMP (5' AAGAGCGACGTGGTTTCCAGCC 3') was used. It was labelled with FAM (6-carboxy-fluorescein) at the 5' end and TAMRA (6-carboxy-N,N,N',N'-tetramethylrhodamine) at the 3' end. The probe was phosphorylated at its 3' end to prevent elongation during PCR. RT–PCR was carried out using the Superscript One-Step RT–PCR System with Platinum Taq (Life Technology). A 20 µl reaction volume contained 10 µl of 2x reaction buffer, 2·5 mM additional magnesium sulfate, 300 nM each of primers MMLVS2 and MMLVAs1, 200 nM of probe MMP, 0·8 µg BSA (Sigma–Aldrich) and 0·4 µl of Superscript Reverse Transcriptase/Platinum Taq enzyme mix. Prepared RNA (2 µl) was added to each reaction. Thermal cycling in a LightCycler (Roche Molecular Biochemicals) involved reverse transcription at 45 °C for 20 min, denaturation at 95 °C for 5 min, followed by 45 cycles of 95 °C for 5 s and 57 °C for 35 s. (Wittwer et al., 1997Down ).

During PCR, the probe MMP was digested by the 5' exonuclease activity of Taq DNA polymerase when specifically annealed to the generated MMLV PCR product (Holland et al., 1991Down ). Probe digestion liberated the FAM from the TAMRA dye, causing an increase in FAM-specific fluorescence during PCR (Livak et al., 1995Down ). FAM fluorescence was measured on detection channel F1 (530 nm) and divided by fluorescence measured on channel F2 (640 nm) for normalization. As a quantification standard for real-time PCR, a strong positive MMLV stock was diluted in virus-negative human plasma prior to RNA preparation. One PCR unit (PCRU) of MMLV RNA was defined as the lowest possible dilution that could be amplified in five out of five replicate reactions. The quantification procedure using the LightCycler has been previously described (De Silva et al., 1998Down ).

{blacksquare} Animal experiments.
NMRI mice or SCID mice were inoculated with 104 p.f.u. of MMLV via either the intraperitoneal (i.p.; 200 µl), intracerebral (i.c.; 50 µl) or intranasal (i.n.; 20 µl) route. The animals were examined daily for signs of morbidity and mortality. The statistical significance of differences in the mean day of death was assessed by means of the Student’s t test and differences in the number of survivals by means of the {chi}2 test with Yates’ correction. To study the progression of MMLV infection in NMRI mice and SCID mice, the animals were infected intraperitoneally with MMLV and two to four mice were sacrified every 3 days. Blood samples were taken and total RNA was extracted from the serum and subsequently used for RT–PCR. Brain, salivary glands, lung, liver, kidney, pancreas, seminal vesicles and spleen were removed and subjected to immunostaining.

In some experiments, half of the infected animals were implanted on day 0 or on day 14 following infection with a mini-osmotic pump (Alzet Model 2002, Alza Corporation, California, USA) filled with ribavirin at a concentration of 83·3 µg/µl, resulting in a continuous subcutaneous calculated release of 50 mg/kg/day of ribavirin. Mice were monitored for 4 weeks after virus challenge.

{blacksquare} Electron microscopy.
Vero cells that had been infected with MMLV and that exhibited an extensive CPE were fixed in a buffered glutaraldehyde solution for 30 min, washed with isotonic phosphate buffer, post-fixed with 1% OsO4 solution for 1 h, collected, dehydrated and embedded in Dow epoxy resin for electron microscopy. Sections (1 µm) stained with toluidine blue were examined with a light microscope. Sample sections (50 nm) of areas of interest were collected on grids, stained with uranyl acetate and lead citrate, and examined with a Philips CM10 electron microscope.

{blacksquare} Histopathology.
Moribund animals with severe signs of paralysis were euthanized with ether anaesthesia and were transcardially perfused with 20 ml of a buffered 4% formaldehyde solution for histology. Fixed tissue samples were embedded in paraffin and further processed using standard methods.

{blacksquare} Preparation of digoxigenin-labelled cRNA.
MMLV cDNA encompassing 655 nucleotides of the NS5 region of the MMLV genome (forward primer 5' TCATCCAGAGAAGAATTG 3'; reverse primer 5' TTCAAAAAGCCAAAGCTTTCAAATTC 3') was cloned into the transcription vector pGEM-T (Promega). To generate runoff transcripts, the plasmid was linearized with NotI (Promega) for 1·5 h at 37 °C. The linearized plasmid DNA was precipitated with 3 M sodium acetate (pH 4·6) and 2·5 vols ethanol. After centrifugation, the pellet was washed in 70% ethanol and dissolved in RNase-free water at a concentration of approximately 100 ng/µl.

Transcription reactions (20 µl) consisted of 2 µl water, 10 µl linearized cDNA (1 µg), 4 µl 5x transcription buffer (Promega), 2 µl 10x Dig Labelling Mix (Roche Diagnostics) and 2 µl T7 RNA polymerase (Promega). The reaction was incubated for 2 h at 37 °C. The cRNA derived by T7 polymerase in vitro transcription was isolated on a Mini Quick Spin RNA column (Boehringer Mannheim) and the eluate was frozen at -80 °C until use.

{blacksquare} In situ hybridization.
Paraffin-embedded tissue was sectioned, hydrated, fixed, denaturated and acetylated according to standard procedures (Breitschopf et al., 1992Down ). The sections were permeabilized by digestion with proteinase K (100 µg/ml) (Boehringer Mannheim) for 20 min. Prehybridization was at 60 °C for 30 min. Hybridization solution was prepared by adding 200 ng of digoxigenin (DIG)-labelled cRNA per ml of hybridization buffer (EasyHyb, Roche Diagnostics). The hybridization solution (150 µl/section) was added, the section was heated for 4 min at 95 °C to denature the probe and hybridization was allowed to occur at 60 °C for 4–6 h in a humidified chamber. The sections were incubated in 2x SSC (0·15 M NaCl, 0·015 M sodium citrate) for 12 h and washed with 1x SSC. On completion of the hybridization step, the sections were incubated in buffer solution containing 0·5% (w/v) blocking reagent (Boehringer Mannheim) at room temperature for 15 min, followed by incubation with alkaline phosphatase-conjugated anti-DIG polyclonal antiserum (1:500 in blocking buffer) for 1 h and incubated overnight with the NBT/BICP reagent (Roche Molecular Biochemicals).

{blacksquare} Immunohistochemistry.
Primary antiserum was produced in New Zealand rabbits after immunization with a suspension of UV-inactivated MMLV and complete Freund's adjuvant. Tissue sections were rehydrated and blocked with 2% skimmed milk. The sections were then incubated with 200 µl of primary rabbit antiserum (dilution 1:100) for 1 h at 37 °C. The sections were rinsed in PBS and incubated with horseradish peroxidase-conjugated donkey anti-rabbit antibody diluted 1:500 in PBS for 30 min at 37 °C. After rinsing, endogenous peroxidase activity was quenched by incubation overnight in 70 ml buffer (0·1 M acetate and 0·15 ml of a 3% H2O2 solution) containing 20 mg AEC (3-amino-9-ethyl-carbazole) (Sigma–Aldrich) in 5 ml N,N-dimethylformamide.

To monitor MMLV infection in the brain, sections were stained with haematoxylin and eosin (H&E) according to standard procedures.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Antiviral susceptibility
MMLV produces an obvious CPE in Vero cells. The susceptibility of MMLV to a selection of antiviral agents could therefore easily be monitored. We compared the inhibitory effects of ribavirin, EICAR (the 5-ethynyl derivative of ribavirin) (De Clercq et al., 1991Down ), tiazofurin, selenazofurin (an oncolytic C-nucleoside) and MPA (an inhibitor of IMP dehydrogenase) on the replication of YFV, DENV and MMLV. As shown in Table 1Down, the antiviral efficacy of the different compounds against all three viruses ranked as follows: mycophenolic acid>EICAR>selenazofurin>tiazofurin>ribavirin. Thus, the susceptibility of MMLV to these compounds proved to be more or less comparable with the susceptibility of the human flaviviruses YFV and DENV to these drugs.


View this table:
[in this window]
[in a new window]
 
Table 1. Susceptibility of MMLV, YFV and DENV to a selection of experimental antiviral agents

 
Ultrastructural analysis
MMLV-infected Vero cell cultures were studied by means of electron microscopy. At 7 days post-infection, the subcellular pathology was characterized, as compared with uninfected cells, by extensive proliferation and dilation of the rough endoplasmic reticulum (RER) (Fig. 1Down), which is characteristic for cells infected with flaviviruses (Chambers et al., 1990Down ; Westaway, 1987Down ). The size of the viral particles inside the RER was determined to be ~40 nm, which is very similar to the size of human flaviviruses (40–60 nm) (Monath & Heinz, 1996Down ).



View larger version (168K):
[in this window]
[in a new window]
 
Fig. 1. Ultrastructural analysis of Vero cells 7 days post-infection, showing extensive proliferation and dilation of the RER (arrow, viral particles; N, nucleus; RER, rough endoplasmic reticulum) (inset: detail of particles). Scale bar, 0·5 µm.

 
MMLV-induced encephalitis and mortality
The effect of different routes of inoculation with MMLV on morbidity and mortality in SCID and NMRI mice was studied. Direct intracerebral (i.c.) inoculation of the virus (104 p.f.u.) in both SCID and NMRI mice led to paralysis within 6 days and mortality within 9 days [Fig. 2ADown, BDown; mean day of paralysis (MDP): 6·1±0·3 (SCID) and 7·1±0·6 (NMRI); mean day of death (MDD): 10·0±1·2 (SCID) and 9·6±0·7 (NMRI); 10 NMRI mice and 15 SCID mice]. Morbidity was characterized by ruffled fur, paralysis of the hind legs and a wasting syndrome. Intraperitoneal (i.p.) or intranasal (i.n.) infection of SCID mice with MMLV resulted in morbidity (Fig. 2ADown; i.p. route: MDP 19·8±2·6, >50 animals; i.n. route: MDP 20·2±1·1, >15 animals) and mortality (Fig. 2Down; i.p. route: MDD 25·1±2·0, >50 animals; i.n. route; MDD 21·6±0·5, >15 animals). Immunocompetent NMRI mice infected with MMLV via the i.p. or i.n. route remained healthy throughout the experiment (Fig. 2BDown).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Paralysis and mortality following intracerebral (i.c.), intraperitoneal (i.p.), or intranasal (i.n.) inoculation of SCID mice (A) or NMRI mice (B) with MMLV. Each group consisted of 10 to >50 mice. The columns represent the mean day of paralysis (MDP; white columns) and the mean day of death (MDD; black columns)±SD.

 
Viral RNA in blood serum and white blood cells
Total RNA was extracted from the serum and white blood cells of i.p. MMLV-infected SCID mice that exhibited obvious signs of paralysis. Following RT–PCR (detection limit: 1·2 fg viral RNA; data not shown), viral RNA was detected in the serum starting at day 6 post-infection (Fig. 3Down). This was confirmed by real-time quantitative RT–PCR. The level of viral RNA in the serum increased continuously until the animals died. No viral RNA was detected in the white blood cell population (leucocytes and macrophages) of infected animals.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 3. Detection of viral RNA in the serum of SCID mice infected with MMLV via the i.p. route. Sera from two mice were collected every third day after infection until day 21 post-infection and were pooled. Quantification of the viral RNA load in the serum was carried out in triplicate by TaqMan RT–PCR (SD below 15%). One PCR unit (PCRU) is defined as the lowest template copy number detectable in three out of three replicate reactions as determined by a limiting dilution series.

 
Histopathology
In SCID mice that had been inoculated with MMLV via the i.p. route, the virus was first detected in the brain by in situ hybridization on day 12 post-infection (data not shown). In one animal (out of eight) a massive degeneration of the hippocampus was seen on day 18 (data not shown). The brains of the other seven animals showed a less pronounced degeneration. At the time of paralysis, viral RNA was detected in the grey matter of the olfactory lobes, the pyriform cerebral cortex, the temporal cerebral cortex, the limbic structures, the midbrain structures (thalamus, hypothalamus), and in the medulla oblongata. Viral RNA was also detected in the cerebellum with infection of virtually all of the Purkinje cells. Overall, MMLV RNA was present in the cytoplasm of infected cells and appeared to be confined to neurons. Neuron dysfunction may therefore be expected to be the cause of encephalitis and ultimately death. The pattern of MMLV infection, as assessed by in situ hybridization, was confirmed by immunohistochemistry (Fig. 4Down).



View larger version (133K):
[in this window]
[in a new window]
 
Fig. 4. Localization of MMLV RNA or antigens in the brains of SCID mice at the time of paralysis (day 18 following infection by i.p. route) by in situ hybridization [A, D, E (1, 2), F, H] and immunohistochemistry [B, C, E (3), I]. The presence of virus is shown in the neurons in the cortex (A; magnification x100; B, x100; C x40), in the bulbus olfactorius (D, x2·5), in the hippocampus [E, (1) x2·5, (2) x25, (3) x25], in the temporal cortex (F, x10), in the cerebellum (H, x10), and in the Purkinje cells in the cerebellum (I, x25). (G) Sagittal section through the mouse brain with indication of the position at which the microphotographs were taken.

 
Effect of treatment with an interferon inducer on MMLV replication and associated mortality
To validate the MMLV model for future antiviral studies, we sought to assess whether there was a correlation between the protective effect on morbidity and mortality of a therapeutic or prophylactic agent, and inhibition of virus replication. Treatment with ribavirin (given as a continuous infusion at 50 mg/kg/day for 14 days) did not protect mice from MMLV-induced morbidity and mortality; nor did it cause a reduction in viral RNA in the infected organs (data not shown). We therefore studied the effect of poly(I)·poly(C), an inducer of interferon-{alpha}/{beta} on virus replication. To this end, SCID mice were treated with a single dose of poly(I)·poly(C) at 15 mg/kg and were infected intraperitoneally with MMLV 24 h later. This pretreatment with poly(I)·poly(C) resulted in a significant reduction in the number of animals developing signs of paralysis (2/6 compared with 6/6 in the untreated control group) (data not shown) and also a 16 day delay in virus-induced mortality (Fig. 5CDown). When poly(I)·poly(C) was given 2 h post-infection, all protective activity was gone. In a parallel group of mice, the infection was monitored by real-time quantitative (Fig. 5BDown) and semi-quantitative (Fig. 5ADown) RT–PCR and by titration (Fig. 5BDown) for infectious virus content in the brain of MMLV-infected SCID mice that had received either mock or poly(I)·poly(C) pretreatment. Tissue samples were taken at a time at which untreated control animals had developed signs of paralysis (i.e. 18 days post-infection). Levels of viral RNA detected in the brain of infected SCID mice that had been pretreated with poly(I)·poly(C) were markedly reduced (1·2x104 PCRU compared with 1·18x108 PCRU in the untreated control group) (Fig. 5BDown). In addition, titration for infectious virus content (Fig. 5BDown) showed an important decrease in viral load in the brain of the pretreatment group (1·5x107 CCID50/g tissue compared with 5x1011 CCID50/g tissue in the control group). Thus, the protective effect of poly(I)·poly(C) on virus-induced morbidity and mortality was reflected by a marked reduction in the infectious virus titre and viral RNA load.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. MMLV RNA detected in the brain of MMLV-infected SCID mice that were treated with poly(I)·poly(C) either 24 h before infection (pretreatment) or starting at 2 h post-infection (post-treatment). (A) Gel electrophoresis of the amplicons obtained by One-Step RT–PCR (VC, untreated virus control group; pre, pretreatment group; post, post-treatment group). (B) Quantification of viral RNA load using TaqMan technology (black bar) or infectious virus content (grey bar). (C) Mean day of death (*, P<0·05 compared with the untreated virus control group). Dashed line: day at which animals in a parallel group were sacrificed for the determination of infectious virus titre and RNA load as depicted in panels A and B.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Several flaviviruses cause life-threatening neurological illnesses in man. There is currently no specific antiviral drug available for the treatment of infections caused by these viruses. The search for treatment strategies has been hampered, in part, by the absence of a convenient animal model. Several flaviviruses are pathogenic and lethal in mice, but only following direct intracerebral inoculation. Other flaviviruses can cause morbidity and mortality following peripheral inoculation; however, these viruses require special safety conditions for manipulation. Flaviviruses such as DENV, YFV or JEV can infect monkeys, but because of the costs involved and the restricted availability of monkeys, the number of studies using these animals is limited.

We have presented a model for the study of antiviral strategies against flavivirus encephalitis employing the Montana Myotis leukoencephalitis virus. MMLV is highly pathogenic to mice and has been classified as a biosafety level II pathogen by SALS (http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s71.htm). As we report in the accompanying paper (Charlier et al., 2002Down ), MMLV has the same overall genome organization as flaviviruses of clinical importance, and in those genes that are considered to be interesting antiviral targets (i.e. the NS3 gene, which encodes an NTPase/helicase and serine protease, and the NS5 gene encoding an RNA-dependent RNA polymerase), it has the same conserved motifs as flaviviruses that are infectious to humans.

MMLV can be readily propagated in cell culture and the virus has a susceptibility to a selection of antiviral drugs, including ribavirin and its 5-ethynyl analogue, EICAR (Leyssen et al., 2000Down ), that is comparable with that of YFV and DENV, which further points to the relevance of MMLV for the study of antiviral strategies against flaviviruses.

MMLV is neuroinvasive in SCID mice, but not in immunocompetent mice, in which it is only neurovirulent. In SCID mice infected via the peripheral route with MMLV, the virus is detected in the brain and serum; no viral antigens or viral RNA are detectable in solid organs (by means of immunohistochemistry or in situ hybridization) nor in macrophages or other blood-borne cells (by means of RT–PCR) (data not shown). Virus titres in the serum of MMLV-infected SCID mice start to rise well before the virus is detected in the brain. It may be assumed that this viraemia is the result of low-level virus replication in peripheral organs, a level that is, however, too low to be detected by in situ hybridization or immunohistochemistry. Virus replication in these organs was not detectable by means of RT–PCR or titration for infectious virus content, since, despite extensive perfusion of the animals, traces of blood resulted in false positive signals for all organs. M. Halevy and collegues concluded that WNV replicates in as yet unidentified target tissues following peripheral inoculation of SCID mice with the virus (Halevy et al., 1994Down ). Modoc virus (MODV), a flavivirus isolated from the white-footed deer mouse (Johnson, 1967Down ), is, like MMLV, neuroinvasive in SCID mice, but, unlike MMLV, replicates in peripheral organs such as the salivary glands and in the spleen (Leyssen et al., 2001Down ). In a recent study, a neuroadapted strain of YFV, 17D, derived from a multiple mouse brain-passaged virus, proved neuroinvasive in SCID mice. Unlike MMLV, this virus exhibited an efficient growth in peripheral tissues of SCID mice (Chambers & Nickells, 2001Down ). In addition to isolation from the brain, JEV was also isolated from the liver and spleen of newborn mice infected via transplacental transmission of intraperitoneally infected pregnant mice (Mathur et al., 1981Down ). It remains largely unclear which determinants influence the organ tropism of flaviviruses in peripheral organs. As is the case for the murine MMLV and WNV models, in patients with WNV encephalitis, virus was not detected in major organs such as lung, liver, spleen and kidney (Nash et al., 2001Down ; Sampson et al., 2000Down ; Shieh et al., 2000Down ).

It has been demonstrated for YFV, WNV, JEV, MVEV, TBEV and LIV that specific amino acid substitutions within the E protein are associated with loss of neuroinvasiveness in mice (Cecilia & Gould, 1991Down ; Hasegawa et al., 1992Down ; Sumiyoshi et al., 1995Down ; McMinn et al., 1995aDown , bDown ; Holzmann et al., 1990Down ; Jiang et al., 1993Down ; Chambers et al., 1998Down ; Chambers & Nickells, 2001Down ). Obviously the E protein plays a prominent role in neuropathogenesis of flaviviruses and the particular characteristics of the E protein of MMLV may thus determine the tropism of this bat virus.

MMLV-induced encephalitis in SCID mice is characterized by the presence of viral RNA in virtually all regions of the brain and infection is clearly confined to neurons. We did not detect other cells of the CNS that were infected with MMLV. In the brain of mice infected with JEV, major cytopathological changes were observed in neurons and developing neurons (Ogata et al., 1991Down ; Hase, 1993Down ; Hase et al., 1993Down ; Wang et al., 1998Down ). Also, in rodent infection models with viruses such as MVEV, YFV and WNV, virus replication in the brain was mainly confined to neurons (Matthews et al., 2000Down ; Schlesinger et al., 1996Down ; Weiner et al., 1970Down ; Eldadah & Nathanson, 1967Down ). Presence of virus in all regions of the brain has also been observed in patients with Japanese encephalitis (Johnson et al., 1985Down ). In patients with West Nile (meningo)encephalitis, virus was detectable in neurons throughout the brain (Nash et al., 2001Down ; Nichter et al., 2000Down ; Sampson et al., 2000Down ; Shieh et al., 2000Down ) and, as seen in the MMLV model, also in the medulla oblongata. TBEV was detected in the thalamus, substantia nigra and cerebellum of the brain of patients with tick-borne encephalitis (Mazlo & Szanto, 1978Down ).

In the CNS of MMLV-infected SCID mice, no or little cell infiltration was observed. Since SCID mice do not carry (functional) B and T cells, infiltration of the brain by lymphocytes is not possible. Yet, SCID mice do harbour functional macrophages as well as natural killer (NK) cells; however, no or little infiltration of these cells in the brain of infected animals was observed. In WNV-infected mice, two populations of inflammatory cells were detected in the central nervous system: NK cells and cytotoxic T cells (Liu et al., 1989Down ). In normal mice, JEV infection caused prominent inflammatory changes with leukocytic infiltration and perivascular cuffing (Hase et al., 1990Down ). The fact that no or little inflammation was observed in the brain of MMLV-infected SCID mice points to the fact that direct viral damage is the main (or sole) reason for brain dysfunction and virus-induced mortality. This may make the MMLV model particularly attractive for the study of antiviral strategies against flaviviruses. Indeed, a protective effect in the MMLV model will probably be solely attributable to a direct inhibitory effect of the compound on virus replication in the brain. If such a molecule can prove sufficiently protective in the MMLV model, it may be interesting to study its effect in animal (including monkey) models with more pathogenic flaviviruses, in which an inflammatory response is also involved in the pathology of the disease.

To validate the MMLV model for future use in antiviral drug studies, we sought to prove that protection against MMLV disease progression correlates with an inhibitory effect on virus replication. Treatment with ribavirin had a weak inhibitory effect on the replication of MMLV in vitro (as for YFV and DENV) and did not protect mice from MMLV-induced morbidity and mortality, nor did it cause a reduction in viral RNA in the brain. This is in line with the finding that ribavirin does not result in any protective effect in rhesus monkeys infected with dengue virus type 1 (Malinoski et al., 1990Down ). Ribavirin has also never been shown to be protective against flaviviruses in man. Ribavirin, therefore, did not prove useful to validate the MMLV model for antiviral drug studies. For this reason, we made use of the interferon-{alpha}/{beta} inducer poly(I)·poly(C). This molecule has previously been shown to elicit a protective effect against JEV and MODV infection in mice and/or monkeys (Leyssen et al., 2001Down ; Harrington et al., 1977Down ; Singh & Postic, 1970Down ; Worthington et al., 1973Down ). The interferon inducer delayed MMLV-induced mortality and reduced virus titres, which further demonstrates that the MMLV model may be useful in both prophylactic and therapeutic studies.

In conclusion, the MMLV mouse model has several clinical, histopathological and virological features reminiscent of flavivirus infections, in particular flavivirus encephalitis, in humans. Therefore, the MMLV model may be valuable for the study of antiviral strategies against infections with flaviviruses, in particular those causing encephalitis.


   Acknowledgments
 
N. Charlier and P. Leyssen are Research Assistants from the Instituut voor Wetenschappelijk Onderzoek & Technologie (IWT/SB/991056/Charlier and IWT/SB/981025/Leyssen) and J. Neyts is a post-doctoral fellow from the Fonds voor Wetenschappelijk Onderzoek – Vlaanderen (FWO). This work was supported by a grant from the Geconcerteerde Onderzoeksacties – Vlaamse Gemeenschap (GOA: Project no. 00/12) and the Fonds voor Wetenschappelijk Onderzoek – Vlaanderen (G. 0122-00).


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Asnis, D. S., Conetta, R., Teixeira, A. A., Waldman, G. & Sampson, B. A. (2000). The West Nile Virus outbreak of 1999 in New York: the Flushing Hospital experience. Clinical Infectious Diseases 30, 413-418.[Medline]

Bell, J. F. & Thomas, L. A. (1964). A new virus, ‘‘MML’’, enzootic in bats (Myotis lucifungus) of Montana. American Journal of Tropical Medicine and Hygiene 607–612.

Breitschopf, H., Suchanek, G., Gould, R. M., Coldman, D. R. & Lassmann, H. (1992). In situ hybridization with digoxigenin-labeled probes: sensitive and reliable detection method applied to myelinating rat brain. Acta Neuropathologica (Berlin) 84, 581-587.[Medline]

Briese, T., Jia, X.-Y., Huang, C., Grady, L. J. & Lipkin, W. I. (1999). Identification of a Kunjin/West Nile-like flavivirus in brains of patients with New York encephalitis. Lancet 354, 1261-1262.[Medline]

Cecilia, D. & Gould, E. A. (1991). Nucleotide changes responsible for loss of neuroinvasiveness in Japanese encephalitis virus neutralization-resistant mutants. Virology 181, 70-77.[Medline]

Chambers, T. J. & Nickells, M. (2001). Neuroadapted Yellow fever virus 17D: genetic and biological characterization of a highly mouse-neurovirulent virus and its infectious molecular clone. Journal of Virology 75, 10912-10922.[Abstract/Free Full Text]

Chambers, T. J., Hahn, C. S., Galler, R. & Rice, C. M. (1990). Flavivirus genome organization, expression, and replication. Annual Review of Microbiology 44, 649-688.[Medline]

Chambers, T. J., Halevy, M., Nestorowicz, A., Rice, C. M. & Lustig, S. (1998). West Nile virus envelope proteins: nucleotide sequence analysis of strains differing in mouse neuroinvasiveness. Journal of General Virology 79, 2375-2380.[Abstract]

Charlier, N., Leyssen, P., Pleij, C. W. A., Lemey, P., Billoir, F., Van Laethem, K., Vandamme, A.-M., De Clerq, E., de Lamballerie, X. & Neyts, J. (2002). Complete genome sequence of Montana Myotis leukoencephalitis virus, phylogenetic analysis and comparative study of the 3' untranslated region of flaviviruses with no known vector. Journal of General Virology 83, 1875-1885.[Abstract/Free Full Text]

Chiba, N., Iwasaki, T., Mizutani, T., Kariwa, H., Kurata, T. & Takashima, L. (1999). Pathogenicity of tick-borne encephalitis virus isolated in Hokkaido, Japan in mouse model. Vaccine 17, 779-787.[Medline]

De Clercq, E., Cools, M., Balzarini, J., Snoeck, R., Andrei, G., Hosoya, M., Shigeta, S., Ueda, T., Minakawa, N. & Matsuda, A. (1991). Antiviral activities of 5-ethynyl-1-beta-D-ribofuranosylimidazole-4-carboxamide and related compounds. Antimicrobial Agents and Chemotherapy 35, 679-684.[Abstract/Free Full Text]

De Silva, D., Reiser, A., Hermann, M., Tabiti, K. & Wittwer, C. (1998). Rapid genotyping and quantification on the LightCycler with hybridization probes. Biochemica 2, 12-15.

Eldadah, A. H. & Nathanson, N. (1967). Pathogenesis of West Nile Virus encephalitis in mice and rats. II. Virus multiplication, evolution of immunofluorescence, and development of histological lesions in the brain. American Journal of Epidemiology 86, 776-790.[Free Full Text]

Halevy, M., Akov, Y., Ben-Nathan, D., Kobiler, D., Lachmi, B. & Lustig, S. (1994). Loss of active neuroinvasiveness in attenuated strains of West Nile virus: pathogenicity in immunocompetent and SCID mice. Archives of Virology 137, 355-370.[Medline]

Han, L. L., Popovici, F., Alexander, J. J., Laurentia, V., Tengelsen, L. A., Cernescu, C., Gary, J. H., Ion, N. N., Campbell, G. L. & Tsai, T. F. (1999). Risk factors for West Nile virus infection and meningoencephalitis, Romania, 1996. Journal of Infectious Diseases 179, 230-233.[Medline]

Harrington, D. G., Hilmas, D. E., Elwell, M. R., Whitmire, R. E. & Stephen, E. I. (1977). Intranasal infection of monkeys with Japanese encephalitis virus: clinical response and treatment with a nuclease-resistant derivative of poly (I).poly (C). American Journal of Tropical Medicine and Hygiene 26, 1191-1198.

Hase, T. (1993). Virus–neuron interactions in the mouse brain infected with Japanese encephalitis virus. Virchows Archiv B Cell Pathology Including Molecular Pathology 64, 161-170.

Hase, T., Dubois, D. R. & Summers, P. L. (1990). Comparative study of mouse brains infected with Japanese encephalitis virus by intracerebral or intraperitoneal inoculation. International Journal of Experimental Pathology 71, 857-869.[Medline]

Hase, T., Dubois, D. R., Summers, P. L., Downs, M. B. & Ussery, M. A. (1993). Comparison of replication rates and pathogenicities between the SA14 parent and SA14-14-2 vaccine strains of Japanese encephalitis virus in mouse brain neurons. Archives of Virology 130, 131-143.[Medline]

Hasegawa, H., Yoshida, M., Shiosaka, T., Fujita, S. & Kobayashi, Y. (1992). Mutations in the envelope protein of Japanese encephalitis virus affect entry into cultured cells and virulence in mice. Virology 191, 158-165.[Medline]

Heinz, F. X. & Mandl, C. W. (1993). The molecular biology of tick-borne encephalitis virus. Acta Pathologica, Microbiologica et Immunologica Scandinavica 101, 735-745.

Holland, P. M., Abramson, R. D., Watson, R. & Gelfand, D. H. (1991). Detection of specific polymerase chain reaction product by utilizing the 5’->3' exonuclease activity of Thermus aquaticus DNA polymerase. Proceedings of the National Academy of Sciences, USA 88, 7276-7280.[Abstract/Free Full Text]

Holzmann, H., Heinz, F. X., Mandl, C. W., Guirakhoo, F. & Kunz, C. (1990). A single amino acid substitution in envelope protein E of tick-borne encephalitis virus leads to attenuation in the mouse model. Journal of Virology 64, 5156-5159.[Abstract/Free Full Text]

Hurrelbrink, R. J., Nestorowicz, A. & McMinn, P. C. (1999). Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA. Journal of General Virology 80, 3115-3125.[Abstract/Free Full Text]

Jiang, W. R., Lowe, A., Higgs, S., Reid, H. & Gould, E. A. (1993). Single amino acid codon changes detected in louping ill virus antibody-resistant mutants with reduced neurovirulence. Journal of General Virology 74, 931-935.[Abstract/Free Full Text]

Johnson, H. N. (1967). Ecological implications of antigenically related mammalian viruses for which arthropod vectors are unknown and avian associated soft tick viruses. Japanese Journal of Medical Science and Biology 20, 160-166.

Johnson, R. T., Burke, D. S., Elwell, M., Leake, C. J., Nisalak, A., Hoke, C. H. & Lorsomrudee, W. (1985). Japanese encephalitis: immunocytochemical studies of viral antigen and inflammatory cells in fatal cases. Annals of Neurology 18, 567-573.[Medline]

Kuno, G., Chang, G. J., Tsuchiya, K. R., Karabatsos, N. & Cropp, C. B. (1998). Phylogeny of the genus Flavivirus. Journal of Virology 72, 73-83.[Abstract/Free Full Text]

Leyssen, P., De Clercq, E. & Neyts, J. (2000). Perspectives for the treatment of infections with Flaviviridae. Clinical Microbiology Reviews 13, 67-82.[Abstract/Free Full Text]

Leyssen, P., Van Lommel, A., Drosten, C., Schmitz, H., De Clercq, E. & Neyts, J. (2001). A novel model for the study of the therapy of flavivirus infections using the Modoc virus. Virology 279, 27-37.[Medline]

Liu, Y., Blanden, R. V. & Mullbacher, A. (1989). Identification of cytolytic lymphocytes in West Nile virus-infected murine central nervous system. Journal of General Virology 70, 565-573.[Abstract/Free Full Text]

Livak, K. J., Flood, S. J., Marmaro, J., Giusti, W. & Deetz, K. (1995). Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods and Applications 4, 357-362.[Medline]

Lvov, D. K., Butenko, A. M., Gromashevsky, V. L., Larichev, V. P., Gaidamovich, S. Y., Vyshemirsky, O. I., Zhukov, A. N., Lazorenko, V. V., Salko, V. N., Kovtunov, A. I., Galimzyanov, K. M., Platonov, A. E., Morozova, T. N., Khutoretskaya, N. V., Shishkina, E. O. & Skvortsova, T. M. (2000). Isolation of two strains of West Nile virus during an outbreak in southern Russia, 1999. Emerging Infectious Diseases 6, 373-376.[Medline]

McMinn, P. C., Lee, E., Hartley, S., Roehrig, J. T., Dalgarno, L. & Weir, R. C. (1995a). Murray Valley encephalitis virus envelope protein antigenic variants with altered hemagglutination properties and reduced neuroinvasiveness in mice. Virology 211, 10-20.[Medline]

McMinn, P. C., Marshall, I. D. & Dalgarno, L. (1995b). Neurovirulence and neuroinvasiveness of Murray Valley encephalitis virus mutants selected by passage in a monkey kidney cell line. Journal of General Virology 76, 865-872.[Abstract/Free Full Text]

Malinoski, F. J., Hasty, S. E., Ussery, M. A. & Dalrymple, J. M. (1990). Prophylactic ribavirin treatment of dengue type 1 infection in rhesus monkeys. Antiviral Research 13, 139-149.[Medline]

Mathur, A., Arora, K. L. & Chaturvedi, U. C. (1981). Congenital infection of mice with Japanese encephalitis virus. Infection and Immunity 34, 26-29.[Abstract/Free Full Text]

Matthews, V., Robertson, T., Kendrick, T., Abdo, M., Papadimitriou, J. & McMinn, P. (2000). Morphological features of Murray Valley encephalitis virus infection in the central nervous system of Swiss mice. International Journal of Experimental Pathology 81, 31-40.[Medline]

Mazlo, M. & Szanto, J. (1978). Morphological demonstration of the virus of tick-borne encephalitis in the human brain. Acta Neuropathologica (Berlin) 43, 251-253.[Medline]

Monath, T. P. & Heinz, F. X. (1996). Flaviviruses. In Fields Virology , pp. 961-1034. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Nash, D., Mostashari, F., Fine, A., Miller, J., O'Leary, D., Murray, K., Huang, A., Rosenberg, A., Greenberg, A., Sherman, M., Wong, S. & Layton, M. (2001). The outbreak of West Nile virus infection in the New York City area in 1999. New England Journal of Medicine 344, 1807-1814.[Abstract/Free Full Text]

Nichter, C. A., Pavlakis, S. G., Shaikh, U., Cherian, K. A., Dobrosyzcki, J., Porricolo, M. E. & Chatturvedi, I. (2000). Rhombencephalitis caused by West Nile fever virus. Neurology 55, 153.[Free Full Text]

Ogata, A., Nagashima, K., Hall, W. W., Ichikawa, M., Kimura-Kuroda, J. & Yasui, K. (1991). Japanese encephalitis virus neurotropism is dependent on the degree of neuronal maturity. Journal of Virology 65, 880-886.[Abstract/Free Full Text]

Sampson, B. A., Ambrosi, C., Charlot, A., Reiber, K., Verress, J. F. & Armbrustmacher, V. (2000). The pathology of human West Nile virus infection. Human Pathology 31, 527-531.[Medline]

Schlesinger, J. J., Chapman, S., Nestorowicz, A., Rice, C. M., Ginocchio, T. E. & Chambers, T. J. (1996). Replication of yellow fever virus in the mouse central nervous system: comparison of neuroadapted and non-neuroadapted virus and partial sequence analysis of the neuroadapted strain. Journal of General Virology 77, 1277-1285.[Abstract/Free Full Text]

Shieh, W. J., Guarner, J., Layton, M., Fine, A., Miller, J., Nash, D., Campbell, G. I., Roehrig, J. T., Gubler, D. J. & Zaki, S. R. (2000). The role of pathology in an investigation of an outbreak of West Nile encephalitis in New York, 1999. Emerging Infectious Diseases 6, 370-372.[Medline]

Siegel-Itzkovich, J. (2000). Twelve die of West Nile virus in Israel. British Medical Journal 321, 724.[Free Full Text]

Singh, B. & Postic, B. (1970). Enhanced resistance of mice to virulent Japanese B encephalitis virus following inactivated vaccine and poly I:C. Journal of Infectious Diseases 122, 339-342.[Medline]

Sumiyoshi, H., Tignor, G. H. & Shope, R. E. (1995). Characterization of a highly attenuated Japanese encephalitis virus generated from molecularly cloned cDNA. Journal of Infectious Diseases 171, 1144-1151.[Medline]

Wang, J. J., Liao, C. L., Yang, C. I., Lin, Y. L., Chiou, C. T. & Chen, L. K. (1998). Localizations of NS3 and E proteins in mouse brain infected with mutant strain of Japanese encephalitis virus. Archives of Virology 143, 2353-2369.[Medline]

Weiner, L. P., Cole, G. A. & Nathanson, N. (1970). Experimental encephalitis following peripheral inoculation of West Nile virus in mice of different ages. Journal of Hygiene (London) 68, 435-446.

Westaway, E. G. (1987). Flavivirus replication strategy. Advances in Virus Research 33, 45-90.[Medline]

Wittwer, C. T., Ririe, K. M., Andrew, R. V., David, D. A., Gundry, R. A. & Balis, U. J. (1997). The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. Biotechniques 22, 176-181.[Medline]

Worthington, M., Levy, H. & Rice, J. (1973). Late therapy of an arbovirus encephalitis in mice with interferon and interferon stimulators. Proceedings of the Society for Experimental Biology and Medicine 143, 638-643.[Medline]

Received 14 December 2001; accepted 10 March 2002.


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. M. P. Ribeiro, A. M. Paradiso, U. Schwab, J. Perez-Vilar, L. Jones, W. O'Neal, and R. C. Boucher
Chronic Airway Infection/Inflammation Induces a Ca2+i-dependent Hyperinflammatory Response in Human Cystic Fibrosis Airway Epithelia
J. Biol. Chem., May 6, 2005; 280(18): 17798 - 17806.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Leyssen, J. Balzarini, E. De Clercq, and J. Neyts
The Predominant Mechanism by Which Ribavirin Exerts Its Antiviral Activity In Vitro against Flaviviruses and Paramyxoviruses Is Mediated by Inhibition of IMP Dehydrogenase
J. Virol., February 1, 2005; 79(3): 1943 - 1947.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Charlier, R. Molenkamp, P. Leyssen, J. Paeshuyse, C. Drosten, M. Panning, E. De Clercq, P. J. Bredenbeek, and J. Neyts
Exchanging the Yellow Fever Virus Envelope Proteins with Modoc Virus prM and E Proteins Results in a Chimeric Virus That Is Neuroinvasive in SCID Mice
J. Virol., July 15, 2004; 78(14): 7418 - 7426.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
A. Schulz, K. Mellenthin, G. Schonian, B. Fleischer, and C. Drosten
Detection, Differentiation, and Quantitation of Pathogenic Leishmania Organisms by a Fluorescence Resonance Energy Transfer-Based Real-Time PCR Assay
J. Clin. Microbiol., April 1, 2003; 41(4): 1529 - 1535.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Charlier, P. Leyssen, C. W. A. Pleij, P. Lemey, F. Billoir, K. Van Laethem, A.-M. Vandamme, E. De Clercq, X. de Lamballerie, and J. Neyts
Complete genome sequence of Montana Myotis leukoencephalitis virus, phylogenetic analysis and comparative study of the 3' untranslated region of flaviviruses with no known vector
J. Gen. Virol., August 1, 2002; 83(8): 1875 - 1885.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.
Agricola
Right arrow Articles by Charlier, N.
Right arrow Articles by Neyts, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS