|
|
||||||||
Animal: RNA Viruses |
Immunology Division and Division of Molecular Virology, Jichi Medical School, Tochigi-Ken 329-0498, Japan1
Japanese Red Cross Saitama Blood Center, Saitama-Ken 338-0001, Japan2
Department of Gastroenterology, Jichi Medical School, Tochigi-Ken 329-0498, Japan3
Author for correspondence: Hiroaki Okamoto. Fax +81 285 44 1557. e-mail hokamoto{at}jichi.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The full genomic sequence of HEV was first published in 1991 for a strain from Burma (Tam et al., 1991
), which had greater than 93% nucleotide identity across the genome to additional isolates obtained from other Asian countries including China, India, Nepal and Pakistan (Aye et al., 1993
; Panda et al., 2000
; Gouvea et al., 1998
; Tsarev et al., 1992
; van Cuyck-Gandre et al., 2000
). In contrast, the Mexican isolate that was implicated in an outbreak that occurred in Mexico in 1986 is distinct from the Burmese variants and constitutes a second genotype (Huang et al., 1992
). Recently, a third group of HEVs has been identified in patients with acute hepatitis in the USA, Argentina, Austria, Italy, Greece, Spain and the UK (Schlauder et al., 1999
, 2000
; Zanetti et al., 1999
; Worm et al., 2000
; Pina et al., 2000
; Wang et al., 2001a
). Extensive diversity has also been reported among isolates from sporadic cases of HEV infection in China and Taiwan that are distinct from the original Chinese isolates and they constitute a fourth group (Wang et al., 1999
, 2000
; Hsieh et al., 1999
). Accordingly, HEV sequences have tentatively been classified into four major genetic groups (genotypes IIV) (Schlauder & Mushahwar, 2001
).
In Japan, hepatitis E is rarely reported and most, if not all, cases of hepatitis E observed thus far have been regarded as imported hepatitis. Recently, an HEV strain (JRA1) of genotype III was isolated from a Japanese patient with acute hepatitis of unknown aetiology who had never been abroad (Takahashi et al., 2001
). However, the extent of the genetic diversity of HEV in Japan remains to be elucidated. In the present study, we identified two distinct genotypes (III and IV) of HEV from a single Japanese patient with acute hepatitis who had not been abroad and characterized the HEV isolates molecularly and phylogenetically to understand better the genomic diversity and molecular epidemiology of HEV in non-endemic countries.
| Methods |
|---|
|
|
|---|
Subject.
|
Detection of HEV RNA in serum.
|
|
Type-specific quantification of HEV RNA.
Amplification of the full-length HE-JI4 genome.
Total RNAs extracted from the serum sample (500 µl) obtained at admission were subjected to RTPCR for amplification of a central 7 kb sequence of the HEV genome (HE-JI4), using primers whose sequences were derived from well-conserved regions of the reported human and swine HEV sequences, as well as from sequences obtained during the amplification procedure. The central portion of the HE-JI4 genome was divided into seven overlapping sections: nt 691270 (1202 nt), nt 10783073 (1996 nt), nt 30483830 (783 nt), nt 38245256 (1433 nt), nt 50085929 (922 nt), nt 59076327 (421 nt) and nt 63167073 (758 nt) (primer sequences excluded), and their sequences were determined separately.
The extreme 5' end sequence of HE-JI4 (nt 188) was determined by a modified rapid amplification of cDNA ends (RACE) technique called RNA ligase-mediated RACE (RLMRACE) with the First Choice RLMRACE kit (Ambion), as described previously (Okamoto et al., 2001
). Briefly, the extracted RNA was treated with calf intestinal phosphatase followed by tobacco acid pyrophosphatase, and was then ligated to an RNA adapter supplied in the kit. This was used as a template to synthesize cDNA with an HEV-specific antisense primer, HE035, and SuperScript II RNase H- reverse transcriptase. The cDNA was then amplified by nested PCR with TaKaRa Ex Taq and the following primers: two RNA adaptor primers supplied in the kit were used as forward primers and HE034 and HE033 were used as reverse primers in the first and second round, respectively.
Amplification of the extreme 3' end sequence [nt 70607171 excluding the poly(A) tail] was attempted by the RACE method with a 20-mer primer (#167: 5' CCGTCGACATCGATAATACG 3') representing part of a 41-mer oligonucleotide containing (T)15 [SSP-T: 5' AAGGATCCGTCGACATCGATAATACG(T)15 3'] and an HEV-specific sense primer (HE038) on cDNAs that had been reverse-transcribed from poly(A)+ RNAs with the 41-mer oligonucleotide with (T)15, according to the method described previously (Okamoto et al., 2000
).
Amplification of partial sequences of the HE-JI3 genome.
A part of the ORF1 sequence of the HE-JI3 genome was amplified by nested RTPCR using the primer pairs HE090 and HE094 in the first round and HE092 and HE121 (genotype III-specific) in the second round (Table 1
), as described above. The size of the amplification product from the first-round PCR was 567 bp and from the second-round PCR was 494 bp. Similarly, a part of the ORF2 sequence of the HE-JI3 genome was amplified by nested RTPCR with primer pairs HE044 and HE040 in the first round and HE111 and HE122 (both genotype III-specific) in the second round; they generated amplification products of 506 bp and 481 bp, respectively.
Cloning and sequence analysis of PCR products.
The amplification products were sequenced on both strands either directly or after cloning into pT7BlueT vector (Novagen), using the BigDye Terminator Cycle Sequencing Ready Reaction Kit on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems). Sequence analysis was performed using Genetyx-Mac version 10.1.6 (Software Development) and ODEN version 1.1.1 from the DNA Data Bank of Japan (DDBJ; National Institute of Genetics, Mishima, Japan) (Ina, 1994
). Sequences were aligned by CLUSTAL W (version 1.8) (Thompson et al., 1994
). Phylogenetic trees were constructed by the neighbour-joining method (Saitou & Nei, 1987
), based on the partial nucleotide sequences of the ORF1 and ORF2 regions, or the entire nucleotide sequence of the HEV genome. Bootstrap values were determined on 1000 resamplings of the data sets (Felsenstein, 1985
). The final tree was obtained using the TREEVIEW program (version 1.6.6) (Page, 1996
).
| Results |
|---|
|
|
|---|
Characterization of the entire HE-JI4 genome
To determine the full-genome nucleotide sequence of the predominant isolate (HE-JI4) from this patient, nine overlapping cDNA sequences covering the entire genome were amplified by conventional PCR or RACE and molecularly cloned. Each cDNA sequence was completely identical to the overlapping sequence(s) of neighbouring regions and had the higher identity with the respective partial sequence of a reported genotype IV isolate (T1) than those of genotype III isolates (US1, US2, swUS1, JRA1 and swJ570) (4·69·3% higher in the nine sequences compared), suggesting that these nine cDNA sequences were derived from the HE-JI4 type and not from the HE-JI3 type.
The HE-JI4 isolate had a genomic length of 7171 nt, excluding the poly(A) tract at the 3' terminus, and possessed three major ORFs similar to reported human and swine HEV isolates. ORF1, ORF2 and ORF3 had a coding capacity of 1684 amino acids (nt 265077), 671 amino acids (nt 50867098) and 114 amino acids (nt 51055446), respectively. Of interest is the fact that, as in the T1 isolate (Wang et al., 2000
), the HE-JI4 isolate had the insertion of a single nucleotide (U) at position 5090, which affected both ORF2 and ORF3 (Fig. 1a
). Assuming that translation starts from the first AUG codon in the ORF, the ORF2 of HE-JI4 starts nine nucleotides downstream of ORF1, whereas the ORF2 in all reported isolates of genotypes IIII begins 41 nucleotides downstream of ORF1. The first initiation codon of ORF3 in HE-JI4 is 28 nucleotides downstream of ORF1, contrasting with the ORF3 in reported isolates of genotypes IIII, which overlaps ORF1 by one nucleotide. Consequently, HE-JI4 has an additional 11 amino acids in the N terminus of the ORF2 protein and is comparable to the T1 isolate, which has an additional 14 codons in ORF2 (Fig. 1b
). The predicted size of the ORF3 of HE-JI4 is identical to that of the T1 isolate, but it is nine codons shorter than that of other reported isolates of genotypes IIII (Fig. 1c
). There is another in-frame AUG codon in the ORF2 and ORF3 of HE-JI4 downstream; if these in-frame AUG codons were used as the start codons, ORF2 and ORF3 would encode 660 and 112 amino acids, respectively.
|
Comparison of HE-JI3 and HE-JI4 genomes with known complete genomes
Comparison of the HE-JI4 genome against reported HEV genomes of genotypes IIV whose entire or nearly entire nucleotide sequence is known revealed that it is closest to an HEV strain (T1) of genotype IV, with identities of 83·5, 82·0, 87·6 and 95·3% in the nucleotide sequences of the full genome, ORF1, ORF2 and ORF3, respectively (Table 3
). The HE-JI4 isolate was only 73·374·9% similar to the human and swine HEV isolates of genotypes IIII. The phylogenetic tree constructed based on the full genomic sequence confirmed that HE-JI4 belongs to genotype IV and is nearest to T1 (Fig. 2
).
|
Comparison with partial ORF1 or ORF2 sequences of reported human and swine HEV isolates
The following partial ORF1 sequences of HEVs of genotype III have been reported: seven human HEV isolates from European countries (Austria, Italy, Greece, Spain and the UK) (Schlauder et al., 1999
; Worm et al., 2000
; Pina et al., 2000
; Wang et al., 2001a
), two human HEV isolates from Argentina (Schlauder et al., 2000
) and one swine HEV isolate from New Zealand (Garkavenko et al., 2001
). Phylogenetic analysis of the common 287 nucleotides within the 5'-terminal region of ORF1 indicated that the HE-JI3 isolate was nearest to US1 among all genotype III isolates whose entire or partial nucleotide sequence is known (Fig. 3a
). Partial ORF2 sequences of HEVs of genotype IV are available for 21 human HEV isolates in China (Wang et al., 2001b
) and eight human and three swine HEV isolates in Taiwan (Wu et al., 2000
). When the common 301 nt sequence of HE-JI4 was compared with that of the human and swine strains and the T1 isolate, the HE-JI4 isolate shared nucleotide identities of only 83·089·0%. The phylogenetic tree constructed based on the partial ORF2 sequence of 301 nt confirmed that HE-JI4 belonged to genotype IV and that it was clearly separate from known genotype IV isolates from China and Taiwan (Fig. 3b
). Recently, Arankalle et al. (2002)
reported 12 swine isolates of HEV of genotype IV in India, which shared only 81·384·3% identity with HE-JI4 in the partial ORF2 sequence of 241263 nucleotides, suggesting that HE-JI4 belongs to a new subgroup of genotype IV that is separate from other subgroups to which the Chinese, Taiwanese and Indian isolates are classifiable.
|
| Discussion |
|---|
|
|
|---|
The source of the two HEV variants in this Japanese patient is unclear. His wife and daughter who live with the patient were negative for anti-HEV, when tested 40 days after disease onset in the patient. Furthermore, the patient and his family members tested negative for antibodies to HAV, which is another water-borne hepatitis virus, and none of them had any history of travelling outside Japan. Therefore, the possibility of intrafamilial HEV transmission can be excluded. Since the patient had no history of blood transfusion, tattooing, or drug abuse by injection, transmission via a parenteral route can also be excluded. As the chef of a sushi shop, he used to eat raw fish and other uncooked seafood, which were caught in Japan or imported from many countries of the world, including China, Taiwan and the USA, where HEV of genotype III or IV circulates. In China, an HEV strain of genotype I is also prevalent and was the source of an epidemic HEV infection (Aye et al., 1993
; Bi et al., 1993
; Yin et al., 1993
). However, genotype I HEV was not detected in our patient. As indicated in Fig. 3(b)
, the HE-JI4 isolate obtained from our patient in the present study belonged to genotype IV, but was located on a new branch and was considered to be in a separate subgroup from those of all known genotype IV isolates from China and Taiwan. HE-JI4 shared less than 85% identity with the recently reported swine isolates from India (Arankalle et al., 2002
), indicating that HE-JI4 can be segregated to a separate subgroup from the Chinese, Taiwanese and Indian strains. Taken altogether, we would like to speculate that HE-JI4 is indigenous to Japan and that it was not imported from China, Taiwan or other countries through an unknown route.
In the USA, only genotype III HEVs from humans and pigs have been reported (Meng et al., 1997
; Schlauder et al., 1998
). Of interest is the fact that the HE-JI3 isolate that was obtained along with the HE-JI4 isolate from our patient in the current study was nearer to the US human and swine strains, with the highest nucleotide identity of 95% with the US1 isolate, than to a human isolate (JRA1) or swine isolate (swJ570) that are believed to be indigenous to Japan (Takahashi et al., 2001
; Okamoto et al., 2001
). This result indicates that HE-JI3 may be a US strain. However, the finding of mixed HEV infection of genotypes III and IV at admission in our patient seems to indicate that the infectious material was initially contaminated with both genotypes of HEV strains. Hence, it is tempting to speculate that the HE-JI3 strain was imported from the USA in the past and has then evolved and circulated in Japan, and that both the HE-JI4 of genotype IV and HE-JI3 of genotype III are now indigenous to Japan. To support this issue, large-scale studies on patients with acute hepatitis of unknown aetiology are needed in Japan.
Although our patient did not report contact with animals such as pigs or rats, evidence is accumulating that hepatitis E is zoonotic in non-endemic countries (Harrison, 1999
). In the USA and Taiwan, where hepatitis E is not endemic in humans, zoonotic spread of HEV is suspected, as the swine and human HEV isolates in each country belong to the same genotype and are closely related to each other (Meng et al., 1997
; Hsieh et al., 1999
) and cross-species infection has been documented (Meng et al., 1998
; Erker et al., 1999
). In contrast, in India, where hepatitis E is endemic in humans, the human HEV isolates belong to genotype I, whereas the swine isolates belong to genotype IV (Arankalle et al., 2002
). Potential zoonotic infection of HEV is also supported by several recent reports that veterinarians working with swine are at higher risk of HEV infection than are normal blood donors in the USA and other countries (Meng et al., 2002
), and that anti-HEV antibodies are highly prevalent in commercial swine populations in Canada, Australia and New Zealand (Yoo et al., 2001
; Chandler et al., 1999
; Garkavenko et al., 2001
). An HEV-like agent has been recovered from chickens with big liver and spleen disease in Australia or those with hepatitis-splenomegaly syndrome in the USA, but avian HEV is genetically related to, but clearly distinct from, known human and swine strains of HEV, displaying less than 60% nucleotide sequence identity (Payne et al., 1999
; Haqshenas et al., 2001
).
In Japan, only three strains of swine HEV of genotype III (swJ570, swJ681 and swJ791) have been isolated from 60- to 90-day-old farm pigs (Okamoto et al., 2001
). Swine HEV strains of the HE-JI3 type of genotype III and the HE-JI4 type of genotype IV have not been recovered from pigs in Japan thus far. Therefore, further epidemiological evidence is required to prove zoonosis of HEV from swine to humans, or vice versa, in Japan by means of isolation of completely identical strains from both humans and pigs.
The overall nucleotide sequence divergence among HEV isolates whose entire or nearly entire sequence is available was less than 27% and the amino acid sequence divergence of ORF1 was less than 20%. In particular, much of the variation in the nucleotide sequence of the HEV genome occurs in the third base of triplet codons, leading to a silent mutation. Similar to genotype III (Schlauder & Mushahwar, 2001
), genotype IV seems to represent a remarkably heterogeneous group of HEV isolates, with the percentage nucleotide divergence between the T1 and HE-JI4 isolates being 16·5% over the entire genome. If nucleotide divergence of 15% is considered as the criterion for subgroup classification, T1 and HE-JI4 may have the status of distinct subgroups. Such genotypic classification of HEV awaits additional studies and requires a decision by the International Committee on Taxonomy of Viruses (ICTV).
In conclusion, two distinct HEV strains of genotypes III and IV that may be indigenous to Japan were identified from a single patient with acute hepatitis in Japan, where clinical HEV infection is rare, but where polyphyletic HEV strains of genotypes III and IV co-circulate. Whether the difference in HEV genotype and coinfection of different genotypes affect the pathogenesis and outcome of HEV infection deserves further analysis.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Aye, T. T., Uchida, T., Ma, X., Lida, F., Shikata, T., Ichikawa, M., Rikihisa, T. & Win, K. M. (1993). Sequence and gene structure of hepatitis E virus isolated from Myanmar. Virus Genes 7, 95-110.[Medline]
Bi, S. L., Purdy, M. A., McCaustland, K. A., Margolis, H. S. & Bradley, D. W. (1993). The sequence of hepatitis E virus isolated directly from a single source during an outbreak in China. Virus Research 28, 233-247.[Medline]
Chandler, J. D., Riddell, M. A., Li, F., Love, R. J. & Anderson, D. A. (1999). Serological evidence for swine hepatitis E virus infection in Australian pig herds. Veterinary Microbiology 68, 95-105.[Medline]
Dawson, G. J., Chau, K. H., Cabal, C. M., Yarbough, P. O., Reyes, G. R. & Mushahwar, I. K. (1992). Solid-phase enzyme-linked immunosorbent assay for hepatitis E virus IgG and IgM antibodies utilizing recombinant antigens and synthetic peptides. Journal of Virological Methods 38, 175-186.[Medline]
Erker, J. C., Desai, S. M., Schlauder, G. G., Dawson, G. J. & Mushahwar, I. K. (1999). A hepatitis E virus variant from the United States: molecular characterization and transmission in cynomolgus macaques. Journal of General Virology 80, 681-690.[Abstract]
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Garkavenko, O., Obriadina, A., Meng, J., Anderson, D. A., Bernard, H. J., Schroeder, B. A., Khudyakov, Y. E., Fields, H. A. & Croxson, M. C. (2001). Detection and characterization of swine hepatitis E virus in New Zealand. Journal of Medical Virology 65, 525-529.[Medline]
Gouvea, V., Snellings, N., Popek, M. J., Longer, C. F. & Innis, B. L. (1998). Hepatitis E virus: complete genome sequence and phylogenetic analysis of a Nepali isolate. Virus Research 57, 21-26.[Medline]
Haqshenas, G., Shivaprasad, H. L., Woolcock, P. R., Read, D. H. & Meng, X. J. (2001). Genetic identification and characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly syndrome in the United States. Journal of General Virology 82, 2449-2462.
Harrison, T. J. (1999). Hepatitis E virus an update. Liver 19, 171-176.[Medline]
Herrera, J. L., Hill, S., Shaw, J., Fleenor, M., Bader, T. & Wolfe, M. S. (1993). Hepatitis E among US travelers, 19891992. Mortality and Morbidity Weekly Report 42, 1-4.
Hsieh, S.-Y., Meng, X.-J., Wu, Y.-H., Liu, S.-T., Tam, A. W., Lin, D.-Y. & Liaw, Y.-F. (1999). Identity of a novel swine hepatitis E virus in Taiwan forming a monophyletic group with Taiwan isolates of human hepatitis E virus. Journal of Clinical Microbiology 37, 3828-3834.
Huang, C.-C., Nguyen, D., Fernandez, J., Yun, K. Y., Fry, K. E., Bradley, D. W., Tam, A. W. & Reyes, G. R. (1992). Molecular cloning and sequencing of the Mexico isolate of hepatitis E virus (HEV). Virology 191, 550-558.[Medline]
Ina, Y. (1994). ODEN: a program package for molecular evolutionary analysis and database search of DNA and amino acid sequences. Computer Applications in the Biosciences 10, 11-12.
Kwo, P. Y., Schlauder, G. G., Carpenter, H. A., Murphy, P. J., Rosenblatt, J. E., Dawson, G. J., Mast, E. E., Krawczynski, K. & Balan, V. (1997). Acute hepatitis E by a new isolate acquired in the United States. Mayo Clinic Proceedings 72, 1133-1136.[Medline]
Li, T.-C., Yamakawa, Y., Suzuki, K., Tatsumi, M., Razak, M. A. A., Uchida, T., Takeda, N. & Miyamura, T. (1997). Expression and self-assembly of empty virus-like particles of hepatitis E virus. Journal of Virology 71, 7207-7213.[Abstract]
Meng, X.-J., Purcell, R. H., Haubur, P. G., Lehman, J. R., Webb, D. M., Tsareva, T. S., Haynes, J. S., Thacker, B. J. & Emerson, S. U. (1997). A novel virus in swine is closely related to the human hepatitis E virus. Proceedings of the National Academy of Sciences, USA 94, 9860-9865.
Meng, X.-J., Halbur, P. G., Shapiro, M. S., Govindarajan, S., Bruna, J. D., Mushahwar, I. K., Purcell, R. H. & Emerson, S. U. (1998). Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. Journal of Virology 72, 9714-9721.
Meng, X. J., Wiseman, B., Elvinger, F., Guenette, D. K., Toth, T. E., Engle, R. E., Emerson, S. U. & Purcell, R. H. (2002). Prevalence of antibodies to hepatitis E virus in veterinarians working with swine and in normal blood donors in the United States and other countries. Journal of Clinical Microbiology 40, 117-122.
Okamoto, H., Nishizawa, T., Tawara, A., Takahashi, M., Kishimoto, J., Sai, T. & Sugai, Y. (2000). TT virus mRNAs detected in the bone marrow cells from an infected individual. Biochemical and Biophysical Research Communications 279, 700-707.[Medline]
Okamoto, H., Takahashi, M., Nishizawa, T., Fukai, K., Muramatsu, U. & Yoshikawa, A. (2001). Analysis of the complete genome of indigenous swine hepatitis E virus isolated in Japan. Biochemical and Biophysical Research Communications 289, 929-936.[Medline]
Page, R. D. M. (1996). TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.
Panda, S. K., Ansari, I. H., Durgapal, H., Agrawal, S. & Jameel, S. (2000). The in vitro-synthesized RNA from a cDNA clone of hepatitis E virus is infectious. Journal of Virology 74, 2430-2437.
Payne, C. J., Ellis, T. M., Plant, S. L., Gregory, A. R. & Wilcox, G. E. (1999). Sequence data suggests big liver and spleen disease virus (BLSV) is genetically related to hepatitis E virus. Veterinary Microbiology 68, 119-125.[Medline]
Pina, S., Buti, M., Cotrina, M., Piella, J. & Girones, R. (2000). HEV identified in serum from humans with acute hepatitis and in sewage of animal origin in Spain. Journal of Hepatology 33, 826-833.[Medline]
Purcell, R. H. & Emerson, S. U. (2001). Hepatitis E virus. In Fields Virology , pp. 3051-3061. Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, M. A. Martin, R. A. Lamb, B. Roizman & S. E. Straus. Philadelphia:Lippincott Williams and Wilkins.
Reyes, G. R., Purdy, M. A., Kim, J. P., Luk, K. C., Young, L. M., Fry, K. E. & Bradley, D. W. (1990). Isolation of cDNA from the virus responsible for enterically transmitted non-A, non-B hepatitis. Science 247, 1336-1339.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]
Sato, S., Ido, K., Isoda, N., Hirasawa, T., Sato, A., Iino, S., Hozumi, M., Ono, K., Nagamine, N., Sugano, K., Okamoto, H. & Mayumi, M. (2002). A case of domestically infected acute hepatitis E. Acta Hepatologica Japonica (in press) (in Japanese).
Schlauder, G. G. & Mushahwar, I. K. (2001). Genetic heterogeneity of hepatitis E virus. Journal of Medical Virology 65, 282-292.[Medline]
Schlauder, G. G., Dawson, G. J., Erker, J. C., Kwo, P. Y., Knigge, M. F., Smalley, D. L., Rosenblatt, J. E., Desai, S. M. & Mushahwar, I. K. (1998). The sequence and phylogenetic analysis of a novel hepatitis E virus isolated from a patient with acute hepatitis reported in the United States. Journal of General Virology 79, 447-456.[Abstract]
Schlauder, G. G., Desai, S. M., Zanetti, A. R., Tassopoulos, N. C. & Mushahwar, I. K. (1999). Novel hepatitis E virus (HEV) isolates from Europe: evidence for additional genotypes of HEV. Journal of Medical Virology 57, 243-251.[Medline]
Schlauder, G. G., Frider, B., Sookoian, S., Castano, G. C. & Mushahwar, I. K. (2000). Identification of 2 novel isolates of hepatitis E virus in Argentina. Journal of Infectious Diseases 182, 294-297.[Medline]
Takahashi, K., Iwata, K., Watanabe, N., Hatahara, T., Ohta, Y., Baba, K. & Mishiro, S. (2001). Full-genome nucleotide sequence of a hepatitis E virus strain that may be indigenous to Japan. Virology 287, 9-12.[Medline]
Tam, A. W., Smith, M. M., Guerra, M. E., Huang, C., Bradley, D. W., Fry, K. E. & Reyes, G. R. (1991). Hepatitis E virus (HEV): molecular cloning and sequence of the full-length viral genome. Virology 185, 120-130.[Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Tsarev, S. A., Emerson, S. U., Reyes, G. R., Tsareva, T. S., Legters, L. J., Malik, I. A., Iqbal, M. & Purcell, R. H. (1992). Characterization of a prototype strain of hepatitis E virus. Proceedings of the National Academy of Sciences, USA 89, 559-563.
van Cuyck-Gandre, H., Zhang, H. Y., Tsarev, S. A., Warren, R. L., Caudill, J. D., Snellings, N. J., Begot, L., Innis, B. L. & Longer, C. F. (2000). Phylogenetically distinct hepatitis E viruses in Pakistan. American Journal of Tropical Medicine and Hygiene 62, 187-189.[Abstract]
Wang, Y., Ling, R., Erker, J. C., Zhang, H., Li, H., Desai, S., Mushahwar, I. K. & Harrison, T. J. (1999). A divergent genotype of hepatitis E virus in Chinese patients with acute hepatitis. Journal of General Virology 80, 169-177.[Abstract]
Wang, Y., Zhang, H., Ling, R., Li, H. & Harrison, T. J. (2000). The complete sequence of hepatitis E virus genotype 4 reveals an alternative strategy for translation of open reading frames 2 and 3. Journal of General Virology 81, 1675-1686.
Wang, Y., Levine, D. F., Bendall, R. P., Teo, C. G. & Harrison, T. J. (2001a). Partial sequence analysis of indigenous hepatitis E virus isolated in the United Kingdom. Journal of Medical Virology 65, 706-709.[Medline]
Wang, Y., Zhang, H., Li, Z., Gu, W., Lan, H., Hao, W., Ling, R., Li, H. & Harrison, T. J. (2001b). Detection of sporadic cases of hepatitis E virus (HEV) infection in China using immunoassays based on recombinant open reading frame 2 and 3 polypeptides from HEV genotype 4. Journal of Clinical Microbiology 39, 4370-4379.
Worm, H. C., Schlauder, G. G., Wurzer, H. & Mushahwar, I. K. (2000). Identification of a novel variant of hepatitis E virus in Austria: sequence, phylogenetic and serological analysis. Journal of General Virology 81, 2885-2890.
Wu, J. C., Chen, C. M., Chiang, T. Y., Sheen, I. J., Chen, J. Y., Tasi, W. H., Huang, Y. H. & Lee, S. D. (2000). Clinical and epidemiological implications of swine hepatitis E virus infection. Journal of Medical Virology 60, 166-171.[Medline]
Yin, S., Tsarev, S. A., Purcell, R. H. & Emerson, S. U. (1993). Partial sequence comparison of eight new Chinese strains of hepatitis E virus suggests the genome sequence is relatively stable. Journal of Medical Virology 41, 230-241.[Medline]
Yoo, D., Willson, P., Pei, Y., Hayes, M. A., Deckert, A., Dewey, C. E., Friendship, R. M., Yoon, Y., Gottschalk, M., Yason, C. & Giulivi, A. (2001). Prevalence of hepatitis E virus antibodies in Canadian swine herds and identification of a novel variant of swine hepatitis E virus. Clinical and Diagnostic Laboratory Immunology 8, 1213-1219.
Zanetti, A. R., Schlauder, G. G., Romano, L., Tanzi, E., Fabris, P., Dawson, G. J. & Mushahwar, I. K. (1999). Identification of a novel variant of hepatitis E virus in Italy. Journal of Medical Virology 57, 356-360.[Medline]
Received 6 March 2002;
accepted 25 March 2002.
This article has been cited by other articles:
![]() |
H. van Cuyck, J. Fan, D. L. Robertson, and P. Roques Evidence of Recombination between Divergent Hepatitis E Viruses J. Virol., July 15, 2005; 79(14): 9306 - 9314. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takahashi, S. Kusakai, H. Mizuo, K. Suzuki, K. Fujimura, K. Masuko, Y. Sugai, T. Aikawa, T. Nishizawa, and H. Okamoto Simultaneous Detection of Immunoglobulin A (IgA) and IgM Antibodies against Hepatitis E Virus (HEV) Is Highly Specific for Diagnosis of Acute HEV Infection J. Clin. Microbiol., January 1, 2005; 43(1): 49 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Huang, Z. F. Sun, S. U. Emerson, R. H. Purcell, H. L. Shivaprasad, F. W. Pierson, T. E. Toth, and X. J. Meng Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV J. Gen. Virol., June 1, 2004; 85(6): 1609 - 1618. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. T. Maila, S. M. Bowyer, and R. Swanepoel Identification of a new strain of hepatitis E virus from an outbreak in Namibia in 1995 J. Gen. Virol., January 1, 2004; 85(1): 89 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yazaki, H. Mizuo, M. Takahashi, T. Nishizawa, N. Sasaki, Y. Gotanda, and H. Okamoto Sporadic acute or fulminant hepatitis E in Hokkaido, Japan, may be food-borne, as suggested by the presence of hepatitis E virus in pig liver as food J. Gen. Virol., September 1, 2003; 84(9): 2351 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Kho, W. S. Tan, B. T. Tey, and K. Yusoff Newcastle disease virus nucleocapsid protein: self-assembly and length-determination domains J. Gen. Virol., August 1, 2003; 84(8): 2163 - 2168. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nishizawa, M. Takahashi, H. Mizuo, H. Miyajima, Y. Gotanda, and H. Okamoto Characterization of Japanese swine and human hepatitis E virus isolates of genotype IV with 99 % identity over the entire genome J. Gen. Virol., May 1, 2003; 84(5): 1245 - 1251. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takahashi, T. Nishizawa, H. Miyajima, Y. Gotanda, T. Iita, F. Tsuda, and H. Okamoto Swine hepatitis E virus strains in Japan form four phylogenetic clusters comparable with those of Japanese isolates of human hepatitis E virus J. Gen. Virol., April 1, 2003; 84(4): 851 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tokita, H. Harada, Y. Gotanda, M. Takahashi, T. Nishizawa, and H. Okamoto Molecular and serological characterization of sporadic acute hepatitis E in a Japanese patient infected with a genotype III hepatitis E virus in 1993 J. Gen. Virol., January 1, 2003; 84(2): 421 - 427. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||