J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schumacher, D.
Right arrow Articles by Osterrieder, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schumacher, D.
Right arrow Articles by Osterrieder, N.
Agricola
Right arrow Articles by Schumacher, D.
Right arrow Articles by Osterrieder, N.
Journal of General Virology (2002), 83, 1987-1992.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Generation of a permanent cell line that supports efficient growth of Marek's disease virus (MDV) by constitutive expression of MDV glycoprotein E

Daniel Schumacher1, B. Karsten Tischer1, Jens-Peter Teifke2, Kerstin Wink1 and Nikolaus Osterrieder1

Institute of Molecular Biology1 and Infectology2, Friedrich-Loeffler Institutes, Federal Research Centre for Virus Diseases of Animals, Boddenblick 5a, D-17498 Insel Riems, Germany

Author for correspondence: Nikolaus Osterrieder. Fax +49 38351 7151. e-mail klaus.osterrieder{at}rie.bfav.de


   Abstract
TOP
Abstract
Main text
References
 
A recombinant cell line (SOgE) was established, which was derived from the permanent quail muscle cell line QM7 and constitutively expressed the glycoprotein E (gE) gene of Marek's disease virus serotype 1 (MDV-1). The SOgE cell line supported growth of virulent (RB-1B) and vaccine (CVI988, 584Ap80C) MDV-1 strains at a level comparable with that of primary chicken embryo cells (CEC). The SOgE cell line was used to produce a vaccine against Marek's disease. Chickens were immunized at 1 day old with 103 p.f.u. CVI988 produced on either CEC or SOgE cells. Challenge infection was performed at day 12 with hypervirulent Italian MDV-1 strain EU1. Whereas 7/7 or 6/6 animals, respectively, immunized with SOgE or QM7 cells alone developed Marek's disease, only 1/8 animals from both CVI988-immunized groups exhibited signs of disease, suggesting that SOgE cells are a valuable permanent cell culture system for MDV-1 vaccine production.


   Main text
TOP
Abstract
Main text
References
 
Marek’s disease virus (MDV), an alphaherpesvirus, occurs worldwide and induces Marek's disease, which is characterized by T cell lymphomas, polyneuritis, immunosuppression and atherosclerosis (Calnek et al., 1983Down ; Calnek, 2001Down ). Three MDV serotypes have been identified, of which only serotype 1 (MDV-1) is pathogenic; serotype 2 (MDV-2) and serotype 3 (herpesvirus of turkeys, HVT) do not cause disease.

MD can be controlled by immunization, but MDV strains have a tendency towards increased virulence despite vaccination, and so-called virulent (v), very virulent (vv) and very virulent plus (vv+) strains have evolved with time (Benton & Cover, 1957Down ; Schat et al., 1982Down ; Witter, 1983Down , 1997Down ). The appearance of vv+ MDV-1 has led to the introduction in the United States of the CVI988/Rispens vaccine, which has been used in Europe since the 1970s (Rispens et al., 1972aDown , bDown ; Witter, 1992Down ; Witter et al., 1995Down ). The cell culture of choice for propagation of MDV strains and production of vaccines, which include all three MDV serotypes, is chicken embryo cells (CEC) (Witter, 2001Down ). For isolation of virulent strains and virus isolates that are not cell culture-adapted, primary chicken kidney cells (CKC) or duck embryo cells (DEF) can be used (Biggs, 2001Down ). Permanent cell lines for MDV propagation have been described; however, long periods of virus adaptation to the cell culture system used were necessary. With the CHCC-OU2 cell line, a permanent cell line derived from CEC, 4 weeks of culture were needed before MDV-1-specific plaques were visible. The resulting CEC cell lines OU2.1 and OU2.2 contain a latent form of virulent MDV as long as the cells are not confluent. This latent virus is reactivated as soon as cell-to-cell contacts are formed (Abujoub & Coussens, 1995Down , 1997Down ). CHCC-OU2 cells have also been used for production of cell lines containing vaccine strains of all three MDV serotypes. Recently, adaptation of MDV strains to the continuous Vero cell line after several rounds of passaging has been described (Jaikumar et al., 2001Down ).

In this communication, the generation of a permanent recombinant cell line is described, which supports efficient growth of both virulent and vaccine MDV strains. The cell line by itself was not tumorigenic and vaccine virus produced on this cell line was able to protect conventional chickens as efficiently as a standard vaccine produced on CEC.

Quail muscle QM7 cells (ATCC, CRL-1632) were grown on six-well plates and transfected with 10 µg of recombinant plasmid pcMgE, which contains the glycoprotein E (gE) open reading frame of the MDV-1 vaccine strain CVI988 under the control of the human cytomegalovirus immediate-early promoter (Brunovskis & Velicer, 1995Down ; Schumacher et al., 2001Down ). Transfected cells were propagated in Dulbecco's minimal essential medium (DMEM) containing 10% foetal calf serum and 1 mg/ml G-418 (Gibco BRL). A cell clone in which virtually every cell expressed gE was identified by indirect immunofluorescence (IIF) and termed SOgE (Fig. 1ADown). The presence of gE DNA in SOgE but not in QM7 cells was confirmed by PCR analysis (Fig. 1BDown).



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1. (A) Detection of gE expression in SOgE cells by IIF using a rabbit polyclonal gE-specific antiserum (Schumacher et al., 2001Down ). Cells were grown on glass coverslips and fixed with 90% acetone 48 h after seeding, then stained and analysed using a Nikon fluorescence microscope (Schumacher et al., 2000Down ). Whereas reactivity of SOgE cells with the antibody was readily detected, no reactivity of the gE-specific serum with QM7 cells was observed. The individual views are 1000x650 µm in size. (B) Analysis of SOgE and QM7 cells by PCR (Saiki et al., 1986Down ). SOgE cells were left uninfected or were infected with MDV-1 strains 584Ap80C, CVI988 or RB-1B. Whereas gE-specific sequences were detected in all infected and uninfected SOgE cells, a gB-specific amplification product was obtained in infected cells only. In QM7 cells neither gB nor gE was detectable. The sizes of the amplification products are given. The gE open reading frame was amplified using 100 pmol each of forward (5' CATAAGCATGCGAGTCAGCGTCATAATGTG 3') and reverse (5' CAAGGGCCCATCAGTGGTATA AATCTAAGC 3') primer. The PCR assay targeting the gB gene was carried out with 100 pmol each of forward (5' GCATATCAGCCTGTTCTATC 3') and reverse (5' AACCAATGGTCGGCTATAAC 3') primer. In both protocols, the respective primers (Lee et al., 2000Down ; Tulman et al., 2000Down ) were mixed with DNA and 35 cycles (95 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s) were run. The specificity of PCR products was confirmed by Southern blotting using digoxigenin-labelled gB or gE sequences as probes (Schumacher et al., 2000Down , 2001Down ) (right-hand panels). Preparation of probes and chemiluminescent detection using CSPD (Roche Biochemicals) were carried out according to the manufacturer's instructions.

 
The question of whether the MDV-1 gE produced by the generated cell line was functional or not was addressed by growing a gE-negative MDV-1 strain (20{Delta}gE), derived from the parental BAC20 virus (Schumacher et al., 2001Down ), on SOgE cells, since gE is essential for MDV-1 growth (Schumacher et al., 2001Down ). 20{Delta}gE DNA or BAC20 DNA was transfected into SOgE or QM7 cells. Whereas 20{Delta}gE plaque formation was readily observed on SOgE cells by IIF with mAb 2K11, which is specific for MDV glycoprotein B (gB), only single infected cells could be visualized on QM7 cells (Fig. 2ADown). These results confirmed that functional gE was produced by SOgE cells, since it efficiently trans-complemented the absence of gE in the 20{Delta}gE virus.



View larger version (88K):
[in this window]
[in a new window]
 
Fig. 2. (A) Growth of gE-negative 20{Delta}gE virus and BAC20 virus on gE-expressing SOgE cells or QM7 cells. After transfection of 20{Delta}gE or BAC20 DNA (Schumacher et al., 2000Down , 2001Down ) into the respective cells, 20{Delta}gE plaque formation was clearly visible from day 3 after transfection on SOgE but not on QM7 cells. In QM7 cells, only single infected cells were observed for 20{Delta}gE virus. BAC20 virus caused very small plaques on QM7 cells but large plaques on recombinant SOgE cells. Both viruses were detected by IIF using anti-gB mAb 2K11. The individual views are 1000x650 µm in size (lower panels) or 300x200 µm in size (upper panels). (B) Plaques of MDV-1 strains 584Ap80C, CVI988 and RB-1B on CEC and SOgE cells. Plaque formation induced by the vaccine strains 584Ap80C and CVI988 and the virulent RB-1B strain were readily observed after plating on SOgE cells. Virus plaque formation on CEC cells was also observed for these three virus strains. The plaques shown were fixed at day 4 after infection of 106 cells with 100 p.f.u. of the indicated viruses. The individual views are 1500x1000 µm in size.

 
The size of 20{Delta}gE plaques on SOgE cells appeared much larger than those of BAC20 virus on QM7 cells (Fig. 2AUp) (Schumacher et al., 2000Down , 2001Down ). This observation was addressed in further experiments. Plaque sizes of the avirulent MDV-1 strains 584Ap80C (Witter, 1997Down ) and CVI988 (MarekVac forte, Lohmann, Cuxhaven, Germany), as well as the virulent RB-1B strain (Schat et al., 1982Down ), were assessed on CEC, QM7 and SOgE cells. Co-seeding of SOgE cells with CEC infected with 584Ap80C, CVI988 or RB-1B at a low m.o.i. of 0·0001 led to MDV-specific plaques (Fig. 1BUp and Fig. 2BUp). The plaque sizes were comparable with those on CEC (Fig. 2BUp). In addition, it was possible to directly reconstitute infectious MDV-1 on SOgE cells by transfection of Escherichia coli-derived cloned viral DNA (Schumacher et al., 2000Down ) and viral DNA derived from infected cells in the case of CVI988 and RB-1B (data not shown). Thus, direct adaptation of several MDV-1 strains to SOgE cells without lengthy cell culture passaging was possible.

Production of MD vaccines could be facilitated using a permanent cell line allowing propagation of MDV-1 vaccine strains. Therefore, CVI988 DNA was transfected into CEC, QM7 or SOgE cells. Six days after transfection, cells were harvested and 103 infected cells were co-seeded with 107 uninfected cells of the matching cell type. Five days post-infection (p.i.), infected cells were trypsinized and titrated on freshly prepared cells. Four days after titration, the numbers of virus plaques were determined by IIF. It could be shown that mean CVI988 titres on SOgE cells reached 1·8x106 p.f.u./107 cells whereas titres of only 5·2x102 p.f.u./107 cells were obtained on QM7 cells. The titres on SOgE cells were virtually identical to those on primary CEC. From the results of the plaque size determinations and the titration experiments, we concluded that propagation of MDV strains on SOgE cells was as effective as or even superior to propagation on primary CEC.

SOgE cells were derived from a chemically induced quail tumour, which raised the remote possibility that it may cause neoplasia after systemic application of whole cell preparations. To address this important issue, 12 conventional White Leghorn chickens (Lohmann Tierzucht) were inoculated at 1 day old with either SOgE cells (six chickens) or parental QM7 cells (six chickens). Each individual chicken simultaneously received 106 cells by the intramuscular and 106 cells by the intra-abdominal route. The fate of the inoculated chickens was followed for 12 weeks, after which post-mortem examination was performed. None of the chickens exhibited any clinical sign during the course of the experiment. All chickens appeared in a good nutritional state and without any sign of tumour formation at the post-mortem examination. From these results, we concluded that SOgE and parental QM7 cells do not cause tumours in chickens, even when approximately 1000-fold more cells compared with a vaccine dose are administered.

The protective capacity of the vaccine strain CVI988 propagated on SOgE cells compared with that produced on CEC was analysed by injecting 106 SOgE (seven chickens) or QM7 cells (six chickens), or 103 p.f.u. CVI988 produced on either SOgE cells (eight chickens) or CEC (eight chickens) into 1-day-old chickens. Vaccine virus was produced after transfection of CVI988 DNA isolated from CEC into SOgE cells or CEC. Transfected cells were co-seeded with fresh uninfected cells and vaccine virus was harvested on day 5 p.i. Immunized birds were challenge-infected with hypervirulent MDV-1 strain EU1 on day 12 after immunization. Strain EU1 was isolated from a vaccinated flock in Italy exhibiting lethal MD in 1992 (F. Fehler and others, unpublished). The results of the experiment are summarized in Fig. 3(A)Down. In mock-immunized animals (QM7 cells), chickens showed signs of MD starting at day 7 p.i., and one bird died on each of days 9 and 10. By day 37 p.i., all birds had died as a consequence of the infection. In SOgE-immunized animals, three birds survived until termination of the experiment on day 65 p.i. The three surviving birds, however, exhibited MD as evidenced by a gross pathology examination and detection of tumours in inner organs. In stark contrast, chickens immunized with CVI988 produced on either SOgE cells or CEC did not suffer from MD until the termination of the experiment, but in one bird in each of these two groups, signs of MD were identified by gross pathology. Serological anti-MDV-1 responses in immunized and challenged birds were followed by an MDV-specific ELISA (Fig. 3BDown). It could be demonstrated that protected birds exhibited antibody titres that gradually rose with time after challenge infection, whereas chickens inoculated with SOgE or QM7 cells did not develop high antibody titres (Fig. 3BDown). We concluded that the CVI988 vaccine produced on permanent SOgE cells provided as good a protection as CVI988 produced conventionally on CEC. Protection against MD was coincident with gradually rising antibody titres, suggesting that a permanent boost of the chicken immune system by either lytically replicating vaccine virus or low level replication of EU1 is a prerequisite for protection against MD.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. (A) Survival curves of chickens infected with hypervirulent MDV-1 strain EU1. Animals were immunized with SOgE cells, QM7 cells, or CVI988 produced on SOgE cells or CEC, and challenge-infected 12 days after immunization. The plot shows percentages of surviving chickens from the day of EU1 challenge for a total of 65 days. Deceased birds were examined by gross pathology to confirm MD. Surviving birds at day 65 after EU1 challenge infection were also examined by gross pathology for signs of MD. Chickens exhibiting signs of MD on the day of termination of the experiment are incorporated within this graph (death occurred on day 70). (B) MDV-1-specific titres of chickens immunized with CVI988 produced on recombinant SOgE cells or on CEC. Immunization was carried out on day -12, and day 0 indicates the day of challenge infection with hypervirulent MDV-1 strain EU1. The levels of MDV-1-specific antibodies in the plasma were determined by ELISA. The antigen consisted of a lysate of 5x107 BAC20-infected CEC harvested 5 days after infection by freeze-thawing. The lysate (5 ml in PBS) was sonicated for 60 s at 60 W and cell debris was removed by centrifugation (10,000 g, 10 min, 4 °C). A lysate of 5x107 uninfected CEC was used as the negative control. Plasma ELISA titres of MDV-1-specific antibodies were determined after bleeding of all birds of each group on the indicated days. Plasma samples of two or three birds per group were pooled. Titres are expressed as the dilution in which the A450 after reaction with MDV-1-infected cell lysates exceeded that of uninfected cell lysates by three standard deviations (Osterrieder et al., 1995Down ).

 
The results presented in this study describe the generation of a permanent cell line, which supports growth of several MDV strains. The MDV-1 gE-expressing cell line was derived from the quail muscle cell line QM7. The in vitro cultivation of MDV-1 is still enormously laborious and difficult to standardize, because primary cell cultures are used, which have to be prepared continuously from embryonated eggs or even hatched birds in the case of CKC. The propagation of MDV-1 strains on permanent cell lines has therefore been the focus of considerable endeavour, and the generation of cell lines persistently infected with MDV has been reported. CHCC-OU2 cells, permanent derivatives of CEC, have been latently infected with selected MDV strains. The switch from latent to lytic infection was induced as soon as close cell-to-cell contacts within the cultures were made. It must be noted, however, that adaptation of viruses to the CHCC-OU2 cells took up to 4 weeks, in which changes in the genetic and antigenic composition of the viruses could occur (Abujoub & Coussens, 1995Down , 1997Down ). Recently, the continuous Vero cell line was tested for its susceptibility to MDV growth, and after 3 weeks of adaptation, very low titres of MDV-1 and HVT were produced (Jaikumar et al., 2001Down ). Using the permanent SOgE cell line, no adaptation of virulent or vaccine MDV strains was necessary, and in passage level 1, growth of the vaccine virus CVI988 was already comparable with that on CEC. In addition, the virulent RB-1B could be readily propagated on these permanent recombinant gE-expressing SOgE cells. The efficient growth of a variety of MDV-1 and also HVT strains on SOgE cells (D. Schumacher & N. Osterrieder, unpublished) have indicated that this system could be extremely useful for diagnostic and vaccine production purposes. It is worthwhile noting that immunization with SOgE cells alone appeared to have some effect on the time elapsing until development of clinical MD, which may indicate that gE is an important target in a protective anti-MDV immune response.

The plaque sizes and virus titres obtained on SOgE cells exceeded that of the parental QM7 cells by 1000-fold. These results reflect the crucial function of MDV-1 gE in cell-to-cell spread, and indicate that the presence of large amounts of gE, which may not be complexed with gI as is the case in MDV-1-infected CEC, serves as a ‘transporter' of MDV-1 infectivity from an infected to an uninfected cell. It is important to note that MDV-1 devoid of gE is unable to spread in CEC or QM7 cells (Schumacher et al., 2001Down ). Future work will concentrate on the mechanism of MDV-1 cell-to-cell spread and the functions of the individual membrane and tegument proteins involved in this process. Cell-to-cell spread appears to be regulated and performed differently in MDV-1 and possibly varicella zoster virus when compared with other Alphaherpesvirinae, because all four proteins forming the membrane protein heterodimers gE/gI and gM/UL49.5 are essential in the case of MDV-1 (Schumacher et al., 2001Down , Tischer et al., 2002Down ). In addition, the tegument component VP22, which may interact with either the gE and/or gM cytoplasmic tails, is also essential for MDV-1 (Dorange et al., 2002Down ; Mettenleiter, 2002Down ).

In summary, the permanent SOgE cell line exhibits unique features inasmuch as it provides the possibility for use as a permanent production system for MDV replication and may be a useful tool for experiments leading to the elucidation of the mechanisms underlying cell-to-cell spread in strictly cell-associated Alphaherpesvirinae.


   Acknowledgments
 
We thank Jean-Francois Vautherot (INRA, Nouzilly, France) for supplying anti-MDV-1 mAbs, and Dr Richard Witter (ADOL, East Lansing, MI, USA) and Dr Fred T. Davison (IAH, Compton, UK) for providing the 584Ap80C and RB-1B viruses. This study was supported by the Commission of the European Union (Grant QLK2-CT-1999-00601).


   References
TOP
Abstract
Main text
References
 
Abujoub, A. & Coussens, P. M. (1995). Development of a sustainable chick cell line infected with Marek's disease virus. Virology 214, 541-549.[Medline]

Abujoub, A. A. & Coussens, P. M. (1997). Evidence that Marek's disease virus exists in a latent state in a sustainable fibroblast cell line. Virology 229, 309-321.[Medline]

Benton, W. J. & M. S. Cover (1957). The increased incidence of visceral lymphomatosis in broiler and replacement birds. Avian Disease 320–327.

Biggs, P. M. (2001). The history and biology of Marek’s Disease Virus. In Marek’s Disease , pp. 1-25. Edited by H. Kanji. Berlin, Heidelberg & New York:Springer-Verlag.

Brunovskis, P. & Velicer, L. F. (1995). The Marek's disease virus (MDV) unique short region: alphaherpesvirus-homologous, fowlpox virus-homologous, and MDV-specific genes. Virology 206, 324-338.[Medline]

Calnek, B. W. (2001). Pathogenesis of Marek's disease virus infection. In Marek’s Disease , pp. 25-55. Edited by H. Kanji. Berlin, Heidelberg & New York:Springer-Verlag.

Calnek, B. W., Schat, K. A., Peckham, M. C. & Fabricant, J. (1983). Field trials with a bivalent vaccine (HVT and SB-1) against Marek's disease. Avian Disease 27, 844-849.[Medline]

Dorange, F., Tischer, B. K., Vautherot, J. F. & Osterrieder, N. (2002). Characterization of Marek's disease virus serotype 1 (MDV-1) deletion mutants that lack UL46 to UL49 genes: MDV-1 UL49, encoding VP22, is indispensable for virus growth. Journal of Virology 76, 1959-1970.[Abstract/Free Full Text]

Jaikumar, D., Read, K. M. & Tannock, G. A. (2001). Adaptation of Marek's disease virus to the Vero continuous cell line. Veterinary Microbiology 79, 75-82.[Medline]

Lee, L. F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H. J. & Witter, R. L. (2000). The complete unique long sequence and the overall genomic organization of the GA strain of Marek's disease virus. Proceedings of the National Academy of Sciences, USA 97, 6091-6096.[Abstract/Free Full Text]

Mettenleiter, T. C. (2002). Herpesvirus assembly and egress. Journal of Virology 76, 1537-1547.[Free Full Text]

Morgan, R. W., Cantello, J. L. & McDermott, C. H. (1990). Transfection of chicken embryo fibroblasts with Marek's disease virus DNA. Avian Disease 34, 345-351.[Medline]

Osterrieder, N., Wagner, R., Brandmüller, C., Schmidt, P., Wolf, H. & Kaaden, O. R. (1995). Protection against EHV-1 challenge infection in the murine model after vaccination with various formulations of recombinant glycoprotein gp14 (gB). Virology 208, 500-510.[Medline]

Rispens, B. H., van Vloten, H., Mastenbroek, N., Maas, H. J. & Schat, K. A. (1972a). Control of Marek's disease in the Netherlands. I. Isolation of an avirulent Marek's disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Disease 16, 108-125.[Medline]

Rispens, B. H., van Vloten, H., Mastenbroek, N., Maas, J. L. & Schat, K. A. (1972b). Control of Marek's disease in the Netherlands. II. Field trials on vaccination with an avirulent strain (CVI 988) of Marek's disease virus. Avian Disease 16, 126-138.[Medline]

Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1986). Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature 324, 163-166.[Medline]

Schat, K. A., Calnek, B. W. & Fabricant, J. (1982). Characterisation of two highly oncogenic strains of Marek's disease virus. Avian Pathology, 593–605.

Schumacher, D., Tischer, B. K., Fuchs, W. & Osterrieder, N. (2000). Reconstitution of Marek's disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome and characterization of a glycoprotein B-negative MDV-1 mutant. Journal of Virology 74, 11088-11098.[Abstract/Free Full Text]

Schumacher, D., Tischer, B. K., Reddy, S. M. & Osterrieder, N. (2001). Glycoproteins E and I of Marek's disease virus serotype 1 are essential for virus growth in cultured cells. Journal of Virology 75, 11307-11318.[Abstract/Free Full Text]

Tischer, B. K., Schumacher, D., Messerle, M., Wagner, M. & Osterrieder, N. (2002). The products of the UL10 (gM) and the UL49.5 genes of Marek's Disease Virus serotype 1 (MDV-1) are essential for virus growth in cultured cells. Journal of General Virology 83, 997-1003.[Abstract/Free Full Text]

Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Rock, D. L. & Kutish, G. F. (2000). The genome of a very virulent Marek's disease virus. Journal of Virology 74, 7980-7988.[Abstract/Free Full Text]

Witter, R. L. (1983). Characteristics of Marek's disease viruses isolated from vaccinated commercial chicken flocks: association of viral pathotype with lymphoma frequency. Avian Disease 27, 113-132.[Medline]

Witter, R. L. (1992). Safety and comparative efficacy of the CVI988/Rispens vaccine strain. World's Poultry Science Association, Amsterdam 315–319.

Witter, R. L. (1997). Increased virulence of Marek's disease virus field isolates. Avian Disease 41, 149-163.[Medline]

Witter, R. L. (2001). Protective efficacy of Marek's disease vaccines. In Marek's Disease , pp. 57-90. Edited by K. Hirai. Berlin, Heidelberg & New York:Springer-Verlag.

Witter, R. L., Lee, L. F. & Fadly, A. M. (1995). Characteristics of CVI988/Rispens and R2/23, two prototype vaccine strains of serotype 1 Marek's disease virus. Avian Disease 39, 269-284.[Medline]

Received 31 January 2002; accepted 15 March 2002.


This article has been cited by other articles:


Home page
J. Virol.Home page
B. K. Tischer, D. Schumacher, D. Chabanne-Vautherot, V. Zelnik, J.-F. Vautherot, and N. Osterrieder
High-Level Expression of Marek's Disease Virus Glycoprotein C Is Detrimental to Virus Growth In Vitro
J. Virol., May 15, 2005; 79(10): 5889 - 5899.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. C. Burgess, J. R. Young, B. J. G. Baaten, L. Hunt, L. N. J. Ross, M. S. Parcells, P. M. Kumar, C. A. Tregaskes, L. F. Lee, and T. F. Davison
Marek's disease is a natural model for lymphomas overexpressing Hodgkin's disease antigen (CD30)
PNAS, September 21, 2004; 101(38): 13879 - 13884.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Petherbridge, K. Howes, S. J. Baigent, M. A. Sacco, S. Evans, N. Osterrieder, and V. Nair
Replication-Competent Bacterial Artificial Chromosomes of Marek's Disease Virus: Novel Tools for Generation of Molecularly Defined Herpesvirus Vaccines
J. Virol., August 15, 2003; 77(16): 8712 - 8718.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
H. Hennig, N. Osterrieder, M. Muller-Steinhardt, H.-M. Teichert, H. Kirchner, and K.-P. Wandinger
Detection of Marek's Disease Virus DNA in Chicken but Not in Human Plasma
J. Clin. Microbiol., June 1, 2003; 41(6): 2428 - 2432.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. K. Tischer, D. Schumacher, M. Beer, J. Beyer, J. P. Teifke, K. Osterrieder, K. Wink, V. Zelnik, F. Fehler, and N. Osterrieder
A DNA vaccine containing an infectious Marek's disease virus genome can confer protection against tumorigenic Marek's disease in chickens
J. Gen. Virol., October 1, 2002; 83(10): 2367 - 2376.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schumacher, D.
Right arrow Articles by Osterrieder, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schumacher, D.
Right arrow Articles by Osterrieder, N.
Agricola
Right arrow Articles by Schumacher, D.
Right arrow Articles by Osterrieder, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS