|
|
||||||||
Animal: DNA Viruses |
Department of Clinical Chemistry and Transfusion Medicine, Sahlgrenska University Hospital, Göteborg University, S-413 45 Gothenburg, Sweden1
Microbiology and Tumor Biology Center, Karolinska Institute, S-171 77 Stockholm, Sweden2
Cellular and Molecular Tumor Pathology, Cancer Centrum Karolinska, CCK R8:04, Karolinska Hospital, S-171 76 Stockholm, Sweden3
Author for correspondence: Lars Rymo. Fax +46 31 828458. e-mail lars.rymo{at}clinchem.gu.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
EBNA1-specific initiation of transcription in the restricted pattern of EBV gene expression in latency I B cells and NPC cells was for some time thought to occur at Fp, the promoter in the BamHI F fragment of the EBV genome (Nonkwelo et al., 1995
; Sample et al., 1991
; Schaefer et al., 1991
), but more recent data strongly suggest that the dominant EBNA1 gene promoter is Qp, located about 200 bp downstream of Fp in the BamHI Q region (Schaefer et al., 1995b
; Tsai et al., 1995
; Zetterberg et al., 1999
). Fp is now considered an early lytic promoter (Schaefer et al., 1995a
). A small proportion (12%) of Fp-initiated lytic transcripts is spliced to the EBNA1-encoding K exon (Zetterberg et al., 1999
). However, the majority of Fp-initiated transcripts are not spliced to this exon, at least not at the regular EBNA1 splice acceptor in BamHI K (Schaefer et al., 1995a
; Zetterberg et al., 1999
). The gene product of these transcripts has not been identified.
The regulation of Fp has been the subject of several investigations during the period when Fp was considered a latent EBNA1-specific promoter. Fp was reported to be repressed by binding of EBNA1 to sequences in BamHI Q and to be highly dependent on BamHI Q sequences resembling binding sites for the cellular transcription factors E2F-1 and leader binding protein-1 (Nonkwelo et al., 1995
; Sung et al., 1994
). However, the measured promoter activity in these experiments most likely arose from Qp. Using a reporter construct that only contained a 146 bp fragment of Fp without sequences from BamHI Q, Bulfone-Paus et al. (1995)
identified three positive promoter-proximal cis-acting elements critical for Fp regulation: one Sp1 site and two tandem LR1 sites (Fig. 1
). In earlier work, Lear et al. (1992)
showed that Fp was upregulated following the switch from latent into lytic cycle, and raised the possibility that ZEBRA, by an unknown mechanism, could upregulate Fp. In the present investigation we corroborate that Fp is a lytic promoter and show that ZEBRA activates transcription from Fp by binding to a promoter-proximal AP-1-like site.
|
| Methods |
|---|
|
|
|---|
Plasmid constructions.
F1), XhoIBamHI (
F2), Eco52IBamHI (
F3), NarIBamHI (
F4) and MluIBamHI (
F5) subfragments of the BamHI F fragment of the EBV genome were cloned in the HindIII site of pSVECAT (obtained from M. Yaniv, Institute Pasteur, Paris) replacing the SV40 early control region. The plasmids were named p
F1CAT, p
F2CAT, p
F3CAT, p
F4CAT and p
F5CAT, respectively (Fig. 1
F5CAT as the template. The 5' primer contained the natural NheI site at position -59 relative to the Fp transcription initiation site and the desired AP-1 mutation (TGACTAA to CAGTCGG, at positions -52 to -46). The 3' primer was specific for a sequence in the CAT gene. The amplified fragment was cleaved with NheI and BamHI and ligated to a SalINheI fragment of p
F5CAT. The resulting fragment was cloned into a SalIBamHI digested CAT vector, yielding the p
F5mutCAT plasmid. The expression vector for ZEBRA was kindly provided by G. Miller (Yale University School of Medicine).
Cell lines and induction of virus lytic cycle.
The cell lines used in this study and their phenotypic characteristics are listed in Table 1
. All cell lines were propagated in RPMI 1640 (Life Technologies) supplemented with 10% foetal bovine serum (Life Technologies), penicillin and streptomycin. Induction of the virus lytic cycle in Rael and Mutu gr I was performed by the addition of 5-azacytidine (Sigma) to a concentration of 5 µM (Masucci et al., 1989
). Induction of the virus lytic cycle in Rael was also performed by transfection of 5x106 cells with 10 µg of ZEBRA expression plasmid by electroporation, as described below. Induction of the virus lytic cycle in Akata was performed by the addition of anti-IgG antibodies (DAKO) to a concentration of 0·2% (Takada & Ono, 1989
). Induction of the lytic cycle was confirmed by direct immunofluorescence using a monoclonal anti-ZEBRA antibody (M7005; DAKO).
|
Transient transfections and CAT assay.
F5CAT reporter plasmid and either 10 µg of expression vector for ZEBRA (37 pmol) or 8·7 µg of parent empty vector (37 pmol). Cells were harvested 3 days after transfection. Cell extracts were prepared and analysed for CAT activity as previously described (Ricksten et al., 1988
RNA analysis.
Cytoplasmic RNA was prepared by a standard procedure (Sambrook et al., 1989
). Transcription initiated at Fp in the endogenous EBV genome was determined by S1 mapping using a single-stranded oligonucleotide corresponding to nucleotides 6222162253 of the L strand of B95-8 EBV DNA: 5' GATCCCCCTCCTCTCTATCCACCGCCGCCCCGG 3'. A non-homologous tail of four nucleotides was added at the 3' end of the oligonucleotide to distinguish incomplete digestion of the probe by transcripts initiated further upstream. 32P-end-labelled probe (150 fmol) was annealed for 1216 h at 37 °C with 100 µg of cytoplasmic RNA in 40 mM PIPES, pH 6·4, 1 mM EDTA, 0·4 mM NaCl and 50% formamide in a total volume of 20 µl. The hybridization mixture was treated with 750 U/ml of S1 nuclease for 45 min at 37 °C. Protected fragments were fractionated by electrophoresis in a denaturing 12% polyacrylamide gel. The expected size of a fragment protected by RNA initiated at the Fp transcription start site 62239 is 15 nucleotides.
Electrophoretic mobility shift assay (EMSA).
For preparation of ZEBRA-containing nuclear extracts, 40 aliquots, each consisting of 107 DG75 cells, were transfected with 10 µg of ZEBRA expression plasmid by electroporation as described above. Nuclear extracts were prepared 3 days after transfection, essentially as described by Dignam et al. (1983)
, except that antipain (5 µg/ml), leupeptin (5 µg/ml) and aprotinin (2 µg/ml) were added to the buffer in the final homogenization and dialysis steps and PMSF was replaced with Pefabloc (0·5 mM). ZEBRA expression was verified by SDSPAGE and immunoblotting using a monoclonal anti-ZEBRA antibody (M7005; DAKO). Aliquots were frozen in liquid nitrogen and stored at -80 °C. A double-stranded, blunt-ended, synthetic oligonucleotide containing the sequence between positions 62179 and 62202 in the EBV genome, (-60/-37)Fp, was used as the probe in the EMSAs. In competition experiments, the following double-stranded consensus oligonucleotides were used: (i) AP-1 consensus: 5' CGCTTGATGACTCAGCCGGAA 3'; and (ii) sequence identical to the probe, except that the AP-1-like site was transversely mutated (AP-1 mut): 5' GGCTAGCCCAGTCGGGGGTGAGGC 3' (mutated sequence underlined). Non-specific competitor was an unrelated DNA sequence. One strand of the oligonucleotide probe was labelled with [
-32P]ATP (6000 Ci/mmol, NEN Life Science Products) using polynucleotide kinase (Boehringer Mannheim) and annealed to the complementary strand. The labelled probe was purified by electrophoresis in an 8% polyacrylamide gel in TBE (0·1 M Tris, 0·1 M boric acid, 2 mM EDTA, pH 8·3). The wet gel was autoradiographed and the DNA fragment was excised, electroeluted by isotachophoresis (Öfverstedt et al., 1984
) and precipitated. Binding reactions were carried out in a volume of 30 µl containing 10 mM TrisHCl, pH 7·5, 50 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA, 5% glycerol, 1 µg poly(dIdC), 5 fmol labelled probe (approximately 70000 c.p.m.) and 5 µg of crude nuclear extracts from ZEBRA-transfected DG75. In competition experiments, 3 pmol of unlabelled oligonucleotides were added into the reaction mixture. After incubation at room temperature for 30 min, the samples were loaded on a 6% polyacrylamide gel (acrylamide:bisacrylamide 29:1) in TGE (25 mM TrisHCl, 0·19 M glycine, 1 mM EDTA, pH 8·3). After electrophoresis gels were dried and autoradiographed. The supershift experiments were performed as described above for the EMSAs except that 210 µl of the respective antibody was added after the incubation at room temperature. A second incubation was carried out at 4 °C for 2 h before the samples were loaded on the gel. Antibodies used for supershift experiments were anti-ZEBRA (M7005; DAKO), anti-Sp1 (sc-59X; Santa Cruz Biotechnology Inc.) and anti-c-Jun (sc-822X; Santa Cruz Biotechnology Inc.).
| Results |
|---|
|
|
|---|
F3CAT, p
F4CAT and p
F5CAT plasmids, which contain intermediate or large fragments of Fp, induced expression of CAT only at very low or background levels in all examined cell lines. However, when sequences upstream of -136 (p
F1CAT and p
F2CAT) were deleted, Fp induced significant CAT expression in latency I B cells as well as in the EBV-negative cell lines, indicating the presence of a negative regulatory cis-element in the deleted upstream sequences. Invariably, the activity of the short Fp fragments was high in latency I B cells and EBV-negative cells and below detection level in latency III B cells. The very low activity of p
F1CAT and p
F2CAT in latency III cells suggests that they may be regulated by transcription factors expressed in a cell-phenotype-dependent manner. Nevertheless, the main finding was the low or undetectable Fp activity in reporter plasmids carrying intermediate or large Fp fragments (p
F3CAT, p
F4CAT and p
F5CAT), confirming that Fp is inactive in EBV-positive cell lines in latent stages of infection and in EBV-negative cell lines.
Fp activity in endogenous virus genomes
To answer the question of whether Fp activity could be detected in the endogenous virus genome and upregulated on induction of the virus lytic cycle, S1 protection analysis was performed. An end-labelled oligonucleotide containing the Fp transcription initiation site at position 62239 was used as the probe (Fig. 2
). Fp-initiated transcripts were only detected in the B95-8 cell line, which contains a significant proportion of spontaneously lytic subpopulations, and in cell lines in which the virus lytic cycle had been induced (Rael ZEBRA, Rael 5azaC, Mutu gr I 5azaC and Akata Ig), corroborating the identity of Fp as an exclusively lytic promoter.
|
F5CAT contained four AP-1-like sites (Fig. 1
F5CAT or p
F5mutCAT, in which the AP-1-like site in the -52/-46 Fp region was mutated, together with a ZEBRA expression plasmid (Fig. 3
F5mutCAT plasmid. The binding of ZEBRA to the AP-1-like site at the -52/-46 Fp position was investigated by EMSA and antibody supershift analysis using a probe corresponding to the -60/-37 Fp region and nuclear extracts from ZEBRA-transfected DG75 cells (Fig. 4
|
|
| Discussion |
|---|
|
|
|---|
Previous studies of regulatory elements in Fp should be carefully interpreted, since they were undertaken during a period when Fp was considered an EBNA1-specific promoter in latency I and II cells. More recent data have demonstrated that EBNA1-specific initiation of transcription in restricted latency stages arises from the downstream Q promoter (Schaefer et al., 1995b
; Tsai et al., 1995
; Zetterberg et al., 1999
). Fp was reported to be regulated by sequences in BamHI Q (Nonkwelo et al., 1995
; Sung et al., 1994
). However, the measured promoter activity in these studies most likely arose from Qp. Bulfone-Paus et al. (1995)
investigated a short Fp fragment (146 bp, resembling our p
F2CAT construct) that spanned the Fp TATA box without BamHI Q sequences. In concordance with our data, their results indicated a remarkably high activity from this short promoter fragment in EBV-positive and -negative B lymphoid cells. They identified three positive cis-acting elements: one Sp1 site and two tandem LR1 sites (Fig. 1
). The activity of the short Fp fragments in our experiments (p
F1CAT and p
F2CAT) was high in latency I B cells and EBV-negative cells and below detection level in latency III B cells, suggesting that the promoter fragments may be regulated by viral or cellular transcription factors expressed in a cell-phenotype-dependent manner. Since there are no such differences between latency I and III B cells with regard to Sp1 and LR1, we suggest that viral proteins or other cellular factors may contribute to the differential regulation. For example, latency I cells may contain additional activating factors not identified in this study, or express higher levels of activating factors, whereas latency III cells may contain a repressor(s). The significance of the differential regulation is, however, unclear since the full-length Fp, which presumably is biologically more relevant, behaves in the same manner irrespective of the original latency type, i.e. is repressed in latent cells and upregulated on induction of the virus lytic cycle. Interestingly, there was a significant activity of the short Fp fragments in the epithelial HeLa cell line, which should not contain the B cell-specific transcription factor LR1 (Bulfone-Paus et al., 1995
). Since Sp1 usually functions together with other transcription factors (Ryu et al., 1999
), it will most likely collaborate with other factors in this cell type (Bulfone-Paus et al., 1995
). The promoter-proximal AP-1-like site in the -52/-46 Fp region overlaps one of the LR1 sites (Fig. 1
). However, Bulfone-Paus et al. (1995)
ruled out a functional role for AP-1 by binding experiments and by comparing reporter gene expression in cells cultured with and without phorbol 12-myristate 13-acetate. Taken together, it seems that Sp1 and LR1, presumably together with additional factors, activate the short Fp fragments in latency I cells and EBV-negative cells and that this activity is downregulated by a repressor element(s) upstream of -136. It should be noted that two other research groups have employed p
F2CAT-like reporter plasmids for studying Fp activity and measured a low promoter activity (Schaefer et al., 1995a
; Sung et al., 1994
). In both studies the Fp transcription start site was assigned to nucleotide 62229 in the EBV-genome, 10 bp upstream of the transcription start site defined by Bulfone-Paus et al. (1995)
. In our study we detected multiple initiations between positions 62232 and 62239. The consequence of this is that the p
F2CAT-like construct used by Sung et al. (1994) did not include the major Fp transcription start sites, explaining the low promoter activity in their experiments. The construct used by Schaefer et al. (1995a)
was identical to p
F2CAT, except that it contained the luciferase reporter gene instead of CAT. Thus, there is no obvious explanation for our differing results regarding this specific question. Nevertheless, the main finding of the transient transfection experiments performed in our study was that reporter plasmids carrying larger fragments of Fp (p
F3CAT, p
F4CAT and p
F5CAT) were inactive in all examined cell lines, corroborating that Fp is silent in cells that are not induced to undergo the virus lytic cycle.
Since Fp was silent in strictly latent cells, both in endogenous genomes and in reporter plasmids carrying large fragments of the Fp regulatory region, we asked if Fp activity could be upregulated by induction of the virus lytic cycle. We have shown that endogenous Fp activity was induced by treatment of EBV-infected cells with known activators of lytic virus replication, confirming previous investigations (Lear et al., 1992
; Schaefer et al., 1995a
; Zetterberg et al., 1999
). Moreover, the silent p
F5CAT was activated in DG75 cells in the absence of other virus proteins when co-transfected with a ZEBRA expression plasmid. The induction depended on the promoter-proximal AP-1-like site, since p
F5mutCAT was only expressed at background levels in spite of the presence of ZEBRA. Notably, the AP-1 mutation introduced in the p
F5mutCAT plasmid changed three bp in the promoter-proximal LR1 site (11 bp). However, the substitutions did not significantly reduce the basal activity of Fp in DG75 cells when introduced in p
F2CAT (data not shown). This finding also supports the conclusion drawn by Bulfone-Paus et al. (1995)
that AP-1 is not involved in the regulation of Fp. Moreover, the substitutions did not alter the nucleotides essential for LR1 binding (Dempsey et al., 1998
). EMSA and supershift experiments identified ZEBRA as a component of one of the proteinDNA complexes detected with an oligonucleotide that spanned the -60/-37 Fp region and nuclear extracts from ZEBRA-transfected DG75 cells. We identified one additional band representing protein binding to the AP-1-like site. The intensity of the band was reproducibly slightly reduced by incubation with antibodies against ZEBRA and Sp1. There is no Sp1 binding site in the -60/-37 Fp region. We could not detect the band with nuclear extracts from untransfected DG75 (data not shown). Either the reduced intensity is an unspecific phenomenon, or it might be a result of an interaction between ZEBRA and Sp1. Such an interaction has not yet been described in the literature. In conclusion, we have identified one additional ZEBRA-responsive element in the EBV genome. There are three more AP-1-like sites in the upstream regulatory region of Fp. Conceivably, these are also involved in ZEBRA-induced transactivation of Fp and initiation of the EBV lytic cascade.
A major question remains: what is the 3' end exon of the Fp-initiated transcripts? In a previous investigation of relative levels of EBNA1 gene transcripts in latent and lytic stages of infection, we demonstrated that only 12% of Fp-initiated transcripts in cells induced to virus lytic cycle splice from the U exon to the EBNA1-encoding K exon (FpQ/U/K splicing pattern) (Zetterberg et al., 1999
). The large majority of the Fp-initiated transcripts displayed an FpQ (5275% of Fp-initiated transcripts) or FpQ/U (2447%) splicing pattern. Furthermore, we identified a BamHI K-containing lytic cycle-specific transcript, which extends upstream of the BamHI f/K cleavage site. It is possible that there is a relationship between the Fp-initiated transcripts with presently unidentified 3' end exon(s) and the lytic cycle-specific BamHI K-containing mRNA, which may give rise to EBNA1. In a study of the transregulatory effects of ZEBRA on different classes of EBV promoters, Kenney et al. (1989)
showed that ZEBRA downregulates Cp and Wp. In spite of the downregulation of latent promoters, EBNA1 is not repressed on induction of the virus lytic cycle (Rowe et al., 1992
; Weigel et al., 1985
). These data suggest that EBNA1 gene transcription in the lytic cycle may be driven by a lytic cycle-specific transcription unit, possibly initiated at Fp, which could compensate for the repression of the latent EBNA1 gene promoters. EBNA1 is known to bind to oriP sequences and enhance nuclear import of oriP-containing plasmids in transient transfection experiments, most probably through its strong nuclear localization signal (Längle-Rouault et al., 1998
). It is tempting to speculate that EBNA1 may serve an important function in the virus lytic cycle through binding to oriP in the genomes of newly packaged virions and facilitate the nuclear import of virus genomes on infection of resting B cells.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C. and others (1984). DNA sequence and expression of the B95-8 EpsteinBarr virus genome. Nature 310, 207211.[Medline]
Biggin, M., Bodescot, M., Perricaudet, M. & Farrell, P. (1987). EpsteinBarr virus gene expression in P3HR1-superinfected Raji cells. Journal of Virology 61, 3120-3132.
Bodescot, M., Perricaudet, M. & Farrell, P. J. (1987). A promoter for the highly spliced EBNA family of RNAs of EpsteinBarr virus. Journal of Virology 61, 3424-3430.
Bulfone-Paus, S., Dempsey, L. A. & Maizels, N. (1995). Host factors LR1 and Sp1 regulate the Fp promoter of EpsteinBarr virus. Proceedings of the National Academy of Sciences, USA 92, 8293-8297.
Countryman, J. & Miller, G. (1985). Activation of expression of latent EpsteinBarr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proceedings of the National Academy of Sciences, USA 82, 4085-4089.
Dempsey, L. A., Hanakahi, L. A. & Maizels, N. (1998). A specific isoform of hnRNP D interacts with DNA in the LR1 heterodimer: canonical RNA binding motifs in a sequence-specific duplex DNA binding protein. Journal of Biological Chemistry 273, 29224-29229.
Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Research 11, 1475-1489.
Farrell, P. J., Rowe, D. T., Rooney, C. M. & Kouzarides, T. (1989). EpsteinBarr virus BZLF1 trans-activator specifically binds to a consensus AP-1 site and is related to c-fos. EMBO Journal 8, 127-132.[Medline]
Flemington, E. K., Goldfeld, A. E. & Speck, S. H. (1991). Efficient transcription of the EpsteinBarr virus immediate-early BZLF1 and BRLF1 genes requires protein synthesis. Journal of Virology 65, 7073-7077.
Greenspan, J. S., Greenspan, D., Lennette, E. T., Abrams, D. I., Conant, M. A., Petersen, V. & Freese, U. K. (1985). Replication of EpsteinBarr virus within the epithelial cells of oral hairy leukoplakia, an AIDS-associated lesion. New England Journal of Medicine 313, 1564-1571.[Abstract]
Hardwick, J. M., Lieberman, P. M. & Hayward, S. D. (1988). A new EpsteinBarr virus transactivator, R, induces expression of a cytoplasmic early antigen. Journal of Virology 62, 2274-2284.
Hudson, G. S., Farrell, P. J. & Barrell, B. G. (1985). Two related but differentially expressed potential membrane proteins encoded by the EcoRI Dhet region of EpsteinBarr virus B95-8. Journal of Virology 53, 528-535.
Hunter, T. & Karin, M. (1992). The regulation of transcription by phosphorylation. Cell 70, 375-387.[Medline]
Ikuta, K., Satoh, Y., Hoshikawa, Y. & Sairenji, T. (2000). Detection of EpsteinBarr virus in salivas and throat washings in healthy adults and children. Microbes and Infection 2, 115-120.[Medline]
Kenney, S., Kamine, J., Holley-Guthrie, E., Lin, J. C., Mar, E. C. & Pagano, J. (1989). The EpsteinBarr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. Journal of Virology 63, 1729-1736.
Kieff, E. & Rickinson, A. B. (2001). EpsteinBarr virus and its replication. In Fields Virology , pp. 2511-2574. Edited by D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Längle-Rouault, F., Patzel, V., Benavente, A., Taillez, M., Silvestre, N., Bompard, A., Sczakiel, G., Jacobs, E. & Rittner, K. (1998). Up to 100-fold increase of apparent gene expression in the presence of EpsteinBarr virus oriP sequences and EBNA1: implications of the nuclear import of plasmids. Journal of Virology 72, 6181-6185.
Lear, A. L., Rowe, M., Kurilla, M. G., Lee, S., Henderson, S., Kieff, E. & Rickinson, A. B. (1992). The EpsteinBarr virus (EBV) nuclear antigen 1 BamHI F promoter is activated on entry of EBV-transformed B cells into the lytic cycle. Journal of Virology 66, 7461-7468.
Masucci, M. G., Contreras-Salazar, B., Ragnar, E., Falk, K., Minarovits, J., Ernberg, I. & Klein, G. (1989). 5-Azacytidine up regulates the expression of EpsteinBarr virus nuclear antigen 2 (EBNA-2) through EBNA-6 and latent membrane protein in the Burkitt's lymphoma line rael. Journal of Virology 63, 3135-3141.
Miyashita, E. M., Yang, B., Lam, K. M., Crawford, D. H. & Thorley-Lawson, D. A. (1995). A novel form of EpsteinBarr virus latency in normal B cells in vivo. Cell 80, 593-601.[Medline]
Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of EpsteinBarr virus persistence in vivo as a resting B cell. Journal of Virology 71, 4882-4891.[Abstract]
Nonkwelo, C., Henson, E. B. & Sample, J. (1995). Characterization of the EpsteinBarr virus Fp promoter. Virology 206, 183-195.[Medline]
Öfverstedt, L. G., Hammarström, K., Balgobin, N., Hjerten, S., Pettersson, U. & Chattopadhyaya, J. (1984). Rapid and quantitative recovery of DNA fragments from gels by displacement electrophoresis (isotachophoresis). Biochimica et Biophysica Acta 782, 120-126.[Medline]
Potter, H., Weir, L. & Leder, P. (1984). Enhancer-dependent expression of human kappa immunoglobulin genes introduced into mouse pre-B lymphocytes by electroporation. Proceedings of the National Academy of Sciences, USA 81, 7161-7165.
Rickinson, A. B. & Kieff, E. (2001). EpsteinBarr virus. In Fields Virology , pp. 2575-2627. Edited by D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Ricksten, A., Olsson, A., Andersson, T. & Rymo, L. (1988). The 5' flanking region of the gene for the EpsteinBarr virus-encoded nuclear antigen 2 contains a cell type specific cis-acting regulatory element that activates transcription in transfected B-cells. Nucleic Acids Research 16, 8391-8410.
Rooney, C. M., Rowe, D. T., Ragot, T. & Farrell, P. J. (1989). The spliced BZLF1 gene of EpsteinBarr virus (EBV) transactivates an early EBV promoter and induces the virus productive cycle. Journal of Virology 63, 3109-3116.
Rowe, M., Lear, A. L., Croom-Carter, D., Davies, A. H. & Rickinson, A. B. (1992). Three pathways of EpsteinBarr virus gene activation from EBNA1-positive latency in B lymphocytes. Journal of Virology 66, 122-131.
Ryu, S., Zhou, S., Ladurner, A. G. & Tjian, R. (1999). The transcriptional cofactor complex CRSP is required for activity of the enhancer-binding protein Sp1. Nature 397, 446-450.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Extraction and purification of RNA. In Molecular Cloning, a Laboratory Manual, 2nd edn, pp. 7.127.15. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sample, J., Brooks, L., Sample, C., Young, L., Rowe, M., Gregory, C., Rickinson, A. & Kieff, E. (1991). Restricted EpsteinBarr virus protein expression in Burkitt lymphoma is due to a different EpsteinBarr nuclear antigen 1 transcriptional initiation site. Proceedings of the National Academy of Sciences, USA 88, 6343-6347.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463-5467.
Schaefer, B. C., Woisetschlaeger, M., Strominger, J. L. & Speck, S. H. (1991). Exclusive expression of EpsteinBarr virus nuclear antigen 1 in Burkitt lymphoma arises from a third promoter, distinct from the promoters used in latently infected lymphocytes. Proceedings of the National Academy of Sciences, USA 88, 6550-6554.
Schaefer, B. C., Strominger, J. L. & Speck, S. H. (1995a). The EpsteinBarr virus BamHI F promoter is an early lytic promoter: lack of correlation with EBNA 1 gene transcription in group 1 Burkitt's lymphoma cell lines. Journal of Virology 69, 5039-5047.[Abstract]
Schaefer, B. C., Strominger, J. L. & Speck, S. H. (1995b). Redefining the EpsteinBarr virus-encoded nuclear antigen EBNA-1 gene promoter and transcription initiation site in group I Burkitt lymphoma cell lines. Proceedings of the National Academy of Sciences, USA 92, 10565-10569.
Speck, S. H., Chatila, T. & Flemington, E. (1997). Reactivation of EpsteinBarr virus: regulation and function of the BZLF1 gene. Trends in Microbiology 5, 399-405.[Medline]
Sung, N. S., Wilson, J., Davenport, M., Sista, N. D. & Pagano, J. S. (1994). Reciprocal regulation of the EpsteinBarr virus BamHI-F promoter by EBNA-1 and an E2F transcription factor. Molecular and Cellular Biology 14, 7144-7152.
Takada, K. & Ono, Y. (1989). Synchronous and sequential activation of latently infected EpsteinBarr virus genomes. Journal of Virology 63, 445-449.
Taylor, N., Flemington, E., Kolman, J. L., Baumann, R. P., Speck, S. H. & Miller, G. (1991). ZEBRA and a FosGCN4 chimeric protein differ in their DNA-binding specificities for sites in the EpsteinBarr virus BZLF1 promoter. Journal of Virology 65, 4033-4041.
Thorley-Lawson, D. A., Miyashita, E. M. & Khan, G. (1996). EpsteinBarr virus and the B cell: that's all it takes. Trends in Microbiology 4, 204-208.[Medline]
Tsai, C. N., Liu, S. T. & Chang, Y. S. (1995). Identification of a novel promoter located within the BamHI Q region of the EpsteinBarr virus genome for the EBNA 1 gene. DNA and Cell Biology 14, 767-776.[Medline]
Weigel, R., Fischer, D. K., Heston, L. & Miller, G. (1985). Constitutive expression of EpsteinBarr virus-encoded RNAs and nuclear antigen during latency and after induction of EpsteinBarr virus replication. Journal of Virology 53, 254-259.
Wingender, E., Chen, X., Hehl, R., Karas, H., Liebich, I., Matys, V., Meinhardt, T., Pruss, M., Reuter, I. & Schacherer, F. (2000). TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Research 28, 316-319.
Zetterberg, H., Stenglein, M., Jansson, A., Ricksten, A. & Rymo, L. (1999). Relative levels of EBNA1 gene transcripts from the C/W, F and Q promoters in EpsteinBarr virus-transformed lymphoid cells in latent and lytic stages of infection. Journal of General Virology 80, 457-466.[Abstract]
Received 29 January 2002;
accepted 25 March 2002.
This article has been cited by other articles:
![]() |
C.-C. Lu, C.-W. Wu, S. C. Chang, T.-Y. Chen, C.-R. Hu, M.-Y. Yeh, J.-Y. Chen, and M.-R. Chen Epstein-Barr virus nuclear antigen 1 is a DNA-binding protein with strong RNA-binding activity J. Gen. Virol., October 1, 2004; 85(10): 2755 - 2765. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |