|
|
||||||||
Animal: DNA Viruses |
Institut für Virologie, Philipps-Universität Marburg, Robert Koch Str. 17, 35037 Marburg, Germany1
Author for correspondence: Matthias Dobbelstein. Fax +49 6421 28 68962. e-mail dobbelst{at}mailer.uni-marburg.de
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Adenovirus and simian virus 40 (SV40) mediate the malignant transformation of cells and induce tumours in animals. The mechanisms underlying this phenomenon have been studied for decades, establishing many of the principles relevant to molecular tumourigenesis (Shenk, 1996
). Understanding how tumour viruses induce and maintain malignancy has frequently elucidated virus and non-virus carcinogenesis in general. Recently, the investigation of virus-mediated transformation was intensified by the observation that human primary cells can be transformed by a limited set of overexpressed genes, i.e. the telomerase catalytic subunit, oncogenic Ras and SV40 large tumour (T) antigen. These oncogenes were found to be sufficient to transform human fibroblasts (Hahn et al., 1999
) and human mammary epithelial cells (Elenbaas et al., 2001
). While these studies may reveal a limited set of oncogenic changes needed for human carcinogenesis, the usefulness of the system depends on a full understanding of the effects caused by the continuous expression of the SV40 T antigen.
The Ad E1 region encodes the E1A proteins, which share common domains, and two entirely distinct E1B proteins, namely the E1B 55 kDa protein (E1B 55K) and the E1B 19 kDa protein (E1B 19K). These three protein entities co-operate to transform primary cells. Ad type 5 (Ad5) E1B 55K forms a specific complex with p53 (Sarnow et al., 1982a
) and, at least transiently, blocks p53-mediated transcription, an activity that co-segregates with the transforming potential of E1B 55K in mutational analysis (Yew & Berk, 1992
). Ad5 E1B 55K binds to the amino-terminal portion of p53 that is responsible for transcriptional activation (Lin et al., 1994
), actively represses p53-mediated transcription (Yew et al., 1994
) and sequesters p53 to characteristic perinuclear clusters (Blair Zajdel & Blair, 1988
; Zantema et al., 1985a
). Given the close correlation between the ability of E1B 55K to bind p53 and its transforming potential (Yew & Berk, 1992
), it is widely assumed that E1B 55K constantly inactivates p53 in Ad E1-transformed cells (Grand et al., 1995
). This view was further supported by the observation that peptides blocking the interaction between E1B 55K and p53 at least temporarily inhibit the growth of Ad E1-transformed cells (Hutton et al., 2000
).
A homologue of p53, termed p73, is expressed in mammalian cells (Kaghad et al., 1997
). Many activities are shared between p53 and p73, such as transcriptional activation and the induction of apoptosis (Jost et al., 1997
). However, unlike p53, p73 does not detectably interact with Ad E1B 55K (Higashino et al., 1998
; Marin et al., 1998
; Roth et al., 1998
; Steegenga et al., 1999; Wienzek et al., 2000
). Based on this finding, a chimera of p53 and p73 was constructed, replacing the five residues at positions 2428 of p53 with the corresponding amino acids from p73, to create the mutant p53mt2428 (Roth et al., 1998
). This p53 mutant is fully active, inducing the transcriptional activation of p53-responsive promoters to the same extent as wild-type p53. However, it cannot be bound and inhibited by the E1B 55K proteins of Ad5 or Ad12 (Koch et al., 2001
; Roth et al., 1998
; Wienzek et al., 2000
). It also remains stable and active throughout an Ad infection (Koch et al., 2001
). Given these properties, p53mt2428 represents a tool to analyse the behaviour of cells in the simultaneous presence of E1B 55K and transcriptionally active p53.
SV40 employs a similar strategy as Ad to inactivate p53. The large T antigen of SV40 binds p53 and prevents it from activating transcription (Jiang et al., 1993
; McCormick et al., 1981
; Sarnow et al., 1982a
) but does not decrease the stability of p53 (Zantema et al., 1985b
). In contrast, when cells were transformed by oncogenic human papillomaviruses (HPVs), p53 is destabilized and virtually eliminated. This effect is due to enhanced p53 ubiquitination in the presence of oncogenic HPV E6 proteins (Huibregtse et al., 1991
; Scheffner et al., 1990
, 1993
).
p53 induces the expression (Barak et al., 1994
; Juven et al., 1993
) of its cellular antagonist, Mdm2 (Oliner et al., 1993
), which mediates the degradation of p53 (Haupt et al., 1997
; Kubbutat et al., 1997
), thereby establishing a regulatory feedback loop (Wu et al., 1993
). In cells that express Ad E1 or SV40 T antigens, however, p53 is at least temporarily inactivated by either E1B 55K or SV40 T antigen and this can be expected to interrupt the activation of mdm2 expression. Accordingly, p53 is stabilized in the presence of E1B 55K (Zantema et al., 1985b
) or SV40 T antigen (Reich et al., 1983
).
Since the stability of p53 is increased in Ad E1- and SV40-transformed cells, we hypothesized that p53 accumulates to an extent that will saturate E1B 55K molecules or T antigens present in these cells and, that beyond this point, any excess of p53 is transcriptionally active. This hypothesis was tested and, indeed, active p53 was constantly present in Ad E1-transformed cells and also in SV40-transformed cells. Furthermore, the stable overexpression of E1B-resistant, active p53mt2428 was tolerated by Ad E1-transformed cells, strongly suggesting that all the relevant growth-preventing products of p53 target genes are effectively inactivated upon transformation of cells by Ad E1 proteins.
| Methods |
|---|
|
|
|---|
Cell culture and transfections.
Plasmids.
Expression plasmids for p53 (Lin et al., 1994
), p53mt2428 (Roth et al., 1998
) and Ad5 E1B 55K (Dobbelstein et al., 1997
) were described previously, as well as the reporter plasmids pGL2BP100 (Freedman et al., 1997
) and pGL2RSV (Ristea et al., 2000
). For stable expression of p53 and its mutants, the p53-encoding region was excised from pRcCMVp53 (Lin et al., 1994
) or pRcCMVp53R273H (Lin et al., 1994
) with HindIII/XbaI. The ends were filled with Pfu turbo DNA polymerase (Stratagene). The plasmid pCIN4, expressing a bicistronic mRNA encoding the gene of interest along with an enzyme conferring neomycin resistance (Rees et al., 1996
), was linearized with EcoRV and ligated to the p53-encoding region in the sense orientation. The plasmid pCINp53mt2428 was made by site-directed mutagenesis using the plasmid pCINp53 and the same oligonucleotides as described previously (Roth et al., 1998
). All constructs were confirmed by sequencing.
Luciferase assays.
For transfections, 2x105 cells per assay were used. Luciferase activities were determined 24 h later using a pre-manufactured assay system (Promega) and an automated luminometer (Berthold).
Immunoblots.
Proteins were separated by 10% SDSPAGE, transferred to nitrocellulose and then incubated with antibodies diluted in PBS containing 5% milk powder and 0·1% Tween 20. Detection was carried out by chemiluminescence (Pierce), using a peroxidase-coupled secondary antibody (Jackson). PAb1801, an antibody to p53 (Calbiochem), and another antibody against Lamin B (Zymed) were diluted 1:5000. Antibody 2A10 to Mdm2 was obtained from a hybridoma supernatant (gift from A. J. Levine) and diluted 1:50.
PCR.
To determine the ratio of wild-type and mutant p53 transcripts in a cell population, total RNA was prepared from these cells using Trizol (Life Technologies) and then treated with DNase. The RNA was reverse transcribed using the p53-specific primer 5' GGGAGCAGCCTCTGGCATTCTG and the RNA-dependent DNA polymerase Superscript II (Life Technologies). This cDNA was then used as a template for PCR amplification, using Pfu turbo DNA polymerase (Stratagene) and the primers 5' ATGGAGGAGCCGCAGTCAGATC and 5' GGGAGCAGCCTCTGGCATTCTG. The DNA obtained was then treated with the restriction enzyme SacI, which cut the PCR product originating from the mutant p53 transcript but not that from the wild-type p53 transcript.
Immunofluorescence.
Cells were seeded on plastic slides suitable for microscopy (Nunc) for 24 h, washed with PBS, fixed with paraformaldehyde (4% in PBS, 15 min), permeabilized with Triton X-100 (0·2% in PBS, 25 min), blocked (10% FBS in PBS, 15 min) and incubated with antibody, as described previously (Dobbelstein et al., 1992
). To detect E1B 55K, the murine monoclonal antibody 2A6 (Sarnow et al., 1982b
) was used. The p53 protein was stained with a polyclonal rabbit antibody (FL-393, Santa Cruz). Primary mouse antibodies were visualized by secondary antibodies coupled to Alexa 488 (Molecular Probes). Primary rabbit antibodies were detected by an Alexa 594-labelled secondary antibody (Molecular Probes). Prior to mounting (Fluroprep, bioMérieux), the cell nuclei were briefly stained using 4',6-diamidino-2-phenylindole (DAPI).
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
|
If p53 binding by E1B 55K is dispensable for the growth of Ad E1-transformed cells, what is the role of E1B 55K in transformation? One possible explanation is that p53 binding may be required only during the initial steps of cell transformation, as described by a hit-and-run scenario. However, this would not explain the maintenance of E1B 55K expression in the majority of E1-transformed cells. We therefore favour the hypothesis that E1B 55K contributes to malignant transformation by mechanisms in addition to p53 binding. Even though mutational analysis revealed a close association between p53 binding and transformation by E1B 55K (Yew & Berk, 1992
), it should be considered that most mutants of E1B 55K have lost several functions at a time (Kao et al., 1990
; Rubenwolf et al., 1997
; Yew & Berk, 1992
; Yew et al., 1990
), presumably due to a labile conformation of the protein, which is easily disrupted even by small mutations. Therefore, mutational analysis cannot exclude the presence of at least one more, as yet unknown, biochemical activity of E1B 55K contributing to malignant transformation. A specific E1B 55K mutant that selectively abolishes p53 binding recently became available (Shen et al., 2001
). Testing this mutant in transformation assays may clarify whether E1B 55K contributes to transformation by mechanisms independent of p53 binding.
Although Ad E1-transformed cells can apparently tolerate p53, this tolerance is not without limitations, as is evident from the considerable colony suppression by p53mt2428 (Fig. 5A
). Also it is clear that some, but not all, p53 molecules in these cells are inactivated by association with E1B 55K. This can explain the fact that the addition of a p53-derived peptide to Ad E1-transformed cells, and the consecutive massive activation of p53, led to a cell-cycle arrest (Hutton et al., 2000
). Nonetheless, it remains to be stated that Ad E1-transformed cells grew rapidly despite a considerable level of exogenous nuclear p53, whereas p53-/- cells did not.
To our knowledge, this is the first example of cell lines that grow despite the stable overexpression of active p53 from the cytomegalovirus major immediate early promoter one of the strongest known promoters (Boshart et al., 1985
). This tolerance for active p53 suggests that p53 target gene products, in addition to p53 itself, are inactivated, directly or indirectly, in Ad E1-transformed cells. For some p53 targets, this was indeed found to be the case (Fig. 8B
). p53 induces the p21CIP1/WAF1 gene product (el-Deiry et al., 1993
), which inhibits the phosphorylation of the retinoblastoma protein pRb and thereby the transition from the G1 to the S phase of the cell cycle (Bartek & Lukas, 2001
). However, the Ad E1A gene products bind and inactivate pRb (Whyte et al., 1988
), thereby antagonizing p21. Likewise, p53 induces the expression of Bax, which induces apoptosis (Miyashita & Reed, 1995
). On the other hand, the E1B 19K protein interacts with Bax and inhibits cell death (Chen et al., 1996
; Han et al., 1996
). The induction of apoptosis by p53-induced Fas CD95 (Muller et al., 1998
) may be prevented by E1B 19K as well (Hashimoto et al., 1991
; Perez & White, 1998
). However, many more p53 target gene products were shown to block cell growth. These gene products include inhibitors of G2M transition, such as 14-3-3
(Hermeking et al., 1997
), MCG10 (Zhu & Chen, 2000
) and Reprimo (Ohki et al., 2000
), as well as inducers of apoptosis, such as Apaf-1 (Kannan et al., 2001
; Moroni et al., 2001
), Killer/DR5 (Wu et al., 1997
), MCG10 (Zhu & Chen, 2000
), Noxa (Oda et al., 2000a
), p53AIP1 (Oda et al., 2000b
), PUMA (Nakano & Vousden, 2001
) and many others (Vogelstein et al., 2000
; Vousden, 2000
). If Ad E1-transformed cells grow despite ongoing p53 activity, this could be explained in three ways. Firstly, the expression of most p53 target genes does not inhibit cell growth, which would be in contradiction with their previous functional analysis in many cases. Secondly, the p53 target genes might be mutated in Ad E1-transformed cells. However, it appears unlikely that such a large number of mutations should have occurred during the process of in vitro transformation. Therefore, we favour the third possibility: at least a growth-limiting subset of the p53 target gene products may be regulated, by as yet unknown mechanisms, through the action of Ad E1 proteins at levels downstream from p53 itself. This hypothesis implies that Ad E1 proteins may promote cell growth by a considerably wider variety of mechanisms than previously anticipated.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Barak, Y., Gottlieb, E., Juven-Gershon, T. & Oren, M. (1994). Regulation of mdm2 expression by p53: alternative promoters produce transcripts with nonidentical translation potential. Genes & Development 8, 1739-1749.
Bartek, J. & Lukas, J. (2001). Pathways governing G1/S transition and their response to DNA damage. FEBS Letters 490, 117-122.[Medline]
Blair Zajdel, M. E. & Blair, G. E. (1988). The intracellular distribution of the transformation-associated protein p53 in adenovirus-transformed rodent cells. Oncogene 2, 579-584.[Medline]
Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B. & Schaffner, W. (1985). A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41, 521-530.[Medline]
Chen, J., Lin, J. & Levine, A. J. (1995). Regulation of transcription functions of the p53 tumor suppressor by the mdm-2 oncogene. Molecular Medicine 1, 142-152.[Medline]
Chen, G., Branton, P. E., Yang, E., Korsmeyer, S. J. & Shore, G. C. (1996). Adenovirus E1B 19-kDa death suppressor protein interacts with Bax but not with Bad. Journal of Biological Chemistry 271, 24221-24225.
Dobbelstein, M., Arthur, A. K., Dehde, S., van Zee, K., Dickmanns, A. & Fanning, E. (1992). Intracistronic complementation reveals a new function of SV40 T antigen that co-operates with Rb and p53 binding to stimulate DNA synthesis in quiescent cells. Oncogene 7, 837-847.[Medline]
Dobbelstein, M., Roth, J., Kimberly, W. T., Levine, A. J. & Shenk, T. (1997). Nuclear export of the E1B 55-kDa and E4 34-kDa adenoviral oncoproteins mediated by a rev-like signal sequence. EMBO Journal 16, 4276-4284.[Medline]
el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W. & Vogelstein, B. (1993). WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817-825.[Medline]
Elenbaas, B., Spirio, L., Koerner, F., Fleming, M. D., Zimonjic, D. B., Donaher, J. L., Popescu, N. C., Hahn, W. C. & Weinberg, R. A. (2001). Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes & Development 15, 50-65.
Fallaux, F. J., Kranenburg, O., Cramer, S. J., Houweling, A., Van Ormondt, H., Hoeben, R. C. & Van Der Eb, A. J. (1996). Characterization of 911: a new helper cell line for the titration and propagation of early region 1-deleted adenoviral vectors. Human Gene Therapy 7, 215-222.[Medline]
Freedman, D. A., Epstein, C. B., Roth, J. C. & Levine, A. J. (1997). A genetic approach to mapping the p53 binding site in the MDM2 protein. Molecular Medicine 3, 248-259.[Medline]
Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I. & Howard, B. H. (1982). The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNA-mediated transfection. Proceedings of the National Academy of Sciences, USA 79, 6777-6781.
Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology 36, 59-74.
Grand, R. J., Lecane, P. S., Owen, D., Grant, M. L., Roberts, S., Levine, A. J. & Gallimore, P. H. (1995). The high levels of p53 present in adenovirus early region 1-transformed human cells do not cause up-regulation of MDM2 expression. Virology 210, 323-334.[Medline]
Hahn, W. C., Counter, C. M., Lundberg, A. S., Beijersbergen, R. L., Brooks, M. W. & Weinberg, R. A. (1999). Creation of human tumour cells with defined genetic elements. Nature 400, 464-468.[Medline]
Han, J., Sabbatini, P., Perez, D., Rao, L., Modha, D. & White, E. (1996). The E1B 19K protein blocks apoptosis by interacting with and inhibiting the p53-inducible and death-promoting Bax protein. Genes & Development 10, 461-477.
Hashimoto, S., Ishii, A. & Yonehara, S. (1991). The E1B oncogene of adenovirus confers cellular resistance to cytotoxicity of tumor necrosis factor and monoclonal anti-Fas antibody. International Immunology 3, 343-351.
Haupt, Y., Maya, R., Kazaz, A. & Oren, M. (1997). Mdm2 promotes the rapid degradation of p53. Nature 387, 296-299.[Medline]
Hermeking, H., Lengauer, C., Polyak, K., He, T. C., Zhang, L., Thiagalingam, S., Kinzler, K. W. & Vogelstein, B. (1997). 14-3-3
is a p53-regulated inhibitor of G2/M progression. Molecular Cell 1, 3-11.[Medline]
Higashino, F., Pipas, J. M. & Shenk, T. (1998). Adenovirus e4orf6 oncoprotein modulates the function of the p53-related protein, p73. Proceedings of the National Academy of Sciences, USA 95, 15683-15687.
Huibregtse, J. M., Scheffner, M. & Howley, P. M. (1991). A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 or 18. EMBO Journal 10, 4129-4135.[Medline]
Hutton, F. G., Turnell, A. S., Gallimore, P. H. & Grand, R. J. (2000). Consequences of disruption of the interaction between p53 and the larger adenovirus early region 1B protein in adenovirus E1 transformed human cells. Oncogene 19, 452-462.[Medline]
Jiang, D., Srinivasan, A., Lozano, G. & Robbins, P. D. (1993). SV40 T antigen abrogates p53-mediated transcriptional activity. Oncogene 8, 2805-2812.[Medline]
Jost, C. A., Marin, M. C. & Kaelin, W. G.Jr (1997). p73 is a human p53-related protein that can induce apoptosis. Nature 389, 191-194.[Medline]
Juven, T., Barak, Y., Zauberman, A., George, D. L. & Oren, M. (1993). Wild-type p53 can mediate sequence-specific transactivation of an internal promoter within the mdm2 gene. Oncogene 8, 3411-3416.[Medline]
Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J. C., Valent, A., Minty, A., Chalon, P., Lelias, J. M., Dumont, X., Ferrara, P., McKeon, F. & Caput, D. (1997). Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90, 809-819.[Medline]
Kannan, K., Kaminski, N., Rechavi, G., Jakob-Hirsch, J., Amariglio, N. & Givol, D. (2001). DNA microarray analysis of genes involved in p53-mediated apoptosis: activation of Apaf-1. Oncogene 20, 3449-3455.[Medline]
Kao, C. C., Yew, P. R. & Berk, A. J. (1990). Domains required for in vitro association between the cellular p53 and the adenovirus 2 E1B 55K proteins. Virology 179, 806-814.[Medline]
Koch, P., Gatfield, J., Löber, C., Hobom, U., Lenz-Stöppler, C., Roth, J. & Dobbelstein, M. (2001). Efficient replication of adenovirus despite the overexpression of active and non-degradable p53. Cancer Research 61, 5941-5947.
Kubbutat, M. H., Jones, S. N. & Vousden, K. H. (1997). Regulation of p53 stability by Mdm2. Nature 387, 299-303.[Medline]
Lane, D. P. (1992). p53, guardian of the genome. Nature 358, 15-16.[Medline]
Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88, 323-331.[Medline]
Lin, J., Chen, J., Elenbaas, B. & Levine, A. J. (1994). Several hydrophobic amino acids in the p53 amino-terminal domain are required for transcriptional activation, binding to mdm-2 and the adenovirus 5 E1B 55-kD protein. Genes & Development 8, 1235-1246.
McCormick, F., Clark, R., Harlow, E. & Tjian, R. (1981). SV40 T antigen binds specifically to a cellular 53 K protein in vitro. Nature 292, 63-65.[Medline]
Marin, M. C., Jost, C. A., Irwin, M. S., DeCaprio, J. A., Caput, D. & Kaelin, W. G.Jr (1998). Viral oncoproteins discriminate between p53 and the p53 homolog p73. Molecular and Cellular Biology 18, 6316-6324.
Miyashita, T. & Reed, J. C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293-299.[Medline]
Moroni, M. C., Hickman, E. S., Denchi, E. L., Caprara, G., Colli, E., Cecconi, F., Muller, H. & Helin, K. (2001). Apaf-1 is a transcriptional target for E2F and p53. Nature Cell Biology 3, 552-558.[Medline]
Muller, M., Wilder, S., Bannasch, D., Israeli, D., Lehlbach, K., Li-Weber, M., Friedman, S. L., Galle, P. R., Stremmel, W., Oren, M. & Krammer, P. H. (1998). p53 activates the CD95 (APO-1/Fas) gene in response to DNA damage by anticancer drugs. Journal of Experimental Medicine 188, 2033-2045.
Nakano, K. & Vousden, K. H. (2001). PUMA, a novel proapoptotic gene, is induced by p53. Molecular Cell 7, 683-694.[Medline]
Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi, T. & Tanaka, N. (2000a). Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science 288, 1053-1058.
Oda, K., Arakawa, H., Tanaka, T., Matsuda, K., Tanikawa, C., Mori, T., Nishimori, H., Tamai, K., Tokino, T., Nakamura, Y. & Taya, Y. (2000b). p53AIP1, a potential mediator of p53-dependent apoptosis, and its regulation by Ser-46-phosphorylated p53. Cell 102, 849-862.[Medline]
Ohki, R., Nemoto, J., Murasawa, H., Oda, E., Inazawa, J., Tanaka, N. & Taniguchi, T. (2000). Reprimo, a new candidate mediator of the p53-mediated cell cycle arrest at the G2 phase. Journal of Biological Chemistry 275, 22627-22630.
Oliner, J. D., Pietenpol, J. A., Thiagalingam, S., Gyuris, J., Kinzler, K. W. & Vogelstein, B. (1993). Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53. Nature 362, 857-860.[Medline]
Perez, D. & White, E. (1998). E1B 19K inhibits Fas-mediated apoptosis through FADD-dependent sequestration of FLICE. Journal of Cell Biology 141, 1255-1266.
Pipas, J. M. & Levine, A. J. (2001). Role of T antigen interactions with p53 in tumorigenesis. Seminars in Cancer Biology 11, 23-30.[Medline]
Rees, S., Coote, J., Stables, J., Goodson, S., Harris, S. & Lee, M. G. (1996). Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques 20, 102104; 106, 108110.
Reich, N. C., Oren, M. & Levine, A. J. (1983). Two distinct mechanisms regulate the levels of a cellular tumor antigen, p53. Molecular and Cellular Biology 3, 2143-2150.
Ristea, S., Dobbelstein, M. & Roth, J. (2000). Rev protein of human immunodeficiency virus type 1 and cellular exportin 1 protein relocalize each other to a subnucleolar structure. AIDS Research and Human Retroviruses 16, 857-865.[Medline]
Roth, J. & Dobbelstein, M. (1997). Export of hepatitis B virus RNA on a Rev-like pathway: inhibition by the regenerating liver inhibitory factor I
B
. Journal of Virology 71, 8933-8939.[Abstract]
Roth, J., König, C., Wienzek, S., Weigel, S., Ristea, S. & Dobbelstein, M. (1998). Inactivation of p53 but not p73 by adenovirus type 5 E1B 55-kilodalton and E4 34-kilodalton oncoproteins. Journal of Virology 72, 8510-8516.
Rubenwolf, S., Schutt, H., Nevels, M., Wolf, H. & Dobner, T. (1997). Structural analysis of the adenovirus type 5 E1B 55-kilodalton-E4orf6 protein complex. Journal of Virology 71, 1115-1123.[Abstract]
Sachsenmeier, K. F. & Pipas, J. M. (2001). Inhibition of Rb and p53 is insufficient for SV40 T-antigen transformation. Virology 283, 40-48.[Medline]
Sarnow, P., Ho, Y. S., Williams, J. & Levine, A. J. (1982a). Adenovirus E1B-58kD tumor antigen and SV40 large tumor antigen are physically associated with the same 54 kD cellular protein in transformed cells. Cell 28, 387-394.[Medline]
Sarnow, P., Sullivan, C. A. & Levine, A. J. (1982b). A monoclonal antibody detecting the adenovirus type 5-E1B-58kD tumor antigen: characterization of the E1B-58kD tumor antigen in adenovirus-infected and -transformed cells. Virology 120, 510-517.[Medline]
Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J. & Howley, P. M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-1136.[Medline]
Scheffner, M., Huibregtse, J. M., Vierstra, R. D. & Howley, P. M. (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505.[Medline]
Schwartz, D. & Rotter, V. (1998). p53-dependent cell cycle control: response to genotoxic stress. Seminars in Cancer Biology 8, 325-336.[Medline]
Shen, Y. & Shenk, T. (1994). Relief of p53-mediated transcriptional repression by the adenovirus E1B 19-kDa protein or the cellular Bcl-2 protein. Proceedings of the National Academy of Sciences, USA 91, 8940-8944.
Shen, Y., Kitzes, G., Nye, J. A., Fattaey, A. & Hermiston, T. (2001). Analyses of single-amino-acid substitution mutants of adenovirus type 5 E1B-55K protein. Journal of Virology 75, 4297-4307.
Shenk, T. (1996). Adenoviridae: The viruses and their replication. In Virology , pp. 2111-2148. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Steegenga, W. T., Shvarts, A., Riteco, N., Bos, J. L. & Jochemsen, A. G. (1999). Distinct regulation of p53 and p73 activity by adenovirus E1A, E1B, and E4orf6 proteins. Molecular and Cellular Biology 19, 3885-3894.
Vogelstein, B., Lane, D. & Levine, A. J. (2000). Surfing the p53 network. Nature 408, 307-310.[Medline]
Vousden, K. H. (2000). p53. Death star. Cell 103, 691-694.[Medline]
Weitzman, J. B. & Yaniv, M. (1999). Rebuilding the road to cancer. Nature 400, 401-402.[Medline]
Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck, M., Weinberg, R. A. & Harlow, E. (1988). Association between an oncogene and an anti-oncogene: the adenovirus E1A proteins bind to the retinoblastoma gene product. Nature 334, 124-129.[Medline]
Wienzek, S., Roth, J. & Dobbelstein, M. (2000). E1B 55-kilodalton oncoproteins of adenovirus types 5 and 12 inactivate and relocalize p53, but not p51 or p73, and cooperate with E4orf6 proteins to destabilize p53. Journal of Virology 74, 193-202.
Wu, X., Bayle, J. H., Olson, D. & Levine, A. J. (1993). The p53-mdm-2 autoregulatory feedback loop. Genes & Development 7, 1126-1132.
Wu, G. S., Burns, T. F., McDonald, E. R.III, Jiang, W., Meng, R., Krantz, I. D., Kao, G., Gan, D. D., Zhou, J. Y., Muschel, R., Hamilton, S. R., Spinner, N. B., Markowitz, S., Wu, G. & el-Deiry, W. S. (1997). KILLER/DR5 is a DNA damage-inducible p53-regulated death receptor gene. Nature Genetics 17, 141-143.[Medline]
Yew, P. R. & Berk, A. J. (1992). Inhibition of p53 transactivation required for transformation by adenovirus early 1B protein. Nature 357, 82-85.[Medline]
Yew, P. R., Kao, C. C. & Berk, A. J. (1990). Dissection of functional domains in the adenovirus 2 early 1B 55K polypeptide by suppressor-linker insertional mutagenesis. Virology 179, 795-805.[Medline]
Yew, P. R., Liu, X. & Berk, A. J. (1994). Adenovirus E1B oncoprotein tethers a transcriptional repression domain to p53. Genes & Development 8, 190-202.
Zantema, A., Fransen, J. A., Davis-Olivier, A., Ramaekers, F. C., Vooijs, G. P., DeLeys, B. & Van der Eb, A. J. (1985a). Localization of the E1B proteins of adenovirus 5 in transformed cells, as revealed by interaction with monoclonal antibodies. Virology 142, 44-58.[Medline]
Zantema, A., Schrier, P. I., Davis-Olivier, A., van Laar, T., Vaessen, R. T. & van der Eb, A. (1985b). Adenovirus serotype determines association and localization of the large E1B tumor antigen with cellular tumor antigen p53 in transformed cells. Molecular and Cellular Biology 5, 3084-3091.
Zhu, J. & Chen, X. (2000). MCG10, a novel p53 target gene that encodes a KH domain RNA-binding protein, is capable of inducing apoptosis and cell cycle arrest in G2M. Molecular and Cellular Biology 20, 5602-5618.
Received 19 February 2002;
accepted 3 April 2002.
This article has been cited by other articles:
![]() |
U. Hobom and M. Dobbelstein E1B-55-Kilodalton Protein Is Not Required To Block p53-Induced Transcription during Adenovirus Infection J. Virol., July 15, 2004; 78(14): 7685 - 7697. [Abstract] [Full Text] [PDF] |
||||
| ||||||