J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Agricola
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Journal of General Virology (2002), 83, 2153-2159.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Identification of the glycosaminoglycan-binding site on the glycoprotein Erns of bovine viral diarrhoea virus by site-directed mutagenesis

Munir Iqbal1 and John W. McCauley1

Division of Molecular Biology, Institute for Animal Health, Compton Laboratory, Compton, Newbury RG20 7NN, UK1

Author for correspondence: Munir Iqbal. Fax +44 1635 577263. e-mail munir.iqbal{at}bbsrc.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Bovine viral diarrhoea virus (BVDV) envelope glycoprotein Erns interacts with highly sulphated heparin-like glycosaminoglycans (GAGs) located on the cell surface as an early step in virus infection of cells. Site-directed mutagenesis of recombinant Erns was undertaken and analysis of mutants by heparin-affinity chromatography and cell surface binding showed that a cluster of basic amino acids (480KKLENKSK487) near the C terminus of Erns was essential for binding. Mutants with amino acid substitutions of lysine residues 481 and 485 in Erns reduced the binding of Erns to immobilized heparin and cellular GAGs but retained ribonuclease activity. In contrast to normal Erns, Erns that was unable to bind to cells also failed to inhibit BVDV infection of cells when the cells were pre-incubated with Erns. It is proposed that the cluster of basic residues (480KKLENKSK487) localized at the C-terminal end of Erns constitutes a GAG-binding site.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Bovine viral diarrhoea virus (BVDV) is a major cattle pathogen with a worldwide distribution, which, together with classical swine fever virus (CSFV) of pigs and border disease virus (BDV) of sheep, belongs to the genus Pestivirus of the family Flaviviridae (Thiel et al., 1996Down ). Many members of this family can cause severe human disease, such as hepatitis C virus, dengue virus and yellow fever virus (Pringle, 1998Down ). The pestivirus genome comprises positive-stranded RNA that is translated to form a single virus polyprotein, which, through cleavage by both host and virus proteases, gives rise to 11 or 12 mature viral proteins (NH2-Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH) (Rice, 1996Down ). Erns, E1 and E2 are glycoproteins found on the surface of the virion. Erns lacks a typical transmembrane domain and a proportion of this protein is secreted from infected cells into the extracellular environment (Rumenapf et al., 1993Down ) and also contains a ribonuclease activity (Hulst et al., 1994Down ; Schneider et al., 1993Down ; Windisch et al., 1996Down ). The role of ribonuclease activity in the virus life cycle is not clear. It has been reported that a genetically engineered strain of CSFV, which lacks ribonuclease activity, induced cell death in swine kidney cells but the parent virus did not (Hulst et al., 1998Down ). However, another mutant CSFV lacking ribonuclease activity was not cytopathogenic (Meyers et al., 1999Down ). Recently we have assigned an additional function to Erns: BVDV glycoprotein Erns binds to glycosaminoglycans (GAGs) on the cell surface (Iqbal et al., 2000Down ); subsequently, this was also shown for Erns of CSFV (Hulst et al., 2000Down ).

Heparin is present in the form of heparan sulphate proteoglycans on the cell surface and a large number of viruses utilize heparan sulphate to mediate attachment and infection of target cells. Examples can be found within many virus families: for example, members of the families Flaviviridae (Chen et al., 1997Down ; Hilgard & Stockert, 2000Down ; Su et al., 2001Down ), Herpesviridae (Terry-Allison et al., 2001Down ) and Picornaviridae (Jackson et al., 1996Down ); human immunodeficiency viruses (Di Caro et al., 1999Down ), human respiratory syncytial virus (Martínez & Melero, 2000Down ), adenovirus types 2 and 5 (Dechecchi et al., 2001Down ); and members of the genus Alphavirus (Byrnes & Griffin, 1998Down ). The binding of proteins and glycoproteins to GAGs is often mediated through heparin-binding domains (HBDs), which are found in a wide range of proteins and are characterized by an overall positive charge. Common structural motifs have been proposed: the sequences BBXB, XBBXBX and XBBBXXBX (where B designates a basic amino acid and X designates any other residue) have been suggested to act as heparin-binding regions (Hileman et al., 1998; Sobel et al., 1992Down ).

The amino acid sequence of Erns has two conserved sequences, 406KKGK409 and 480KKLENKSK487, which closely match consensus HBD sequences. Here we examine whether these putative heparin-binding consensus sequences present in Erns are involved in Erns–GAG binding; we describe their relative affinities for heparin and cell surface binding; and the ability of mutated Erns to block BVDV infection.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
Calf testes (CTe) cells were maintained in Eagle’s minimum essential medium (EMEM) supplemented with 10% BVDV-free foetal calf serum (FCS), 5% lactalbumin hydrolysate and 0·1% penicillin G and streptomycin (100 µg/ml). Insect cells (Schneider S2; Drosophila) were obtained from Invitrogen and grown at room temperature in DES expression medium (Invitrogen) containing 10% FCS. Working stock (passage no. 12) of BVDV cytopathogenic (CP) virus strain Pe515 (Pocock et al., 1987Down ) was prepared in CTe cells.

{blacksquare} Site-directed mutagenesis of heparin-binding sites.
The Erns gene was cloned previously into a Drosophila expression vector to produce pMT/BiP/Erns/V5-His, which represented the full-length Erns cDNA of BVDV (non CP) strain Pe515 corresponding to amino acids 268–494 of the BVDV polyprotein (Iqbal et al., 2000Down ). Specific mutation of positively charged amino acids in putative heparin-binding motifs of Erns was carried out to substitute lysine for uncharged amino acids (alanine, glycine or threonine). Mutagenesis was done by PCR using the Quick Change Site-Directed Mutagenesis kit (Stratagene) following the manufacturer’s guidelines. The sequences of the mutagenic primers used for the constructs can be obtained from the authors upon request. Sequencing of mutagenized plasmids was carried out commercially (MWG-Biotech). A deletion mutant of Erns ({Delta}480–494 Erns), where the C-terminal 15 amino acids of mature Erns were deleted, was constructed by PCR and cloned into the DES expression vector pMT/BiP/V5-His (Invitrogen). The primers used were: 5' ATTCAAGTTACAAGATCTGAAAATATAACA 3' (sense orientation), which corresponds to nucleotides 1178–1207 of the BVDV genome sequence modified to include a BglII recognition site (bold letters) on the 5' end of the Erns sequence; and 5' CTTGTTTTCCAATCTAGATCCTAGTATCCC 3' (anti-sense orientation), which corresponds to nucleotides 1820–1849 of the BVDV genome sequence modified by the inclusion of an XbaI recognition site (bold letters). Plasmids (pMT/BiP/Erns/V5-His) containing the genes encoding wild-type, mutated or deleted Erns were individually co-transfected with a hygromycin-resistant selection vector pCoHYGRO (Invitrogen) at a ratio of 19 (pMT/BiP/Erns/V5-His) to 1 (pCoHYGRO) into insect (S2) cells using a Calcium Phosphate Transfection kit (Invitrogen), according to the supplier’s instructions.

{blacksquare} Expression and purification of wild-type and mutant Erns.
Wild-type and mutant Erns glycoproteins were expressed and purified as described previously (Iqbal et al., 2000Down ). Briefly, Drosophila S2 cells harbouring the Erns gene were grown in Ultimate Insect serum-free medium (Invitrogen) and expression of V5-tagged Erns (ErnsV5) was induced by the addition of 5 µM copper sulphate. The culture supernatants collected 72 h post-induction were dialysed against equilibration buffer (20 mM Tris–HCl, pH 7·8, and 500 mM NaCl) and subjected to nickel affinity chromatography (Probond, Invitrogen). The column was washed with 20 mM Tris–HCl, pH 6·0, containing 1·0 M NaCl and 50 mM imidazole and Erns was eluted with 20 mM Tris–HCl, pH 6·0, containing 300 mM imidazole. Fractions containing ErnsV5 were pooled and the concentration of protein was determined using the Coomassie reagent (Pierce).

{blacksquare} Binding of Erns and its mutants to heparin.
The relative affinity of wild-type and mutant Erns to immobilized heparin was determined by loading the S2 cell culture supernatants containing wild-type or mutant proteins onto a 1·0 ml heparin–agarose column (Sigma) equilibrated previously with 20 mM Tris–HCl, pH 7·8. The column was washed with equilibration buffer and eluted in 1·0 ml fractions with a stepwise gradient of increasing concentrations of NaCl (0·1–1·0 M) in equilibration buffer. Dilutions of each fraction were coated onto a 96-well ELISA plate at 4 °C overnight and then blocked with 5% skimmed milk in PBS. Erns was detected using an anti-V5 antibody (a generous gift from Professor R. Randall, University of St. Andrews, Scotland, UK).

{blacksquare} Cell surface binding assay.
Confluent cell monolayers of CTe cells in 96-well plates were washed twice with PBS, fixed with 4% paraformaldehyde in PBS for 45 min at room temperature and blocked overnight at 4 °C with blocking buffer (5% normal goat serum and 0·01% NaN3 in PBS). The cells were then incubated with 0·3 µg wild-type or mutant Erns in PBS in a total volume of 50 µl for 1 h at room temperature. Subsequently, the cells were washed three times with PBS. Bound wild-type and mutant Erns were detected with an anti-Erns monoclonal antibody (WB210, Veterinary Laboratories Agency) or an anti-V5 monoclonal antibody (ibid).

{blacksquare} Inhibition of BVDV infection of cells by Erns.
Confluent monolayers of CTe cells growing in 6-well plates were rinsed twice with serum-free EMEM and pre-incubated with 500 µl serum-free EMEM containing recombinant wild-type Erns, mutant Erns or control protein at 37 °C. After 1 h, dilutions of 500 µl CP BVDV (75 p.f.u.) in serum-free EMEM were added to the wells. When the virus solution was added, the concentration of protein (wild-type Erns, mutant Erns or GFP/V5) was diluted to 20 µg/ml (the concentration at which inhibition was measured). The virus–protein mixture was further allowed to adsorb for 1 h at 37 °C, after which the cells were washed three times with EMEM and overlaid with maintenance medium containing 1% agarose. The cells were then incubated at 37 °C for 3 days. The cells were stained with toluidine blue (0·1% toluidine blue and 4% formaldehyde in PBS) and the number of CP virus plaques was counted.

{blacksquare} Ribonuclease activity of Erns.
Ribonuclease activity of wild-type and mutant Erns was carried out essentially as described by Hulst et al. (1994)Down . Briefly, the assay mixture (25 µl in total) contained 0·2 µg of purified wild-type or mutant Erns and 12·5 µg of yeast 16–23S RNA in 20 mM sodium acetate buffer, pH 4·5. The mixture was incubated at 37 °C for varying time-points (5–45 min) and the enzyme reaction was stopped by acid precipitation using 5 µl of 25% (v/v) HClO4 containing 0·75% (w/v) uranyl acetate. After cooling on ice for 10 min, the reaction mixture was centrifuged for 5 min at 10000 g and the absorbance at 260 nm of the supernatant was measured. The specific ribonuclease activity was expressed as A260 units per min per mg of Erns.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Construction of Erns mutants
The BVDV glycoprotein contains two clusters of basic amino acids: 406KKGK409 (HBD-1), which exactly matches various viral and mammalian heparin-binding site sequences (Feldman et al., 1999Down ; Hileman et al., 1998Down ; Proudfoot et al., 2001Down ), and 480KKLENKSK487 (HBD-2) in the polyprotein of BVDV strain Pe515, both may be potential heparin-binding sites. Both of these regions of basic amino acids are conserved among all the BVDV strains for which data have been deposited in sequence databases. To determine whether the basic amino acid residues in these potential heparin-binding motifs are indeed responsible for Erns–GAG-binding activity, a series of single and double mutants, generated by site-directed mutagenesis by substituting lysine with neutral residues, and a single deletion mutant (a deletion of 15 amino acids, 480–494) were made. A total of 11 single, double and deletion mutants was constructed (Fig. 1Down).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. Amino acid sequence of potential HBDs of BVDV Erns. The lysine residues altered by site-directed mutagenesis are underlined and the resulting single and double mutants are shown in the boxes below. Mutant clones, which lost heparin-binding affinity, are indicated in bold.

 
Effect of Erns mutation on heparin-binding affinity
The relative affinities of the recombinant proteins for heparin were assessed by chromatography on heparin–agarose columns. Wild-type and mutant Erns proteins were expressed in Drosophila S2 cells and culture supernatants were applied to heparin–agarose columns and eluted with a stepwise gradient of an increasing concentration of NaCl (0·1–1·0 M). Wild-type and Erns mutants, K406A– K407T, K406A, K407T and K409G, in which basic amino acids had been substituted in the first potential HBD, HBD-1, and two mutants, K480A and K487G, from the second potential HBD, HBD-2, eluted between 0·5 and 1·0 M NaCl. These results indicated that the heparin-binding affinity of these Erns mutants was like wild-type Erns (Fig. 2aDown). In contrast, the other mutants from HBD-2, K480A–K481T, K485A–K487G, K481T and K485A and the deletion mutant {Delta}480–494 eluted from the matrix at 0·2–0·4 M NaCl (Fig. 2bDown) and showed reduced heparin binding. From these results we deduce that two basic residues of Erns, Lys481 and Lys485, are critical for binding to the heparin matrix.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Binding activities of Erns mutants to heparin–agarose. The relative binding of Erns mutants to heparin was estimated by the concentration of NaCl required for elution from a heparin–agarose column. Culture supernatants from Drosophila S2 cells expressing wild-type and mutant Erns proteins were applied to a heparin–agarose column and the Erns protein was eluted with a stepwise NaCl gradient (0·1–1·0 M). The fractions were assayed for Erns by ELISA. Total eluted Erns for each mutant from each NaCl concentration is shown. (a) Erns mutants that had no effect on their binding to heparin–agarose: wild-type (black), K406A–K407T (blue), K406A (pink), K407T (green), K409G (red), K480A (cyan) and K487G (purple). (b) Erns mutants that showed altered binding to heparin–agarose: {Delta}480–494 (black), K480A–K481T (blue), K485A–K487G (pink), K481T (green) and K485A (red).

 
Erns mutants that lack heparin-binding ability retain their RNase activity
To ensure that the changes introduced into Erns did not induce extensive conformational change to the molecule, the ribonuclease activity of Erns was examined. The specific ribonuclease activities of the purified wild-type and Erns mutants K480A–K481T, K485A–K487G, K481T and K485A and the deletion mutant {Delta}480–494 were: 756, 822, 634, 712, 568 and 613 A260 units per min per mg, respectively. These results demonstrated that mutant Erns showed no significant loss of ribonuclease activity.

Effect of Erns mutations on binding to the cell surface
The Erns mutants were examined for their differences in cell surface binding. Purified recombinant proteins were incubated with paraformaldehyde-fixed CTe cells and the relative binding of mutant proteins was analysed by ELISA. The data, shown in Fig. 3Down, demonstrated that wild-type and six mutants of glycoprotein Erns (K406A–K407T, K406A, K407T, K409G, K480A and K487G) showed similar binding to CTe cells but mutants K480A–K481T, K485A–K487G, K481T and K485A and the deletion mutant {Delta}480–494 had lost their ability to bind to the surface of cells. These results show that residues Lys481 and Lys485 are important residues involved in binding to cell surface GAGs. Notably, the ability of Erns to bind to cells correlates with their affinity for immobilized heparin.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Binding profiles of Erns mutants to CTe cells. Cell surface binding of wild-type and mutant Erns was measured by incubation of Erns with paraformaldehyde-fixed CTe cells in 96-well plates for 1 h at room temperature. Erns bound to cells were detected by ELISA using an anti-V5 monoclonal antibody. Each bar represents the mean of at least two independent experiments and error bars show the standard deviations from triplicate data points.

 
Ability of mutant Erns to block virus infectivity
To determine whether the observed impairment of Erns mutants in cell surface binding and binding to immobilized heparin also correlated with inhibition of virus infection, CTe cells were incubated with wild-type and mutant proteins and subsequently infected with CP BVDV virus. As shown in Fig. 4Down, the addition of wild-type Erns and mutant Erns, K406A–K407T, K406A, K407T, K409G, K480A and K487G during the period of virus attachment reduced plaque formation. In contrast, Erns mutants K480A–K481T, K485A–K487G, K481T and K485A and the deletion mutant {Delta}480–494 showed no significant inhibitory effect on virus infection compared to the GFP/V5 negative control protein. Hence, we conclude that Erns mutants with lysine residues at positions 481 and 485 changed to neutral amino acid residues were defective in heparin and cell surface binding and also lost their ability to block virus infection.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4. Effect of amino acid substitutions in the Erns protein on its ability to inhibit BVDV infection. Erns mutants were tested for their ability to block virus infection by treating the CTe cells with wild-type Erns, mutant Erns or GFP/V5 (control) for 1 h at 37 °C. Cells were then inoculated with approximately 75 p.f.u. of CP BVDV. The final concentration of Erns, mutant Erns or GFP/V5 was diluted to 20 µg/ml and incubated for a further 1 h. The cells were then washed and overlaid with medium containing 1% agarose. After incubation for 3 days, the cells were fixed and stained and the plaques counted. Error bars show the standard deviations from triplicate data points.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Recently we showed that BVDV glycoprotein Erns binds to immobilized heparin and interacts with cell surface heparan sulphate-like GAGs and proposed that BVDV interacts initially with the infected cell through this mechanism (Iqbal et al., 2000Down ). In this report, we localized a functional site on Erns that is involved in binding to cell surface GAGs and we determined the relative importance of positively charged residues in two potential HBDs (406KKGK409 and 480KKLENKSK487) of Erns. The results from site-directed mutagenesis of Erns presented here indicated that binding of the Erns to GAGs involves lysine residues at positions 481 and 485 of the virus polyprotein, the motif at residues 406–409 had no effect on GAG binding.

In CSFV, strain Brescia, Hulst et al. (2000)Down observed that the affinity of the virus for heparin increased after passage in tissue culture. These authors showed that residue 476 was involved in determining the affinity of the virus for heparin, since, on adaptation to tissue culture, this residue changed from Ser to Arg: this residue is adjacent to the heparin-binding motif that we have identified here for BVDV. At position 476, strains of CSFV vary with lysine, arginine or serine residues present but all BVDV and BDV sequences deposited in sequence databases are distinct and have glycine at that position. (In this study, we have not examined the effect of changing the conserved glycine at position 476 of BVDV Erns.) Like residue 476, the region we have identified (480KKLENK486) as a GAG-binding site is totally conserved in all BVDV strains sequenced to date. As a comparison with the examples from sequence databases, we have examined the amino acid sequence of this region of BVDV Erns directly from the serum of three persistently infected calves. RT–PCR and sequencing the cDNA products prepared from serum samples showed a conserved amino acid sequence between residues 470 and the C terminus of Erns in the region of the GAG-binding motif we have identified (data not shown). We submit, therefore, that adaptation of BVDV to tissue culture does not select for mutations around the GAG-binding motif and changes in binding to GAGs; this contrasts with observations made on CSFV (Hulst et al., 2000Down ). This GAG-binding motif is also highly conserved in BDV isolates: the only variation has been observed is residue 485. In BDV, residue 485 may be asparagine (as observed in BVDV) or histidine, which makes the BDV consensus KKLEN/HK. This region is somewhat different in CSFV isolates. The sequence reported most frequently in this region for CSFV isolates is KRLEGR but the consensus sequence can be described as K/RK/RLEG/S/RK/R. Notably, in all pestiviruses the LE motif is totally conserved. The significance of the change between CSFV and the BVDV/BDV group is unclear but it may correlate with the fine specificity of GAG binding and the important influence of residue 476 in CSFV.

The GAG-binding motif for all pestiviruses can be summarized as BBLEXBSB. This sequence does not exactly match any of the motifs for heparin binding adduced by Hileman et al. (1998)Down . Similarly this region of Erns does not match the other motifs: the XBBBXBX motif, typified by IL8, or the TXXBXXTBXXXTBB motif, typified by fibroblast growth factors.

There is a wide range of diverse interactions between cell surface proteoglycans and proteins or glycoproteins. Normal physiological interactions range from coagulation cascades, growth factor signalling and cell adhesion to lipase binding (Davies et al., 2001Down ; Feldman et al., 2000Down ; Hirose et al., 2001Down ; Hussain et al., 2000Down ; Koyama et al., 1991Down ; Wuppermann et al., 2001Down ). Likewise, viruses interact with proteoglycans in a number of ways. Several viruses may use cell surface proteoglycans as a step in virus attachment to cells but other virus molecules are not involved in the binding of virus to cells. Two well-studied examples of virus particles binding to GAGs are worth considering.

The importance of binding to cell surface GAGs of members of the family Herpesviridae in virus entry has recently been reviewed (Rajcani & Vojvodova, 1998Down ). Herpes simplex virus (HSV) contains at least two glycoproteins that bind to GAGs, gB and gC, and the residues involved in binding to GAGs have been identified. In the alphaherpesviruses pseudorabies virus and bovine herpesvirus-1 the gC glycoproteins contain multiple HBDs (Flynn & Ryan, 1996Down ; Liang et al., 1993Down ), whereas the gC of HSV-1 appears to have a single GAG-binding region (Mrdberg et al., 2001Down ; Tal-Singer et al., 1995Down ; Trybala et al., 1994Down ). Clearly, at least some herpesviruses interact with GAGs through multiple proteins in multiple interactions.

On the other hand, the crystal structure of foot-and-mouth disease virus (FMDV) associated with GAGs has revealed that there is a single site of interaction between GAGs and the virus particle. The interaction is formed by three virus capsid proteins (Fry et al., 1999Down ) with special importance associated with arginine at position 56 of VP3. This residue in field strains is histidine but arginine is selected on passage in tissue culture, which parallels an increased affinity for heparin but attenuation for cattle (Sa-Carvalho et al., 1997Down ). The adaptation of FMDV to tissue culture may be analogous to the adaptation of CSFV to tissue culture. There is no structural information available for pestivirus glycoproteins and whether variation in the affinity of the Erns glycoprotein of BVDV for GAGs affects virulence is not known. For BVDV and BDV, we do not know whether there is a selective pressure in culture to increase the affinity of the virus for GAGs. However, the highly conserved nature of the GAG-binding region in both BVDV and BDV and the absence of the variant amino acids in that region observed in CSFV prompts us to suggest that adaptation of GAG binding in tissue culture is not a major issue. However, the mutation of a single region in BVDV Erns and the alteration of the affinity for heparin in CSFV close to this site suggest that there is a single GAG-binding motif in Erns.

The binding of cytokines and growth factors to GAGs is thought to be an important mechanism favouring a paracrine action rather than a systemic action. It is hypothesized that binding to sulphated polysaccharides may focus the action of soluble polypeptides locally. Examples include many interleukins (for example, see Mummery & Rider, 2000Down ) and IFN-{gamma} (Lortat-Jacob & Grimaud, 1991Down ; Lortat-Jacob et al., 1995Down ). Interaction with proteoglycans local to the site of infection also may be an important way for viruses to influence their local environment. This strategy seems to have been utilized by some poxviruses. Many secreted poxvirus proteins bind to GAGs; examples include a complement control protein (Smith et al., 2000Down ) and the chemokine antagonists MC148 from Molluscum contagiosum (Damon et al., 1998Down ) and MT-1 from myxoma virus (Seet et al., 2001Down ). The GAG-binding activity of these virus proteins may well retain the activity of these polypeptides local to the site of virus infection acting in a paracrine fashion.

Erns is a structural component of the virus particle but it is also secreted from infected cells. Erns has the opportunity to act not only in virus entry but also as a paracrine mediator of an undefined activity. It is possible that an unknown function of Erns as a secreted glycoprotein may require its GAG-binding activity. Whether such a function is required during the acute phase of infection or in establishing a persistent infection is open to investigation. Identification of the residues involved in the interaction between Erns and glycosaminoglycan proteoglycans should promote the design of experiments to dissect the function of this glycoprotein in the natural history of pestiviruses.

Note added in proof. Langedijk (Journal of Biological Chemistry 277, 5308–5314, 2002) has recently shown that peptides corresponding to the C-terminal domain of Erns were able to enter the cell and localize to nucleoli. In his study, deletion of the region identified here as the GAG-binding motif of Erns abrogated that activity.


   Acknowledgments
 
We thank Dr Martin Fray and Dr Sue Baigent for discussion and for critically reviewing the manuscript.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Byrnes, A. P. & Griffin, D. E. (1998). Binding of Sindbis virus to cell surface heparan sulfate. Journal of Virology 72, 7349-7356.[Abstract/Free Full Text]

Chen, Y., Maguire, T., Hileman, R. E., Fromm, J. R., Esko, J. D., Linhardt, R. J. & Marks, R. M. (1997). Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nature Medicine 3, 866-871.[Medline]

Damon, I., Murphy, P. M. & Moss, B. (1998). Broad spectrum chemokine antagonistic activity of a human poxvirus chemokine homolog. Proceedings of the National Academy of Sciences, USA 95, 6403-6407.[Abstract/Free Full Text]

Davies, J. A., Fisher, C. E. & Barnett, M. W. (2001). Glycosaminoglycans in the study of mammalian organ development. Biochemical Society Transactions 29, 166-171.[Medline]

Dechecchi, M. C., Melotti, P., Bonizzato, A., Santacatterina, M., Chilosi, M. & Cabrini, G. (2001). Heparan sulfate glycosaminoglycans are receptors sufficient to mediate the initial binding of adenovirus types 2 and 5. Journal of Virology 75, 8772-8780.[Abstract/Free Full Text]

Di Caro, A., Perola, E., Bartolini, B., Marzano, M., Liverani, L., Mascellani, G., Benedetto, A. & Cellai, L. (1999). Fractions of chemically oversulphated galactosaminoglycan sulphates inhibit three enveloped viruses: human immunodeficiency virus type 1, herpes simplex virus type 1 and human cytomegalovirus. Antiviral Chemistry & Chemotherapy 10, 33-38.[Medline]

Feldman, S. A., Hendry, R. M. & Beeler, J. A. (1999). Identification of a linear heparin binding domain for human respiratory syncytial virus attachment glycoprotein G. Journal of Virology 73, 6610-6617.[Abstract/Free Full Text]

Feldman, S. A., Audet, S. & Beeler, J. A. (2000). The fusion glycoprotein of human respiratory syncytial virus facilitates virus attachment and infectivity via an interaction with cellular heparan sulfate. Journal of Virology 74, 6442-6447.[Abstract/Free Full Text]

Flynn, S. J. & Ryan, P. (1996). The receptor-binding domain of pseudorabies virus glycoprotein gC is composed of multiple discrete units that are functionally redundant. Journal of Virology 70, 1355-1364.[Abstract/Free Full Text]

Fry, E. E., Lea, S. M., Jackson, T., Newman, J. W., Ellard, F. M., Blakemore, W. E., Abu-Ghazaleh, R., Samuel, A., King, A. M. & Stuart, D. I. (1999). The structure and function of a foot-and-mouth disease virus–oligosaccharide receptor complex. EMBO Journal 18, 543-554.[Medline]

Hileman, R. E., Fromm, J. R., Weiler, J. M. & Linhardt, R. J. (1998). Glycosaminoglycan–protein interactions: definition of consensus sites in glycosaminoglycan binding proteins. Bioessays 20, 156-167.[Medline]

Hilgard, P. & Stockert, R. (2000). Heparan sulfate proteoglycans initiate dengue virus infection of hepatocytes. Hepatology 32, 1069-1077.[Medline]

Hirose, J., Kawashima, H., Yoshie, O., Tashiro, K. & Miyasaka, M. (2001). Versican interacts with chemokines and modulates cellular responses. Journal of Biological Chemistry 276, 5228-5234.[Abstract/Free Full Text]

Hulst, M. M., Himes, G., Newbigin, E. & Moormann, R. J. (1994). Glycoprotein E2 of classical swine fever virus: expression in insect cells and identification as a ribonuclease. Virology 200, 558-565.[Medline]

Hulst, M. M., Panoto, F. E., Hoekman, A., van Gennip, H. G. & Moormann, R. J. (1998). Inactivation of the RNase activity of glycoprotein Erns of classical swine fever virus results in a cytopathogenic virus. Journal of Virology 72, 151-157.[Abstract/Free Full Text]

Hulst, M. M., van Gennip, H. G. & Moormann, R. J. (2000). Passage of classical swine fever virus in cultured swine kidney cells selects virus variants that bind to heparan sulfate due to a single amino acid change in envelope protein Erns. Journal of Virology 74, 9553-9561.[Abstract/Free Full Text]

Hussain, M. M., Obunike, J. C., Shaheen, A., Hussain, M. J., Shelness, G. S. & Goldberg, I. J. (2000). High affinity binding between lipoprotein lipase and lipoproteins involves multiple ionic and hydrophobic interactions, does not require enzyme activity, and is modulated by glycosaminoglycans. Journal of Biological Chemistry 275, 29324-29330.[Abstract/Free Full Text]

Iqbal, M., Flick-Smith, H. & McCauley, J. W. (2000). Interactions of bovine viral diarrhoea virus glycoprotein Erns with cell surface glycosaminoglycans. Journal of General Virology 81, 451-459.[Abstract/Free Full Text]

Jackson, T., Ellard, F. M., Ghazaleh, R. A., Brookes, S. M., Blakemore, W. E., Corteyn, A. H., Stuart, D. I., Newman, J. W. & King, A. M. (1996). Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulfate. Journal of Virology 70, 5282-5287.[Abstract/Free Full Text]

Koyama, T., Parkinson, J. F., Sie, P., Bang, N. U., Muller-Berghaus, G. & Preissner, K. T. (1991). Different glycoforms of human thrombomodulin. Their glycosaminoglycan- dependent modulatory effects on thrombin inactivation by heparin cofactor II and antithrombin III. European Journal of Biochemistry 198, 563-570.[Medline]

Liang, X., Babiuk, L. A. & Zamb, T. J. (1993). Mapping of heparin-binding structures on bovine herpesvirus 1 and pseudorabies virus gIII glycoproteins. Virology 194, 233-243.[Medline]

Lortat-Jacob, H. & Grimaud, J. A. (1991). Interferon-{gamma} binds to heparan sulfate by a cluster of amino acids located in the C-terminal part of the molecule. FEBS Letters 280, 152-154.[Medline]

Lortat-Jacob, H., Turnbull, J. E. & Grimaud, J. A. (1995). Molecular organization of the interferon {gamma}-binding domain in heparan sulphate. Biochemical Journal 310, 497-505.

Mrdberg, K., Trybala, E., Glorioso, J. C. & Bergström, T. (2001). Mutational analysis of the major heparan sulfate-binding domain of herpes simplex virus type 1 glycoprotein C. Journal of General Virology 82, 1941-1950.[Abstract/Free Full Text]

Martínez, I. & Melero, J. A. (2000). Binding of human respiratory syncytial virus to cells: implication of sulfated cell surface proteoglycans. Journal of General Virology 81, 2715-2722.[Abstract/Free Full Text]

Meyers, G., Saalmuller, A. & Buttner, M. (1999). Mutations abrogating the RNase activity in glycoprotein Erns of the pestivirus classical swine fever virus lead to virus attenuation. Journal of Virology 73, 10224-10235.[Abstract/Free Full Text]

Mummery, R. S. & Rider, C. C. (2000). Characterization of the heparin-binding properties of IL-6. Journal of Immunology 165, 5671-5679.[Abstract/Free Full Text]

Pocock, D. H., Howard, C. J., Clarke, M. C. & Brownlie, J. (1987). Variation in the intracellular polypeptide profiles from different isolates of bovine virus diarrhoea virus. Archives of Virology 94, 43-53.[Medline]

Pringle, C. R. (1998). The universal system of virus taxonomy of the International Committee on Virus Taxonomy (ICTV), including new proposals ratified since publication of the Sixth ICTV Report in 1995. Archives of Virology 143, 203-210.[Medline]

Proudfoot, A. E., Fritchley, S., Borlat, F., Shaw, J. P., Vilbois, F., Zwahlen, C., Trkola, A., Marchant, D., Clapham, P. R. & Wells, T. N. (2001). The BBXB motif of RANTES is the principal site for heparin binding and controls receptor selectivity. Journal of Biological Chemistry 276, 10620-10626.[Abstract/Free Full Text]

Rajcani, J. & Vojvodova, A. (1998). The role of herpes simplex virus glycoproteins in the virus replication cycle. Acta Virologica 42, 103-118.[Medline]

Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology , pp. 931-959. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Rumenapf, T., Unger, G., Strauss, J. H. & Thiel, H.-J. (1993). Processing of the envelope glycoproteins of pestiviruses. Journal of Virology 67, 3288-3294.[Abstract/Free Full Text]

Sa-Carvalho, D., Rieder, E., Baxt, B., Rodarte, R., Tanuri, A. & Mason, P. W. (1997). Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. Journal of Virology 71, 5115-5123.[Abstract/Free Full Text]

Schneider, R., Unger, G., Stark, R., Schneider-Scherzer, E. & Thiel, H.-J. (1993). Identification of a structural glycoprotein of an RNA virus as a ribonuclease. Science 261, 1169-1171.[Abstract/Free Full Text]

Seet, B. T., Barrett, J., Robichaud, J., Shilton, B., Singh, R. & McFadden, G. (2001). Glycosaminoglycan binding properties of the myxoma virus CC-chemokine inhibitor, M-T1. Journal of Biological Chemistry 276, 30504-30513.[Abstract/Free Full Text]

Smith, S. A., Mullin, N. P., Parkinson, J., Shchelkunov, S. N., Totmenin, A. V., Loparev, V. N., Srisatjaluk, R., Reynolds, D. N., Keeling, K. L., Justus, D. E., Barlow, P. N. & Kotwal, G. J. (2000). Conserved surface-exposed K/R-X-K/R motifs and net positive charge on poxvirus complement control proteins serve as putative heparin binding sites and contribute to inhibition of molecular interactions with human endothelial cells: a novel mechanism for evasion of host defense. Journal of Virology 74, 5659-5666.[Abstract/Free Full Text]

Sobel, M., Soler, D. F., Kermode, J. C. & Harris, R. B. (1992). Localization and characterization of a heparin binding domain peptide of human von Willebrand factor. Journal of Biological Chemistry 267, 8857-8862.[Abstract/Free Full Text]

Su, C. M., Liao, C. L., Lee, Y. L. & Lin, Y. L. (2001). Highly sulfated forms of heparin sulfate are involved in Japanese encephalitis virus infection. Virology 286, 206-215.[Medline]

Tal-Singer, R., Peng, C., Ponce De Leon, M., Abrams, W. R., Banfield, B. W., Tufaro, F., Cohen, G. H. & Eisenberg, R. J. (1995). Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules. Journal of Virology 69, 4471-4483.[Abstract/Free Full Text]

Terry-Allison, T., Montgomery, R. I., Warner, M. S., Geraghty, R. J. & Spear, P. G. (2001). Contributions of gD receptors and glycosaminoglycan sulfation to cell fusion mediated by herpes simplex virus 1. Virus Research 74, 39-45.[Medline]

Thiel, H.-J., Plagemann, G. W. & Moennig, V. (1996). The pestiviruses. In Fields Virology , pp. 1059-1073. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Trybala, E., Bergström, T., Svennerholm, B., Jeansson, S., Glorioso, J. C. & Olofsson, S. (1994). Localization of a functional site on herpes simplex virus type 1 glycoprotein C involved in binding to cell surface heparan sulphate. Journal of General Virology 75, 743-752.[Abstract/Free Full Text]

Windisch, J. M., Schneider, R., Stark, R., Weiland, E., Meyers, G. & Thiel, H.-J. (1996). RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies. Journal of Virology 70, 352-358.[Abstract/Free Full Text]

Wuppermann, F. N., Hegemann, J. H. & Jantos, C. A. (2001). Heparan sulfate-like glycosaminoglycan is a cellular receptor for Chlamydia pneumoniae. Journal of Infectious Diseases 184, 181-187.[Medline]

Received 14 December 2001; accepted 16 April 2002.


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. A. Tews and G. Meyers
The Pestivirus Glycoprotein Erns Is Anchored in Plane in the Membrane via an Amphipathic Helix
J. Biol. Chem., November 9, 2007; 282(45): 32730 - 32741.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Krey, E. Moussay, H.-J. Thiel, and T. Rumenapf
Role of the Low-Density Lipoprotein Receptor in Entry of Bovine Viral Diarrhea Virus
J. Virol., November 1, 2006; 80(21): 10862 - 10867.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Krey, A. Himmelreich, M. Heimann, C. Menge, H.-J. Thiel, K. Maurer, and T. Rumenapf
Function of Bovine CD46 as a Cellular Receptor for Bovine Viral Diarrhea Virus Is Determined by Complement Control Protein 1
J. Virol., April 15, 2006; 80(8): 3912 - 3922.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Fetzer, B. A. Tews, and G. Meyers
The Carboxy-Terminal Sequence of the Pestivirus Glycoprotein Erns Represents an Unusual Type of Membrane Anchor
J. Virol., September 15, 2005; 79(18): 11901 - 11913.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Maurer, T. Krey, V. Moennig, H.-J. Thiel, and T. Rumenapf
CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus
J. Virol., February 15, 2004; 78(4): 1792 - 1799.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Iqbal, E. Poole, S. Goodbourn, and J. W. McCauley
Role for Bovine Viral Diarrhea Virus Erns Glycoprotein in the Control of Activation of Beta Interferon by Double-Stranded RNA
J. Virol., January 1, 2004; 78(1): 136 - 145.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Agricola
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS