J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krondiris, J. V.
Right arrow Articles by Sideris, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krondiris, J. V.
Right arrow Articles by Sideris, D. C.
Agricola
Right arrow Articles by Krondiris, J. V.
Right arrow Articles by Sideris, D. C.
Journal of General Virology (2002), 83, 2211-2214.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Intramolecular disulfide bonding is essential for betanodavirus coat protein conformation

John V. Krondiris1 and Diamantis C. Sideris1

University of Athens, Faculty of Biology, Department of Biochemistry and Molecular Biology, Panepistimioupolis, 15701 Athens, Greece1

Author for correspondence: Diamantis Sideris. Fax +30 10 7274158. e-mail dsideris{at}biol.uoa.gr


   Abstract
TOP
Abstract
Main text
References
 
Here we report on the conformational changes that are responsible for the appearance of the Dicentrarchus labrax encephalitis virus (DlEV) coat protein as a doublet in SDS–PAGE. Wild-type and mutated forms of the coat protein cDNA were expressed in E. coli. The study of the resulting recombinant molecules excluded the possibility of the involvement of a precursor autocatalysis mechanism or a ribosomal frameshifting event in the doublet formation. The appearance of the coat protein doublet was found to be {beta}-mercaptoethanol sensitive. Based on this observation, we carried out substitution of all cysteine residues. The obtained results demonstrated the importance of intramolecular disulfide bonding between cysteines 187 and 201 on coat protein conformational changes.


   Main text
TOP
Abstract
Main text
References
 
Nodaviruses are a family of small non-enveloped, isometric viruses containing bipartite positive-sense RNA genomes, which are capped but not polyadenylated (Ball & Johnson, 1999Down ; Iwamoto et al., 2001Down ; Newman & Brown, 1976Down ). The family Nodaviridae contains two genera: the alphanodaviruses, which primarily infect insects, and the betanodaviruses, which infect fish (Ball et al., 2000Down ).

Alphanodaviruses are the most characterized nodavirus genus to date (Ball & Johnson, 1999Down ; Ball et al., 2000Down ; Johnson et al., 2000; Schneemann et al., 1998Down ). The larger genomic segment RNA1 encodes protein A, the viral contribution to the RNA-dependent RNA polymerase (RdRp). During RNA replication, a subgenomic RNA3 is synthesized, which is coterminal with RNA1 and encodes one or two small proteins (B1 and B2) with unknown functions. The smaller genomic segment, RNA2, encodes for the virion coat protein precursor {alpha}, which is autocatalytically cleaved to form the mature coat proteins {beta} and {gamma}, with approximate molecular masses of 40 and 4 kDa, respectively (Gallagher & Rueckert, 1988Down ). A conserved aspartate residue near the N terminus catalyses the cleavage of the coat protein precursor at a specific Asn–Ala site in all alphanodaviruses that have been examined, with the exception of Pariacoto virus (PaV) (Johnson et al., 2000Down ; Kaesberg et al., 1990Down ; Zlotnick et al., 1994Down ).

Betanodaviruses are the causative agents of viral nervous necrosis, which has been associated with high mortalities in a wide variety of marine fish species (Bovo et al., 1999Down ; Le Breton et al., 1997Down ; Munday & Nakai, 1997Down ; Skliris et al., 2001Down ). The complete nucleotide sequences of both RNAs are available only for two betanodaviruses, striped jack nervous necrosis virus (SJNNV) (Iwamoto et al., 2001Down ; Nishizawa et al., 1995Down ; Nagai & Nishizawa, 1999Down ) and greasy grouper nervous necrosis virus (GGNNV) (Tan et al., 2001Down ). The full-length RNA2 sequence has been determined for Dicentrarchus labrax encephalitis virus (DlEV) (Delsert et al., 1997aDown ), while partial RNA2 sequences from several other betanodaviruses are also now available (Aspehaug et al., 1999Down ; Nishizawa et al., 1995Down , 1997Down ; Sideris, 1997Down ; Skliris et al., 2001Down ). Molecular phylogenetic analyses of the partial coat protein gene have shown that fish nodaviruses are classified into four different genotypes (Nishizawa et al., 1997Down ; Skliris et al., 2001Down ). Although betanodaviruses process coat proteins of similar sizes to those of the alphanodaviruses, their amino acid sequences share less than 11% similarity (Nishizawa et al., 1995Down ). Furthermore, it has been suggested that the fish nodavirus capsid is made of a protein doublet of similar molecular mass and that its formation is the result of a processing pathway that is different from that of the alphanodaviruses (Delsert et al., 1997aDown , bDown ).

In the work presented here, we have studied the coat protein processing in DlEV by expression of cDNAs encoding the wild-type and a variety of mutants of this protein in E. coli. Our results indicate that the coat protein doublet formation is not the result of an autocatalytic cleavage of a precursor or of any kind of ribosomal frameshifting. Mutagenesis studies revealed that cysteines 187 and 201 form an intramolecular disulfide bond, which is responsible for the more rapid migration of the protein in SDS–PAGE than the totally reduced form of the coat protein.

The construction and structure of plasmid Fp5 expressing the wild-type DlEV coat protein (isolate Gr/16/Sba; Skliris et al., 2001Down ) in E. coli has been described previously (Sideris, 1997). This plasmid was used to create mutant constructs with the single mutations D75G, N288T, C115S, C187S, C201S and C331S, the double mutation C115,187S and finally the triple mutation C115,187,201S, using the Promega GeneEditor Site-Directed Mutagenesis System, according to the manufacturer’s recommendations. The primers used were as follows (mutation sites are underlined): D75G (5' CAGGAACAGGCGGATACG 3'), N288T (5' GCTGGAACTGCTGGCAC 3'), C115S (5' CAGCCAATGTCCCCCGCAAAC 3'), C187S (5' ATACTCCTGTCTGTCGGCAAC 3'), C201S (5' TCAGTGCTGTCTCGCTGGAGT 3') and C331S (5' GGCACTGTCTCCACCAGGGTT 3'). Nucleotide sequences of the coding regions of all mutant plasmids were confirmed by DNA sequencing analysis. Primers Fexp (5' catATGGTACGCAAAGGTGATAAG 3') and Rexp (5' ctcgagGTTTTCCGAGTCAACACGG 3') were used for PCR amplification of the plasmid Fp5 coding region. The sense primer Fexp (nt 1–21) included an additional three-base linker sequence, creating an NdeI recognition site. The antisense primer Rexp (complementary to nt 996–1014) included an additional six-base linker sequence creating a XhoI site. PCR products were cloned into the PCR 2.1 vector (Invitrogen), generating the plasmid FK. After double digestion, the insert was ligated into an expression vector, pET-20b (Novagen), and DNA sequencing analysis confirmed the insertion of the coding region of the DlEV coat protein gene into the recombinant plasmid E20.

Wild-type and mutant DlEV coat protein cDNAs were transformed into the AD494(DE3) strain of E. coli and subsequently induced in liquid culture by the addition of 1 mM IPTG. The recombinant proteins were found in the cellular insoluble fraction and were purified from the inclusion bodies by the His binding resin (Novagen) in the presence of 6 M urea, according to the manufacturer’s specifications.

SDS–PAGE analysis of the native or recombinant coat proteins was performed according to Laemmli (1970)Down . Polyacrylamide gels were either stained with Coomassie blue or electroblotted on to a nitrocellulose membrane as described by Towbin et al. (1979)Down . The coat protein was immunodetected using an anti-DlEV polyclonal antibody raised against the recombinant coat protein in rabbits.

Coat protein sequence alignment of different DlEV strains has revealed the conservation of residues N288 and A289, which form the cleavage site in the alphanodavirus precursor coat protein (Skliris et al., 2001; Zlotnick et al., 1994Down ). In order to determine whether the above residues are involved in a similar proteolytic cleavage event in betanodaviruses, experiments were performed using the Gr/16/Sba DlEV strain, which carries both the catalytic D75 residue and the potential cleavage site NA. The mutant constructs D75G and N288T, in which the residue D75 was replaced by G or the residue N288 was substituted by T were created using the Fp5 plasmid, which expressed the wild-type Gr/16/Sba DlEV coat protein. The resulting recombinant proteins were purified and analysed by SDS–PAGE. As shown in Fig. 1(A)Down, in all cases studied a protein doublet was detected, suggesting that substitution of D75 or N288 does not affect the formation of the two polypeptides. Identical results were obtained when the wild-type and mutant plasmids were transcribed and translated in vitro, using the T7 coupled reticulocyte system (data not shown). These findings suggested that autoproteolytic catalysis is not likely to be valid in betanodaviruses, without ruling out the possibility that other amino acids are essential for this process. In addition, our data are in good agreement with the results of Delsert et al. (1997aDown ), who showed that the absence of the NA site is not essential for capsid protein doublet formation. Therefore, the biosynthetic mechanism responsible for the production of the two proteins appears to be different from that seen in alphanodaviruses.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. SDS–PAGE of the purified DlEV recombinant coat protein expressed in E. coli from wild-type and mutated plasmids. (A) Lane 1, wild-type recombinant protein; lane 2, D75G mutated protein; lane 3, N288T mutated protein. (B) Lane 1, recombinant protein expressed in pET-19b vector; lane 2, recombinant protein expressed in pET-20b vector. Polyacrylamide gels (9%) were stained with Coomassie brilliant blue.

 
It is clearly established that many viruses utilize programmed ribosomal frameshifting for the production of their structural and enzymatic gene products (Brierley, 1995Down ; Dinman, 1995Down ; Farabaugh, 1996Down ; Gesteland & Atkins, 1996Down ). In order to test the validity of this mechanism in betanodavirus capsid protein formation, we cloned the cDNA encoding the DlEV coat protein into the pET-20b expression vector, which is designed to add six histidine residues at the C terminus of the recombinant protein. As shown in Fig. 1(B)Up (lane 2), SDS–PAGE analysis revealed the expression of two forms of the coat protein. Identical results were obtained in similar experiments using the pET-19b vector, which adds a His anchor at the N terminus of the recombinant protein (Fig. 1BUp, lane 1). This observation was interpreted as suggesting that the production of the two forms of the coat protein is not likely to be achieved using an alternative initiation codon at the translational level. Furthermore, the appearance of the two forms of the coat protein, despite the site of the His anchor addition, led us to the conclusion that the production of the two molecules was not the result of a ribosomal frameshifting event, but was rather due to a conformational change of the same protein molecule. This conformation change hypothesis is strongly supported by the data obtained by electrospray ionization mass spectrometry (ESI–MS) experiments. Mass spectra of coat protein expressed in pET-20b vector revealed one main peak of molecular mass 38187 Da. This value is very close to the expected value derived from the deduced amino acid sequence (38086 Da).

The relationship between the two forms of coat protein was examined by treating purified recombinant protein with different concentrations of {beta}-mercaptoethanol ({beta}-ME). SDS–PAGE analysis of the samples showed that treatment with 5 or 10% {beta}-ME resulted in the appearance of one band migrating at approximately 40 kDa, representing the totally reduced form of the coat protein (Fig. 2ADown, lanes 3 and 4). When {beta}-ME was removed from the sample by dialysis, a portion of the protein was reoxidized forming disulfide bond(s) and migrated again at 38 kDa (Fig. 2ADown, lane 5). Electrophoresis of proteins under non-reducing conditions has been used to characterize intramolecular disulfide bond formation in several viral protein molecules. Proteins containing intramolecular disulfide bonds are known to migrate more rapidly than totally reduced proteins due to the more compact nature of their structure (Braakman et al., 1992Down ; Doms et al., 1993Down ; Mulvey & Brown, 1994Down ). To determine whether cysteine residues are involved in the formation of disulfide bond(s) in the native DlEV coat protein, samples from homogenized brain and retinal tissues were obtained from infected fish and analysed under reducing and non-reducing conditions by SDS–PAGE followed by Western blotting. Analysis of the samples under non-reducing conditions revealed a major band running at 38 kDa (Fig. 2BDown, lane 1), whereas the fully reduced protein migrated at 40 kDa (Fig. 2BDown, lanes 4 and 5). Samples treated with 1 or 2% {beta}-ME represent both the oxidized and reduced forms of the coat protein (Fig. 2BDown, lanes 2 and 3). Additionally, when the {beta}-ME treated sample was dialysed against a buffer lacking {beta}-ME, a change of mobility from the reduced to the oxidized form of the coat protein was observed (Fig. 2BDown, lane 6). Since oligomers linked through intermolecular disulfide bonds were not detected in any sample, these data indicate that the DlEV coat protein acquires at least one intramolecular disulfide bond. The formation of this bond(s) is not restricted only in the case of DlEV, but seems to be common in betanodaviruses, since identical results were observed using brain homogenates obtained from other fish species infected by nodaviruses, such as striped jack (Pseudocaranx dentex) and barramundi (Lates calcarifer) (data not shown).



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 2. Effect of {beta}-mercaptoethanol on the migration of the DlEV coat protein in SDS–PAGE. (A) Equal amounts of purified recombinant coat protein were treated with Laemmli sample buffer containing 1% (lane 1), 2% (lane 2), 5% (lane 3) or 10 % (lane 4) {beta}-ME, and then subjected to SDS–PAGE. The sample in lane 5 was first treated with 10% {beta}-ME for 2 h, then dialysed against 20 mM Tris–HCl, pH 7·6, containing 6 M urea and finally subjected to SDS–PAGE under non-reducing conditions. (B) Samples from homogenized brain and retinal tissues obtained from DlEV infected sea bass were subjected to SDS–PAGE and Western blotting analysis, using a polyclonal antibody against the DlEV recombinant coat protein. Equal amounts of total protein extract were treated with Laemmli sample buffer without {beta}-ME (lanes 1 and 6) or buffer containing 1% (lane 2), 2% (lane 3), 5% (lane 4) or 10% (lane 5) {beta}-ME, and loaded into a 9% polyacrylamide gel. The sample in lane 6 was first treated with 10% {beta}-ME for 2 h and then was dialysed against 20 mM Tris–HCl, pH 7·6, containing 6 M urea.

 
To identify which cysteine residues participate in the formation of disulfide bond(s), all cysteine residues were substituted to serines by site-directed mutagenesis. The wild-type and mutated recombinant proteins were purified and analysed by SDS–PAGE. The protein doublet representing the faster-migrating oxidized and the fully reduced form of the wild-type coat protein (Fig. 3Down, lane 1) appeared when cysteine 115 or 331 was changed to serine (Fig. 3Down, lanes 2 and 5). In contrast, when cysteine 187 or 201 was substituted, only the totally reduced form of the coat protein was detected (Fig. 3Down, lanes 3 and 4). The double mutant at Cys 115 and 187 (Fig. 3Down, lane 6) and the triple mutant at positions 115, 187 and 201 (Fig. 3Down, lane 7) expressed only the reduced coat protein form. These data strongly suggested that the coat protein forms one intramolecular disulfide bond between cysteines 187 and 201. This finding is also supported by the observation that only these cysteine residues are strictly conserved in all betanodaviruses studied (Aspehaug et al., 1999Down ; Delsert et al., 1997aDown ; Nishizawa et al., 1995Down , 1997Down ; Skliris et al., 2001Down ). Therefore, it is possible that the formation of this disulfide bond is essential for the folding of the coat protein into a functional structure. Additional structural and in vivo studies are required for the understanding of the role of this disulfide bond in the stabilization, infectivity and assembly of the betanodavirus capsid.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. SDS–PAGE of the purified DlEV recombinant coat protein expressed in E. coli from wild-type and mutated plasmids. Lane 1, wild-type recombinant protein; lanes 2–7, mutated proteins C115S, C187S, C201S, C331S, C115,187S and C115,187,201S, respectively. The polyacrylamide gel (9%) was stained with Coomassie brilliant blue.

 

   Acknowledgments
 
This work was supported by a 97 YPER 2-23 grant from the Hellenic General Secreteriat of Research and Technology.


   References
TOP
Abstract
Main text
References
 
Aspehaug, V., Devold, M. & Nylund, A. (1999). The phylogenetic relationship of nervous necrosis virus from halibut (Hippoglossus hippoglossus). Bulletin of the European Association of Fish Pathologists 19, 196-202.

Ball, L. A. & Johnson, K. L. (1999). Reverse genetics of nodaviruses. Advances in Virus Research 53, 229-244.[Medline]

Ball, L. A., Hendry, D. A., Johnson, J. E., Rueckert, R. R. & Scotti, P. D. (2000). Family Nodaviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 747-755. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego: Academic Press.

Bovo, G., Nishizawa, T., Maltese, C., Borghesan, F., Mutinelli, F., Montesi, F. & De Mas, S. (1999). Viral encephalopathy and retinopathy of farmed marine fish species in Italy. Virus Research 63, 143-146.[Medline]

Braakman, I., Helenius, J. & Helenius, A. (1992). Manipulating disulfide bond formation and protein folding in the endoplasmic reticulum. EMBO Journal 11, 1717-1722.[Medline]

Brierley, I. (1995). Ribosomal frameshifting on viral RNAs. Journal of General Virology 76, 1885-1892.[Abstract/Free Full Text]

Delsert, C., Morin, N. & Comps, M. (1997a). A fish encephalitis virus that differs from other nodaviruses by its capsid protein processing. Archives of Virology 142, 2359-2371.[Medline]

Delsert, C., Morin, N. & Comps, M. (1997b). Fish nodavirus lytic cycle and semipermissive expression in mammalian and fish cell cultures. Journal of Virology 71, 5673-5677.[Abstract]

Dinman, J. D. (1995). Ribosomal frameshifting in yeast viruses. Yeast 11, 1115-1127.[Medline]

Doms, R. W., Lamb, R. A., Rose, J. R. & Helenius, A. (1993). Folding and assembly of viral membrane proteins. Virology 193, 545-562.[Medline]

Farabaugh, P. J. (1996). Programmed translational frameshifting. Microbiological Reviews 60, 103-134.[Free Full Text]

Gallagher, T. M. & Rueckert, R. R. (1988). Assembly-dependent maturation cleavage in provirions of a small icosahedral insect ribovirus. Journal of Virology 62, 3399-3406.[Abstract/Free Full Text]

Gesteland, R. F. & Atkins, J. F. (1996). Recoding: dynamic reprogramming of translation. Annual Review of Biochemistry 65, 741-768.[Medline]

Iwamoto, T., Mise, K., Mori, K., Arimoto, M., Nakai, T. & Okuno, T. (2001). Establishment of an infectious RNA transcription system for Striped jack nervous necrosis virus, the type species of the betanodaviruses. Journal of General Virology 82, 2653-2662.[Abstract/Free Full Text]

Johnson, K. N., Zeddam, J. L. & Ball, L. A. (2000). Characterization and construction of functional cDNA clones of Pariacoto virus, the first Alphanodavirus isolated outside Australasia. Journal of Virology 74, 5123-5132.[Abstract/Free Full Text]

Kaesberg, P., Dasgupta, R., Sgro, J. Y., Wery, J. P., Selling, B. H., Hosur, M. V. & Johnson, J. E. (1990). Structural homology among four nodaviruses as deduced by sequencing and X-ray crystallography. Journal of Molecular Biology 214, 423-435.[Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriaphage T4. Nature 227, 680-685.[Medline]

Le Breton, A., Grisez, L., Sweetman, J. & Ollevier, F. (1997). Viral nervous necrosis (VNN) associated with mass mortalities in cage-reared sea bass Dicentrarchus labrax. Journal of Fish Diseases 20, 145-151.

Mulvey, M. & Brown, D. T. (1994). Formation and rearrangement disulfide bonds during maturation of the Sindbis virus E1 glycoprotein. Journal of Virology 68, 805-812.[Abstract/Free Full Text]

Munday, B. L. & Nakai, T. (1997). Special topic review: nodaviruses as pathogens in larval and juvenile marine finfish. World Journal of Microbiology & Biotechnology 13, 375-381.

Nagai, T. & Nishizawa, T. (1999). Sequence of the non-structural protein gene encoded by RNA1 of striped jack nervous necrosis virus. Journal of General Virology 80, 3019-3022.[Abstract/Free Full Text]

Newman, J. F. E. & Brown, F. (1976). Absence of poly(A) from the infective RNA of nodamura virus. Journal of General Virology 30, 137-140.[Abstract/Free Full Text]

Nishizawa, T., Mori, K. I., Furuhashi, M., Nakai, T., Furusawa, I. & Muroga, K. (1995). Comparison of the coat protein genes of five fish nodaviruses, the causative agents of viral nervous necrosis in marine fish. Journal of General Virology 76, 1563-1569.[Abstract/Free Full Text]

Nishizawa, T., Furuhashi, M., Nagai, T., Nakai, T. & Muroga, K. (1997). Genomic classification of fish nodaviruses by molecular phylogenetic analysis of the coat protein gene. Applied and Environmental Microbiology 63, 1633-1636.[Abstract]

Schneemann, A., Reddy, V. & Johnson, J. E. (1998). The structure and function of nodavirus particles: a paradigm for understanding chemical biology. Advances in Virus Research 50, 381-446.[Medline]

Sideris, D. C. (1997). Cloning, expression and purification of the coat protein of encephalitis virus (DlEV) infecting Dicentrarchus labrax. Biochemistry and Molecular Biology International 42, 409-417.[Medline]

Skliris, G. P., Krondiris, J. V., Sideris, D. C., Shinn, A. P., Starkey, W. G. & Richards, R. H. (2001). Phylogenetic and antigenic characterization of new fish Nodavirus isolates from Europe and Asia. Virus Research 75, 59-67.[Medline]

Tan, C., Huang, B., Chang, S. F., Ngoh, G. H., Munday, B., Chen, S. C. & Kwang, J. (2001). Determination of the complete nucleotide sequences of RNA1 and RNA2 from greasy grouper (Epinephelus tauvina) nervous necrosis virus, Singapore strain. Journal of General Virology 82, 647-653.[Abstract/Free Full Text]

Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences, USA 76, 4350-4354.[Abstract/Free Full Text]

Zlotnick, A., Reddy, V. S., Dasgupta, R., Schneemann, A., Ray, W. J.Jr, Rueckert, R. R. & Johnson, J. E. (1994). Capsid assembly in a family of animal viruses primes an autoproteolytic maturation that depends on a single aspartic acid residue. Journal of Biological Chemistry 269, 13680-13684.[Abstract/Free Full Text]

Received 5 February 2002; accepted 23 April 2002.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krondiris, J. V.
Right arrow Articles by Sideris, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krondiris, J. V.
Right arrow Articles by Sideris, D. C.
Agricola
Right arrow Articles by Krondiris, J. V.
Right arrow Articles by Sideris, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS