|
|
||||||||
Animal: RNA Viruses |
University of Athens, Faculty of Biology, Department of Biochemistry and Molecular Biology, Panepistimioupolis, 15701 Athens, Greece1
Author for correspondence: Diamantis Sideris. Fax +30 10 7274158. e-mail dsideris{at}biol.uoa.gr
| Abstract |
|---|
|
|
|---|
-mercaptoethanol sensitive. Based on this observation, we carried out substitution of all cysteine residues. The obtained results demonstrated the importance of intramolecular disulfide bonding between cysteines 187 and 201 on coat protein conformational changes. | Main text |
|---|
|
|
|---|
Alphanodaviruses are the most characterized nodavirus genus to date (Ball & Johnson, 1999
; Ball et al., 2000
; Johnson et al., 2000; Schneemann et al., 1998
). The larger genomic segment RNA1 encodes protein A, the viral contribution to the RNA-dependent RNA polymerase (RdRp). During RNA replication, a subgenomic RNA3 is synthesized, which is coterminal with RNA1 and encodes one or two small proteins (B1 and B2) with unknown functions. The smaller genomic segment, RNA2, encodes for the virion coat protein precursor
, which is autocatalytically cleaved to form the mature coat proteins
and
, with approximate molecular masses of 40 and 4 kDa, respectively (Gallagher & Rueckert, 1988
). A conserved aspartate residue near the N terminus catalyses the cleavage of the coat protein precursor at a specific AsnAla site in all alphanodaviruses that have been examined, with the exception of Pariacoto virus (PaV) (Johnson et al., 2000
; Kaesberg et al., 1990
; Zlotnick et al., 1994
).
Betanodaviruses are the causative agents of viral nervous necrosis, which has been associated with high mortalities in a wide variety of marine fish species (Bovo et al., 1999
; Le Breton et al., 1997
; Munday & Nakai, 1997
; Skliris et al., 2001
). The complete nucleotide sequences of both RNAs are available only for two betanodaviruses, striped jack nervous necrosis virus (SJNNV) (Iwamoto et al., 2001
; Nishizawa et al., 1995
; Nagai & Nishizawa, 1999
) and greasy grouper nervous necrosis virus (GGNNV) (Tan et al., 2001
). The full-length RNA2 sequence has been determined for Dicentrarchus labrax encephalitis virus (DlEV) (Delsert et al., 1997a
), while partial RNA2 sequences from several other betanodaviruses are also now available (Aspehaug et al., 1999
; Nishizawa et al., 1995
, 1997
; Sideris, 1997
; Skliris et al., 2001
). Molecular phylogenetic analyses of the partial coat protein gene have shown that fish nodaviruses are classified into four different genotypes (Nishizawa et al., 1997
; Skliris et al., 2001
). Although betanodaviruses process coat proteins of similar sizes to those of the alphanodaviruses, their amino acid sequences share less than 11% similarity (Nishizawa et al., 1995
). Furthermore, it has been suggested that the fish nodavirus capsid is made of a protein doublet of similar molecular mass and that its formation is the result of a processing pathway that is different from that of the alphanodaviruses (Delsert et al., 1997a
, b
).
In the work presented here, we have studied the coat protein processing in DlEV by expression of cDNAs encoding the wild-type and a variety of mutants of this protein in E. coli. Our results indicate that the coat protein doublet formation is not the result of an autocatalytic cleavage of a precursor or of any kind of ribosomal frameshifting. Mutagenesis studies revealed that cysteines 187 and 201 form an intramolecular disulfide bond, which is responsible for the more rapid migration of the protein in SDSPAGE than the totally reduced form of the coat protein.
The construction and structure of plasmid Fp5 expressing the wild-type DlEV coat protein (isolate Gr/16/Sba; Skliris et al., 2001
) in E. coli has been described previously (Sideris, 1997). This plasmid was used to create mutant constructs with the single mutations D75G, N288T, C115S, C187S, C201S and C331S, the double mutation C115,187S and finally the triple mutation C115,187,201S, using the Promega GeneEditor Site-Directed Mutagenesis System, according to the manufacturers recommendations. The primers used were as follows (mutation sites are underlined): D75G (5' CAGGAACAGGCGGATACG 3'), N288T (5' GCTGGAACTGCTGGCAC 3'), C115S (5' CAGCCAATGTCCCCCGCAAAC 3'), C187S (5' ATACTCCTGTCTGTCGGCAAC 3'), C201S (5' TCAGTGCTGTCTCGCTGGAGT 3') and C331S (5' GGCACTGTCTCCACCAGGGTT 3'). Nucleotide sequences of the coding regions of all mutant plasmids were confirmed by DNA sequencing analysis. Primers Fexp (5' catATGGTACGCAAAGGTGATAAG 3') and Rexp (5' ctcgagGTTTTCCGAGTCAACACGG 3') were used for PCR amplification of the plasmid Fp5 coding region. The sense primer Fexp (nt 121) included an additional three-base linker sequence, creating an NdeI recognition site. The antisense primer Rexp (complementary to nt 9961014) included an additional six-base linker sequence creating a XhoI site. PCR products were cloned into the PCR 2.1 vector (Invitrogen), generating the plasmid FK. After double digestion, the insert was ligated into an expression vector, pET-20b (Novagen), and DNA sequencing analysis confirmed the insertion of the coding region of the DlEV coat protein gene into the recombinant plasmid E20.
Wild-type and mutant DlEV coat protein cDNAs were transformed into the AD494(DE3) strain of E. coli and subsequently induced in liquid culture by the addition of 1 mM IPTG. The recombinant proteins were found in the cellular insoluble fraction and were purified from the inclusion bodies by the His binding resin (Novagen) in the presence of 6 M urea, according to the manufacturers specifications.
SDSPAGE analysis of the native or recombinant coat proteins was performed according to Laemmli (1970)
. Polyacrylamide gels were either stained with Coomassie blue or electroblotted on to a nitrocellulose membrane as described by Towbin et al. (1979)
. The coat protein was immunodetected using an anti-DlEV polyclonal antibody raised against the recombinant coat protein in rabbits.
Coat protein sequence alignment of different DlEV strains has revealed the conservation of residues N288 and A289, which form the cleavage site in the alphanodavirus precursor coat protein (Skliris et al., 2001; Zlotnick et al., 1994
). In order to determine whether the above residues are involved in a similar proteolytic cleavage event in betanodaviruses, experiments were performed using the Gr/16/Sba DlEV strain, which carries both the catalytic D75 residue and the potential cleavage site NA. The mutant constructs D75G and N288T, in which the residue D75 was replaced by G or the residue N288 was substituted by T were created using the Fp5 plasmid, which expressed the wild-type Gr/16/Sba DlEV coat protein. The resulting recombinant proteins were purified and analysed by SDSPAGE. As shown in Fig. 1(A)
, in all cases studied a protein doublet was detected, suggesting that substitution of D75 or N288 does not affect the formation of the two polypeptides. Identical results were obtained when the wild-type and mutant plasmids were transcribed and translated in vitro, using the T7 coupled reticulocyte system (data not shown). These findings suggested that autoproteolytic catalysis is not likely to be valid in betanodaviruses, without ruling out the possibility that other amino acids are essential for this process. In addition, our data are in good agreement with the results of Delsert et al. (1997a
), who showed that the absence of the NA site is not essential for capsid protein doublet formation. Therefore, the biosynthetic mechanism responsible for the production of the two proteins appears to be different from that seen in alphanodaviruses.
|
The relationship between the two forms of coat protein was examined by treating purified recombinant protein with different concentrations of
-mercaptoethanol (
-ME). SDSPAGE analysis of the samples showed that treatment with 5 or 10%
-ME resulted in the appearance of one band migrating at approximately 40 kDa, representing the totally reduced form of the coat protein (Fig. 2A
, lanes 3 and 4). When
-ME was removed from the sample by dialysis, a portion of the protein was reoxidized forming disulfide bond(s) and migrated again at 38 kDa (Fig. 2A
, lane 5). Electrophoresis of proteins under non-reducing conditions has been used to characterize intramolecular disulfide bond formation in several viral protein molecules. Proteins containing intramolecular disulfide bonds are known to migrate more rapidly than totally reduced proteins due to the more compact nature of their structure (Braakman et al., 1992
; Doms et al., 1993
; Mulvey & Brown, 1994
). To determine whether cysteine residues are involved in the formation of disulfide bond(s) in the native DlEV coat protein, samples from homogenized brain and retinal tissues were obtained from infected fish and analysed under reducing and non-reducing conditions by SDSPAGE followed by Western blotting. Analysis of the samples under non-reducing conditions revealed a major band running at 38 kDa (Fig. 2B
, lane 1), whereas the fully reduced protein migrated at 40 kDa (Fig. 2B
, lanes 4 and 5). Samples treated with 1 or 2%
-ME represent both the oxidized and reduced forms of the coat protein (Fig. 2B
, lanes 2 and 3). Additionally, when the
-ME treated sample was dialysed against a buffer lacking
-ME, a change of mobility from the reduced to the oxidized form of the coat protein was observed (Fig. 2B
, lane 6). Since oligomers linked through intermolecular disulfide bonds were not detected in any sample, these data indicate that the DlEV coat protein acquires at least one intramolecular disulfide bond. The formation of this bond(s) is not restricted only in the case of DlEV, but seems to be common in betanodaviruses, since identical results were observed using brain homogenates obtained from other fish species infected by nodaviruses, such as striped jack (Pseudocaranx dentex) and barramundi (Lates calcarifer) (data not shown).
|
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ball, L. A. & Johnson, K. L. (1999). Reverse genetics of nodaviruses. Advances in Virus Research 53, 229-244.[Medline]
Ball, L. A., Hendry, D. A., Johnson, J. E., Rueckert, R. R. & Scotti, P. D. (2000). Family Nodaviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 747-755. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego: Academic Press.
Bovo, G., Nishizawa, T., Maltese, C., Borghesan, F., Mutinelli, F., Montesi, F. & De Mas, S. (1999). Viral encephalopathy and retinopathy of farmed marine fish species in Italy. Virus Research 63, 143-146.[Medline]
Braakman, I., Helenius, J. & Helenius, A. (1992). Manipulating disulfide bond formation and protein folding in the endoplasmic reticulum. EMBO Journal 11, 1717-1722.[Medline]
Brierley, I. (1995). Ribosomal frameshifting on viral RNAs. Journal of General Virology 76, 1885-1892.
Delsert, C., Morin, N. & Comps, M. (1997a). A fish encephalitis virus that differs from other nodaviruses by its capsid protein processing. Archives of Virology 142, 2359-2371.[Medline]
Delsert, C., Morin, N. & Comps, M. (1997b). Fish nodavirus lytic cycle and semipermissive expression in mammalian and fish cell cultures. Journal of Virology 71, 5673-5677.[Abstract]
Dinman, J. D. (1995). Ribosomal frameshifting in yeast viruses. Yeast 11, 1115-1127.[Medline]
Doms, R. W., Lamb, R. A., Rose, J. R. & Helenius, A. (1993). Folding and assembly of viral membrane proteins. Virology 193, 545-562.[Medline]
Farabaugh, P. J. (1996). Programmed translational frameshifting. Microbiological Reviews 60, 103-134.
Gallagher, T. M. & Rueckert, R. R. (1988). Assembly-dependent maturation cleavage in provirions of a small icosahedral insect ribovirus. Journal of Virology 62, 3399-3406.
Gesteland, R. F. & Atkins, J. F. (1996). Recoding: dynamic reprogramming of translation. Annual Review of Biochemistry 65, 741-768.[Medline]
Iwamoto, T., Mise, K., Mori, K., Arimoto, M., Nakai, T. & Okuno, T. (2001). Establishment of an infectious RNA transcription system for Striped jack nervous necrosis virus, the type species of the betanodaviruses. Journal of General Virology 82, 2653-2662.
Johnson, K. N., Zeddam, J. L. & Ball, L. A. (2000). Characterization and construction of functional cDNA clones of Pariacoto virus, the first Alphanodavirus isolated outside Australasia. Journal of Virology 74, 5123-5132.
Kaesberg, P., Dasgupta, R., Sgro, J. Y., Wery, J. P., Selling, B. H., Hosur, M. V. & Johnson, J. E. (1990). Structural homology among four nodaviruses as deduced by sequencing and X-ray crystallography. Journal of Molecular Biology 214, 423-435.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriaphage T4. Nature 227, 680-685.[Medline]
Le Breton, A., Grisez, L., Sweetman, J. & Ollevier, F. (1997). Viral nervous necrosis (VNN) associated with mass mortalities in cage-reared sea bass Dicentrarchus labrax. Journal of Fish Diseases 20, 145-151.
Mulvey, M. & Brown, D. T. (1994). Formation and rearrangement disulfide bonds during maturation of the Sindbis virus E1 glycoprotein. Journal of Virology 68, 805-812.
Munday, B. L. & Nakai, T. (1997). Special topic review: nodaviruses as pathogens in larval and juvenile marine finfish. World Journal of Microbiology & Biotechnology 13, 375-381.
Nagai, T. & Nishizawa, T. (1999). Sequence of the non-structural protein gene encoded by RNA1 of striped jack nervous necrosis virus. Journal of General Virology 80, 3019-3022.
Newman, J. F. E. & Brown, F. (1976). Absence of poly(A) from the infective RNA of nodamura virus. Journal of General Virology 30, 137-140.
Nishizawa, T., Mori, K. I., Furuhashi, M., Nakai, T., Furusawa, I. & Muroga, K. (1995). Comparison of the coat protein genes of five fish nodaviruses, the causative agents of viral nervous necrosis in marine fish. Journal of General Virology 76, 1563-1569.
Nishizawa, T., Furuhashi, M., Nagai, T., Nakai, T. & Muroga, K. (1997). Genomic classification of fish nodaviruses by molecular phylogenetic analysis of the coat protein gene. Applied and Environmental Microbiology 63, 1633-1636.[Abstract]
Schneemann, A., Reddy, V. & Johnson, J. E. (1998). The structure and function of nodavirus particles: a paradigm for understanding chemical biology. Advances in Virus Research 50, 381-446.[Medline]
Sideris, D. C. (1997). Cloning, expression and purification of the coat protein of encephalitis virus (DlEV) infecting Dicentrarchus labrax. Biochemistry and Molecular Biology International 42, 409-417.[Medline]
Skliris, G. P., Krondiris, J. V., Sideris, D. C., Shinn, A. P., Starkey, W. G. & Richards, R. H. (2001). Phylogenetic and antigenic characterization of new fish Nodavirus isolates from Europe and Asia. Virus Research 75, 59-67.[Medline]
Tan, C., Huang, B., Chang, S. F., Ngoh, G. H., Munday, B., Chen, S. C. & Kwang, J. (2001). Determination of the complete nucleotide sequences of RNA1 and RNA2 from greasy grouper (Epinephelus tauvina) nervous necrosis virus, Singapore strain. Journal of General Virology 82, 647-653.
Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences, USA 76, 4350-4354.
Zlotnick, A., Reddy, V. S., Dasgupta, R., Schneemann, A., Ray, W. J.Jr, Rueckert, R. R. & Johnson, J. E. (1994). Capsid assembly in a family of animal viruses primes an autoproteolytic maturation that depends on a single aspartic acid residue. Journal of Biological Chemistry 269, 13680-13684.
Received 5 February 2002;
accepted 23 April 2002.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |