|
|
||||||||
Animal: RNA Viruses |
Wohl Virion Centre, The Windeyer Institute of Medical Sciences, University College London, 46 Cleveland Street, London W1T 4JF, UK1
Author for correspondence: Yasuhiro Takeuchi. Fax +44 207 679 9555. e-mail y.takeuchi{at}ucl.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Among several PERV families within the pig genome (Ericsson et al., 2001
; Patience et al., 2001
), one family produces infectious viruses whose closest relatives are the gammaretroviruses gibbon ape leukaemia virus (GALV) and mouse leukaemia virus (MLV) (Le Tissier et al., 1997
; Patience et al., 1997
; Akiyoshi et al., 1998
). Since the discovery of PERVs in the 1970s (Breese, 1970
; Armstrong et al., 1971
; Todaro et al., 1974
), it has been shown that several pig cell lines, including the pig kidney cell line PK-15, as well as primary pig cells such as endothelial and mitogenically activated peripheral blood mononuclear cells release PERV particles which are infectious for human cells (Patience et al., 1997
; Martin et al., 1998a
, 2000a
, b
; Wilson et al., 1998
, 2000
). Molecular isolation and analysis of partial and full-length proviruses confirmed the presence of at least three different classes of PERV genomes, termed PERV-A, -B and -C, with high homology in the gag and pol genes but a significant divergence within sequences encoding the outer envelope glycoprotein (Le Tissier et al., 1997
; Patience et al., 1997
; Akiyoshi et al., 1998
; Czauderna et al., 2000
; Wilson et al., 2000
; Krach et al., 2001
). Pseudotyping experiments with the PERV envelope glycoproteins indicated that PERV-A, -B and -C use different receptors from each other for cell entry (Takeuchi et al., 1998
) and that a significant number of cell lines of human and animal origin are permissive to entry of PERV-A and -B. While it was shown that the host range of PERV-C is mostly restricted to porcine cells (Takeuchi et al., 1998
), a range of different cell lines derived from human, primates, mink, mouse, rat, rabbit, bat, hamster and dog is permissive to entry of PERV-A and/or -B (Takeuchi et al., 1998
; Blusch et al., 2000
; Martin et al., 2000a
, b
; Wilson et al., 2000
). PERV-A and -B can productively infect human primary cells of endothelial and vascular origin (Martin et al., 2000a
, b
), cell types which would become extensively exposed to potential xenografts.
PERVs have thus raised major concern regarding the safety of xenotransplantation, and the potential of cross-species infection by PERV has been reported by recent findings of PERV infection in non-obese diabetic severe combined immunodeficiency (NOD-SCID) mice after pig islet cell transplantation (Deng et al., 2000
; van der Laan et al., 2000
). However, studies of immunosuppressed non-human primates (Martin et al., 1998b
; Switzer et al., 1999
; Templin et al., 2000
; Winkler et al., 2000
) and extensive retrospective studies of patients treated with living pig tissues or cells mostly for a short period of time did not result in any evidence of PERV infection (Patience et al., 1998
; Heneine et al., 1998
, 2001
; Paradis et al., 1999
; Pitkin & Mullon, 1999
; Dinsmore et al., 2000
; Herring et al., 2001
; Tacke et al., 2001
). While the lack of evidence of PERV infection in primates and humans has been reassuring, these observations do not rule out that a risk exists.
Pig genomes have been reported to contain up to 50 copies of PERV, although many of them are likely to be defective (Patience et al., 1997
; Le Tissier et al., 1997
; Akiyoshi et al., 1998
; Bosch et al., 2000
; Krach et al., 2001
). PERV integration patterns in different pig individuals showed only limited conservation (Le Tissier et al., 1997
), suggesting that individual pigs harbour different sets of PERV with significant heterogeneity. Because retroviruses can evolve fast, it is possible that new forms of infectious PERV will emerge in the process of xenotransplantation. Replication competent, molecular clones of PERV will be useful to study PERV biology by genetic approaches. Infectious clones have recently been isolated by screening a phage genomic library derived from human 293 cells infected with PK15-derived PERV (Czauderna et al., 2000
; Krach et al., 2001
). In this study, we isolated infectious PERV clones using a PCR-based method, which is less labour intensive and more widely applicable than the classical method of phage library construction followed by hybridization screening. In addition, a titration method for PERV infection was established using polyclonal antibodies raised against PERV capsid protein, which allowed us to quantitatively compare infectivity of PERV-A and -B clones and their parental isolates as well as other standard gammaretrovirus strains.
| Methods |
|---|
|
|
|---|
PCR based cloning.
PCR screening.
PCR reactions were performed in 50 µl volumes using Taq polymerase (Promega) according to the manufacturers instructions with 50 to 100 ng genomic DNA as template. Reactions were run at standard conditions using an extension time of 1 min per kb target sequence. Primer sequences for different amplicons were previously described (Patience et al., 1997
).
Bacterial expression of capsid protein.
A His-tagged capsid (His6-capsid) expression vector was constructed by PCR with Pfu polymerase (Stratagene) and the primers (+) GATCGCCATGGTACCGCTGCGCACCTATGG and (-) CCACCTCGAGCAAGATCTTAGTCAAAT. A capsid-encoding 800 bp band was amplified using cycling conditions of 94 °C for 4 min followed by 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 56 °C followed by 1 min 20 s extension at 72 °C. The PCR product was purified with the QIAquick PCR Purification Kit, digested with the restriction enzymes XhoI and NcoI and ligated into the XhoI/NcoI-digested bacterial expression vector pET21D (Novagen). Expression of the His6-capsid protein was performed in the bacterial strain BL21 DE3 codon + (Stratagene). When 3 litres of bacterial culture reached an OD595 of 0·5, protein expression was induced with IPTG at a final concentration of 1 mM and the culture incubated with shaking at 37 °C for 4 h. After harvest the bacterial pellet was resuspended in 250 ml lysis buffer containing 50 mM Tris, 150 mM NaCl, 5 mM imidazole pH 8, 1 mM PMSF and protease inhibitor cocktail (Roche). Lysozyme was added to a final concentration of 0·1 mg/ml. To aid lysis the culture was freezethawed once and then sonicated followed by a 30 min centrifugation at 11000 r.p.m. at 4 °C. The supernatant containing the soluble protein fraction was batch-bound to 3 ml Ni2+agarose beads (Qiagen) for 1·5 h at 4 °C on a rotating wheel. The beads were then loaded onto a column and washed sequentially with (a) 50 ml of 50 mM Tris, 600 mM NaCl, 5 mM imidazole pH 8, 0·1% Tween, 0·1% Triton X-100, (b) 50 ml of 50 mM Tris, 150 mM NaCl, 5 mM imidazole pH 8, 0·1% Tween, 0·1% Triton X-100 and (c) 50 ml of 50 mM Tris, 150 mM NaCl, 10 mM imidazole pH 8, 0·1% Tween, 0·1% Triton X-100. The His6-caspid protein was eluted in a buffer consisting of 50 mM Tris, 150 mM NaCl, 100 mM imidazole pH 8, 1 mM PMSF and protease inhibitor cocktail. His6-capsid fractions were pooled and dialysed against 50 mM Tris, 150 mM NaCl, 0·5 mM DTT at 4 °C overnight.
Antibody production.
His6-capsid protein (440 µg) was adjusted to a volume of 2 ml with PBS and added to one vial of the adjuvant MPL+TDM+CWS (M6661, Sigma), according to the manufacturers instructions, and injected into a rabbit. Total serum was recovered after four further boosts with the same antigen/adjuvant preparation.
Immunoblotting and in situ staining.
Cell-lysates were analysed by SDSPAGE, transferred onto nitrocellulose membrane using a semi-dry blotting system (Hoefer) and probed with rabbit antibodies (dilution was 1/500 for the antibody produced in this study as well as that obtained from Q-One Biotech) using chemiluminescence-based detection (Amersham) according to the manufacturers instructions.
The detection of lacZ pseudotypes was performed as previously described (Takeuchi et al., 1994
). For in situ staining with anti-PERV capsid antibody 293 cells were fixed for 15 min with an ice-cold 1:1 mixture of methanol and acetone and then left to dry. Fixed cells were stored at -20 °C if not processed immediately. Cells were washed twice in PBS and then blocked for 10 min at room temperature with PBS containing 10% foetal calf serum (FCS) followed by a 1 h incubation with PBS containing 1% FCS and anti-PERV capsid antibody at a dilution of 1:250. This was followed by two washes in PBS, 1% FCS and a 1 h incubation with PBS, 1% FCS containing secondary goat anti-rabbit antibody conjugated to alkaline phosphatase (Jackson). After two washes in PBS, 1% FCS and two washes in PBS, alkaline phosphatase was detected using NBT/BCIP ready-to-use tablets (Roche) according to the manufacturers instructions.
Viruses and cell culture.
The origins of the MLV-A and GALV SF virus strains, the lacZ pseudotypes and the human embryonic kidney fibroblasts 293 used here have been described previously (Takeuchi et al., 1998
). The cell-free infection was carried out essentially as described previously (Takeuchi et al., 1994
). Briefly, 104 cells per well of 293 cells were seeded in a 96-multiwell plate; 24 h later virus dilutions were added in the presence of 4 µg/ml polybrene and then incubated for 3 days before fixation and staining. Transfections into 293 cells were performed using lipofectamine from GIBCO according to the manufacturers instructions.
Nucleotide sequence accession numbers.
The complete nucleotide sequences of PERV-17 (AY099324) and PERV-60 (AY099323) have been deposited at GenBank. Sequences used for sequence comparison are PK15-ERV (AF038601) (Akiyoshi et al., 1998
), 293-PERV-A(42) (AJ133817) (Krach et al., 2001
) and 293-PERV-B(43) (AJ133818) (Czauderna et al., 2000
).
| Results and Discussion |
|---|
|
|
|---|
|
|
|
Genome analysis of infectious PERV- A and -B clones
To determine their genomic structure, proviruses PERV-17 and -60 were sequenced and compared to three PK-15-derived PERV database sequences. 293-PERV-A(42) and 293-PERV-B(43) are infectious clones from a
phage library based on 293 cells infected with PK-15 supernatant (Czauderna et al., 2000
; Krach et al., 2001
). PK15-ERV is a PERV-A cDNA clone from PK-15 cells which is non-infectious due to deletions in pol and at the beginning of the env open reading frame (Akiyoshi et al., 1998
). The isolated proviruses PERV-60 and PERV-17 consist of 8714 and 8704 nt, respectively, and are 99% identical to the corresponding sequences displayed by 293-PERV-A(42) and 293-PERV-B(43), respectively.
The sequence differences between PERV-60 and 293-PERV-A(42) as well as between PERV-17 and 293-PERV-B(43) are summarized in Table 1
. While the LTRs and leader sequence contained interesting changes, the open reading frames of gag, pol and env were found to be highly homologous to database PERV sequences. Overall, the majority of base changes found in the genomes of PERV-17 and -60 were conserved in PK15-ERV and were also present in two or more of the five separately isolated molecular PERV clones (data not shown). This suggests that most of these changes reflect the sequence of the template proviruses rather than PCR errors. Limited sequencing of the other three infectious clones proved that they have small number of base changes and therefore are independent clones.
|
The LTR and leader sequences of PERV-17 and -60 were highly homologous to those of 293-PERV-A(42) and 293-PERV-B(43) with 97 and 98% nucleotide identity, respectively. Within U3 of the 5' LTR PERV-60 contained a deletion of 39 nt compared to 293-PERV-A(42). This sequence motif has previously been shown to act as viral enhancer and to multimerize dynamically upon serial passage of PERV in human cells (Scheef et al., 2001
). PERV-17 and -60 contain two such enhancer repeats within their 5' LTR and three within their 3' LTR. The 5' LTR of PERV-60 was also found to contain a base triplet insertion (CGC) located 5 nt downstream of the transcriptional start site at the beginning of R (Czauderna et al., 2000
), which is not present in any other PERV sequence and whose function is unknown.
The primer binding sites (PBS) of 293-PERV-A(42) and 293-PERV-B(43) are complementary to the last 18 nt of tRNAGly but differ from those of PERV-60 and -17 at one position (G677A, G638A, respectively), as shown in Table 2
. However, this change is conserved in other endogenous retroviruses, feline RD114 and yellow baboon (Papio cynocephalus) endogenous retrovirus (Mang et al., 1999
; van der Kuyl et al., 1999
), and a database search (Sprinzel et al., 1999
) identified this sequence as complementary to a human tRNAGly sequence. The PBS of PERV-17 contains an additional base change (T640G) which is only conserved in a mouse retrovirus-like 30S genetic element. The effect of this second base change in the PBS of PERV-17 on priming of reverse transcription is unclear but overall the replication efficiency of this virus was comparable to that of the other molecular and biological PERV isolates (data not shown). PBS changes have not been reported for PERV previously. While HIV as well as avian viruses have been shown to be stringent in tRNA primer utilization, MLV, a close relative of PERV seems to have less stringent requirements. Similar to our observations for PERV, endogenous MLVs with altered PBSs have been isolated (Nikbakht et al., 1985
; Colicelli & Goff, 1986
; Petersen et al., 1991
; Yamauchi et al., 1995
; Lund et al., 2000
). However, subtle base changes in the PBS of MLV have been shown to restore replication in a non-permissive embryonic stem cell-line through the disruption of a negative regulatory element in the immediate vicinity of the PBS (Petersen et al., 1991
; Yamauchi et al., 1995
). While the alterations in the PBS had no effect on the replication efficiency of our PERV clones in 293 cells, it remains to be determined whether this is the case in other cell types. The remainder of the leader sequence of PERV-17 contained three further nucleotide changes and one insert of 8 nt compared to 293-PERV-B(43), but all these changes were conserved in PERV-A sequences.
|
|
|
Endogenous retroviruses are known to evolve rapidly and only minor genetic variations within retroviral genomes have been shown to alter tropism in the past. Up to now very few infectious clones of PERV have been analysed and assessed for their ability to evolve by mutation or recombination, and indeed one PERV envelope recombinant has already been reported (Wilson et al., 2000
). In order to understand PERV replication and its associated risks for humans in xenotransplantation it will be important to isolate various different PERV genomes from different sources to assess their infectivity as well as their ability to mutate or recombine into novel forms with altered biological properties. We isolated PERV-A and -B proviruses with the same infectious properties as their parent isolates by a PCR-based method. These clones will be useful as standard clones, whilst this cloning method, in combination with the sensitive and quantitative immunocytological detection method described here, will be useful to address these issues.
| Acknowledgments |
|---|
| Footnotes |
|---|
Present address: Laboratoire de Vectorologie Rétrovirale et Thérapie Génique, INSERM U412, École Normale Supérieure de Lyon, 46 allée d'Italie, 69364 Lyon Cedex 07, France. | References |
|---|
|
|
|---|
Armstrong, J. A., Porterfield, J. S. & De Madrid, A. T. (1971). C-type virus particles in pig kidney cell lines. Journal of General Virology 10, 195-198.
Birmingham, K. (1999). FDA subcommittee finds no evidence of PERV transmission. Nature Medicine 5, 855.
Blusch, J. H., Patience, C., Takeuchi, Y., Templin, C., Roos, C., Von Der Helm, K., Steinhoff, G. & Martin, U. (2000). Infection of nonhuman primate cells by pig endogenous retrovirus. Journal of Virology 74, 7687-7690.
Bosch, S., Arnauld, C. & Jestin, A. (2000). Study of full-length porcine endogenous retrovirus genomes with envelope gene polymorphism in a specific-pathogen-free Large White swine herd. Journal of Virology 74, 8575-8581.
Breese, S. S.Jr (1970). Virus-like particles occurring in cultures of stable pig kidney cell lines. Archiv für die Gesamte Virusforschung 30, 401-404.[Medline]
Colicelli, J. & Goff, S. P. (1986). Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA. Journal of Virology 57, 37-45.
Cozzi, E., Masroor, S., Soin, B., Vial, C. & White, D. J. (2000). Progress in xenotransplantation. Clinical Nephrology 53, 13-18.
Czauderna, F., Fischer, N., Boller, K., Kurth, R. & Tonjes, R. R. (2000). Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. Journal of Virology 74, 4028-4038.
Deng, Y. M., Tuch, B. E. & Rawlinson, W. D. (2000). Transmission of porcine endogenous retroviruses in severe combined immunodeficient mice xenotransplanted with fetal porcine pancreatic cells. Transplantation 70, 1010-1016.[Medline]
Dinsmore, J. H., Manhart, C., Raineri, R., Jacoby, D. B. & Moore, A. (2000). No evidence for infection of human cells with porcine endogenous retrovirus (PERV) after exposure to porcine fetal neuronal cells. Transplantation 70, 1382-1389.[Medline]
Ericsson, T., Oldmixon, B., Blomberg, J., Rosa, M., Patience, C. & Andersson, G. (2001). Identification of novel porcine endogenous betaretrovirus sequences in miniature swine. Journal of Virology 75, 2765-2770.
Heneine, W., Tibell, A., Switzer, W. M., Sandstrom, P., Rosales, G. V., Mathews, A., Korsgren, O., Chapman, L. E., Folks, T. M. & Groth, C. G. (1998). No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet 352, 695-699.[Medline]
Heneine, W., Switzer, W. M., Soucie, J. M., Evatt, B. L., Shanmugam, V., Rosales, G. V., Matthews, A., Sandstrom, P. & Folks, T. M. (2001). Evidence of porcine endogenous retroviruses in porcine factor VIII and evaluation of transmission to recipients with hemophilia. Journal of Infectious Diseases 183, 648-652.[Medline]
Herring, C., Cunningham, D. A., Whittam, A. J., Fernandez-Suarez, M. & Langford, G. A. (2001). Monitoring xenotransplant recipients for infection by PERV. Clinical Biochemistry 34, 23-27.[Medline]
Krach, U., Fischer, N., Czauderna, F., Kurth, R. & Tonjes, R. R. (2000). Generation and testing of a highly specific anti-serum directed against porcine endogenous retrovirus nucleocapsid. Xenotransplantation 7, 221-229.[Medline]
Krach, U., Fischer, N., Czauderna, F. & Tonjes, R. R. (2001). Comparison of replication-competent molecular clones of porcine endogenous retrovirus class A and class B derived from pig and human cells. Journal of Virology 75, 5465-5472.
Le Tissier, P., Stoye, J. P., Takeuchi, Y., Patience, C. & Weiss, R. A. (1997). Two sets of human-tropic pig retrovirus. Nature 389, 681-682.[Medline]
Lund, A. H., Duch, M. & Pedersen, F. S. (2000). Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication. Nucleic Acids Research 28, 791-799.
Mang, R., Goudsmit, J. & van der Kuyl, A. C. (1999). Novel endogenous type C retrovirus in baboons: complete sequence, providing evidence for baboon endogenous virus gagpol ancestry. Journal of Virology 73, 7021-7026.
Martin, U., Kiessig, V., Blusch, J. H., Haverich, A., von der Helm, K., Herden, T. & Steinhoff, G. (1998a). Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352, 692-694.[Medline]
Martin, U., Steinhoff, G., Kiessig, V., Chikobava, M., Anssar, M., Morschheuser, T., Lapin, B. & Haverich, A. (1998b). Porcine endogenous retrovirus (PERV) was not transmitted from transplanted porcine endothelial cells to baboons in vivo. Transplantation International 11, 247-251.
Martin, U., Winkler, M. E., Id, M., Radecke, H., Arseniev, L., Groteluschen, R., Simon, A. R. & Steinhoff, G. (2000a). Transmission of pig endogenous retrovirus to primary human cells. Transplantation Proceedings 32, 1157.[Medline]
Martin, U., Winkler, M. E., Id, M., Radeke, H., Arseniev, L., Takeuchi, Y., Simon, A. R., Patience, C., Haverich, A. & Steinhoff, G. (2000b). Productive infection of primary human endothelial cells by pig endogenous retrovirus (PERV). Xenotransplantation 7, 138-142.[Medline]
Nikbakht, K. N., Ou, C. Y., Boone, L. R., Glover, P. L. & Yang, Z. K. (1985). Nucleotide sequence analysis of endogenous murine leukemia virus-related proviral clones reveals primer-binding sites for glutamine tRNA. Journal of Virology 54, 889-893.
Paradis, K., Langford, G., Long, Z., Heneine, W., Sandstrom, P., Switzer, W. M., Chapman, L. E., Lockey, C., Onions, D. & Otto, E. (1999). Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285, 1236-1241.
Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282-286.[Medline]
Patience, C., Patton, G. S., Takeuchi, Y., Weiss, R. A., McClure, M. O., Rydberg, L. & Breimer, M. E. (1998). No evidence of pig DNA or retroviral infection in patients with short- term extracorporeal connection to pig kidneys. Lancet 352, 699-701.[Medline]
Patience, C., Switzer, W. M., Takeuchi, Y., Griffiths, D. J., Goward, M. E., Heneine, W., Stoye, J. P. & Weiss, R. A. (2001). Multiple groups of novel retroviral genomes in pigs and related species. Journal of Virology 75, 2771-2775.
Petersen, R., Kempler, G. & Barklis, E. (1991). A stem cell-specific silencer in the primer-binding site of a retrovirus. Molecular Cell Biology 11, 1214-1221.
Pitkin, Z. & Mullon, C. (1999). Evidence of absence of porcine endogenous retrovirus (PERV) infection in patients treated with a bioartificial liver support system. Artificial Organs 23, 829-833.[Medline]
Platt, J. L. (2000). Xenotransplantation. New risks, new gains. Nature 407, 27, 2930.[Medline]
Qari, S. H., Magre, S., Garcia-Lerma, J. G., Hussain, A. I., Takeuchi, Y., Patience, C., Weiss, R. A. & Heneine, W. (2001). Susceptibility of the porcine endogenous retrovirus to reverse transcriptase and protease inhibitors. Journal of Virology 75, 1048-1053.
Scheef, G., Fischer, N., Krach, U. & Tonjes, R. R. (2001). The number of a U3 repeat box acting as an enhancer in long terminal repeats of polytropic replication-competent porcine endogenous retroviruses dynamically fluctuates during serial virus passages in human cells. Journal of Virology 75, 6933-6940.
Simmons, G., McKnight, A., Takeuchi, Y., Hoshino, H. & Clapham, P. R. (1995). Cell-to-cell fusion, but not virus entry in macrophages by T-cell line tropic HIV-1 strains: a V3 loop-determined restriction. Virology 209, 696-700.[Medline]
Sprinzel, M., Vassilenko, K. S., Emmerich, J. & Bauer, F. (1999). Compilation of tRNA sequences and sequences of tRNA genes. http/uni-bayreuth.de/departments/biochemie/trna/, r1r54.
Stephan, O., Schwendemann, J., Specke, V., Tacke, S. J., Boller, K. & Denner, J. (2001). Porcine endogenous retroviruses (PERVs): generation of specific antibodies, development of an immunoperoxidase assay (IPA) and inhibition by AZT. Xenotransplantation 8, 310-316.[Medline]
Switzer, W. M., Shanmugam, V., Chapman, L. & Heneine, W. (1999). Polymerase chain reaction assays for the diagnosis of infection with the porcine endogenous retrovirus and the detection of pig cells in human and nonhuman recipients of pig xenografts. Transplantation 68, 183-188.[Medline]
Tacke, S. J., Bodusch, K., Berg, A. & Denner, J. (2001). Sensitive and specific immunological detection methods for porcine endogenous retroviruses applicable to experimental and clinical xenotransplantation. Xenotransplantation 8, 125-135.[Medline]
Takeuchi, Y. & Weiss, R. A. (2000). Xenotransplantation: reappraising the risk of retroviral zoonosis. Current Opinion in Immunology 12, 504-507.[Medline]
Takeuchi, Y., Cosset, F. L., Lachmann, P. J., Okada, H., Weiss, R. A. & Collins, M. K. (1994). Type C retrovirus inactivation by human complement is determined by both the viral genome and the producer cell. Journal of Virology 68, 8001-8007.
Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P. & Stoye, J. P. (1998). Host range and interference studies of three classes of pig endogenous retrovirus. Journal of Virology 72, 9986-9991.
Templin, C., Schroder, C., Simon, A. R., Laaff, G., Kohl, J., Chikobava, M., Lapin, B., Steinhoff, G. & Martin, U. (2000). Analysis of potential porcine endogenous retrovirus transmission to baboon in vitro and in vivo. Transplantation Proceedings 32, 1163-1164.[Medline]
Todaro, G. J., Benveniste, R. E., Lieber, M. M. & Sherr, C. J. (1974). Characterization of a type C virus released from the porcine cell line PK(15). Virology 58, 65-74.[Medline]
van der Kuyl, A. C., Dekker, J. T. & Goudsmit, J. (1999). Discovery of a new endogenous type C retrovirus (FcEV) in cats: evidence for RD-114 being an FcEV(GagPol)/baboon endogenous virus BaEV(Env) recombinant. Journal of Virology 73, 7994-8002.
van der Laan, L. J., Lockey, C., Griffeth, B. C., Frasier, F. S., Wilson, C. A., Onions, D. E., Hering, B. J., Long, Z., Otto, E., Torbett, B. E. & Salomon, D. R. (2000). Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice. Nature 407, 90-94.[Medline]
Wilson, C. A., Wong, S., Muller, J., Davidson, C. E., Rose, T. M. & Burd, P. (1998). Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. Journal of Virology 72, 3082-3087.
Wilson, C. A., Wong, S., VanBrocklin, M. & Federspiel, M. J. (2000). Extended analysis of the in vitro tropism of porcine endogenous retrovirus. Journal of Virology 74, 49-56.
Winkler, M. E., Martin, U., Loss, M., Arends, H., Rensing, S., Kaup, F. J., Hedrich, H. J., Klempnauer, J. & Winkler, M. (2000). Porcine endogenous retrovirus is not transmitted in a discordant porcine-to-cynomolgus xenokidney transplantation model with long-term survival of organ recipients. Transplantation Proceedings 32, 1162.[Medline]
Yamauchi, M., Freitag, B., Khan, C., Berwin, B. & Barklis, E. (1995). Stem cell factor binding to retrovirus primer binding site silencers. Journal of Virology 69, 1142-1149.[Abstract]
Received 14 January 2002;
accepted 3 May 2002.
This article has been cited by other articles:
![]() |
S. A. LaMere, J. A. St. Leger, M. D. Schrenzel, S. J. Anthony, B. A. Rideout, and D. R. Salomon Molecular Characterization of a Novel Gammaretrovirus in Killer Whales (Orcinus orca) J. Virol., December 15, 2009; 83(24): 12956 - 12967. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wood, B. L. J. Webb, B. Bartosch, T. Schaller, Y. Takeuchi, and G. J. Towers Porcine endogenous retroviruses PERV A and A/C recombinant are insensitive to a range of divergent mammalian TRIM5{alpha} proteins including human TRIM5{alpha} J. Gen. Virol., March 1, 2009; 90(3): 702 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Moalic, H. Felix, Y. Takeuchi, A. Jestin, and Y. Blanchard Genome Areas with High Gene Density and CpG Island Neighborhood Strongly Attract Porcine Endogenous Retrovirus for Integration and Favor the Formation of Hot Spots J. Virol., February 15, 2009; 83(4): 1920 - 1929. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeuchi, M. O. McClure, and M. Pizzato Identification of Gammaretroviruses Constitutively Released from Cell Lines Used for Human Immunodeficiency Virus Research J. Virol., December 15, 2008; 82(24): 12585 - 12588. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dong, S. Kim, S. Hong, J. Das Gupta, K. Malathi, E. A. Klein, D. Ganem, J. L. DeRisi, S. A. Chow, and R. H. Silverman From the Cover: An infectious retrovirus susceptible to an IFN antiviral pathway from human prostate tumors PNAS, January 30, 2007; 104(5): 1655 - 1660. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Harrison, Y. Takeuchi, B. Bartosch, and J. P. Stoye Determinants of High Titer in Recombinant Porcine Endogenous Retroviruses J. Virol., December 15, 2004; 78(24): 13871 - 13879. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bartosch, D. Stefanidis, R. Myers, R. Weiss, C. Patience, and Y. Takeuchi Evidence and Consequence of Porcine Endogenous Retrovirus Recombination J. Virol., December 15, 2004; 78(24): 13880 - 13890. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Scobie, S. Taylor, N. A. Logan, S. Meikle, D. Onions, C. Patience, and G. Quinn Characterization of germline porcine endogenous retroviruses from Large White pig J. Gen. Virol., August 1, 2004; 85(8): 2421 - 2428. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Magre, Y. Takeuchi, G. Langford, A. Richards, C. Patience, and R. Weiss Reduced Sensitivity to Human Serum Inactivation of Enveloped Viruses Produced by Pig Cells Transgenic for Human CD55 or Deficient for the Galactosyl-{alpha}(1-3) Galactosyl Epitope J. Virol., June 1, 2004; 78(11): 5812 - 5819. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Scobie, S. Taylor, J. C. Wood, K. M. Suling, G. Quinn, S. Meikle, C. Patience, H.-J. Schuurman, and D. E. Onions Absence of Replication-Competent Human-Tropic Porcine Endogenous Retroviruses in the Germ Line DNA of Inbred Miniature Swine J. Virol., March 1, 2004; 78(5): 2502 - 2509. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Tonjes and M. Niebert Relative Age of Proviral Porcine Endogenous Retrovirus Sequences in Sus scrofa Based on the Molecular Clock Hypothesis J. Virol., November 15, 2003; 77(22): 12363 - 12368. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Klymiuk, M. Muller, G. Brem, and B. Aigner Recombination analysis of human-tropic porcine endogenous retroviruses J. Gen. Virol., October 1, 2003; 84(10): 2729 - 2734. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. Del Priore, O. Ishida, E. W. Johnson, Y. Sheng, D. B. Jacoby, L. Geng, T. H. Tezel, and H. J. Kaplan Triple Immune Suppression Increases Short-Term Survival of Porcine Fetal Retinal Pigment Epithelium Xenografts Invest. Ophthalmol. Vis. Sci., September 1, 2003; 44(9): 4044 - 4053. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Ericsson, Y. Takeuchi, C. Templin, G. Quinn, S. F. Farhadian, J. C. Wood, B. A. Oldmixon, K. M. Suling, J. K. Ishii, Y. Kitagawa, et al. Identification of receptors for pig endogenous retrovirus PNAS, May 27, 2003; 100(11): 6759 - 6764. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |