|
|
||||||||
Animal: RNA Viruses |
Department of Medical Biotechnology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 5159, 63225 Langen, Germany1
Author for correspondence: Christian Buchholz. Fax: +49 6103/771255. e-mail bucch{at}pei.de
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
In retroviruses that are fusion active under neutral pH conditions the major trigger seems to be receptor contact. However, receptor binding is not sufficient in some retroviruses. For murine leukaemia virus (MLV) proteolytic processing of the R-peptide has been described as a second mode of fusion activation preceding receptor contact. The R-peptide, as initially detected in MLV, is a fragment of 16 amino acids which is released from the C terminus of the cytoplasmic tail of the TM protein upon particle formation as a result of proteolytic cleavage by the viral protease (Green et al., 1981
; Henderson et al., 1984
). R-peptide-less recombinant MLV Env proteins generated by insertion of a stop codon at the position of the cleavage site cause the formation of large syncytia when expressed in receptor-positive cells in the absence of all other virus proteins (Ragheb & Anderson, 1994
; Rein et al., 1994
; Yang & Compans, 1997
). Apart from MLV, R-peptide cleavage has been demonstrated for MasonPfizer monkey virus, a type D retrovirus, and the lentivirus equine anaemia virus (Brody et al., 1992
; Rice et al., 1990
). The cleavage sites in the cytoplasmic tails (C-tails) of the Env proteins of these viruses have been mapped based on sequence-specific antibodies. However, no sequence homologies are detectable within the C-tails of these Env proteins and that of C-type retroviruses. Recently, indirect evidence suggested the presence of an R-peptide in the Env protein of another C-type retrovirus, gibbon ape leukaemia virus (GaLV) (Fielding et al., 2000
; Christodoulopoulos & Cannon, 2001
). Here we investigated R-peptide-dependent fusion regulation in C-type retroviruses of simian, porcine and avian origin, in particular, the Env proteins of GaLV, spleen necrosis virus (SNV) and porcine endogenous retrovirus (PERV).
The first aim of this study was the identification of putative R-peptide cleavage sites by aligning their sequences to that of MLV. The alignment was started at the C terminus of the transmembrane domain (TMD) of TM which includes a conserved GPC motif present in all four viruses. All C-tails start with a positively charged amino acid at their N terminus and have a similar length, ranging from 32 to 35 amino acids. It is important to mention that different Env protein sequences with shorter C-tails for SNV and GALV have been published in GenBank. However, these were based on sequencing errors and have been corrected (Engelstädter et al., 2000
; Ting et al., 1998
). The C-tails can be separated into three parts, a membrane proximal part, a central hydrophobic part and a membrane distal part which mainly corresponds to the MLV R-peptide (Fig. 1
). The membrane proximal part (1415 amino acids) shows a pattern of alternating charged and hydrophobic residues which is conserved among all the four viruses. In contrast, the membrane distal part shows less sequence homology. The only conserved motifs are YXXL, an endocytotic signal previously identified in several retroviral cytoplasmic domains (Ohno et al., 1997
), and the accumulation of negatively charged residues. The central parts are completely hydrophobic and include four (MLV, GaLV, PERV) or six (SNV) amino acid residues. In MLV, the R-peptide cleavage site has been mapped to leucine-646 (P1) and valine-647 (P1') (arrow in Fig. 1
). This LV dipeptide is also present in the GaLV and SNV central parts. Moreover, identical or homologous residues are present in the putative P2 and P2' positions (second residues N- respectively C-terminally of the scissile bond). We therefore predict R-peptide cleavage to occur between leucine-671 and valine-672 in GaLV and leucine-580 and valine-581 in SNV, respectively. In PERV, as the most likely cleavage site we suggest methionine-643 and valine-644. Then, the P1'+P2' residues are identical to those in MLV. Overall, the sequence alignment shows that the membrane proximal and the central part including the R-peptide cleavage site of the MLV C-tail are well conserved among GaLV, SNV and PERV Env protein C-tails. Although the membrane distal parts are less well conserved they might exhibit equivalent functions as the MLV R-peptide.
|
RCla- (5' CCATCGATTTACAGAATTTTAACTGCACTTATC 3') to generate plasmid pALF-GALV
R. For the SNV Env plasmid, pRD134 (Martinez & Dornburg, 1995
R, using the QuickChange Site-Directed Mutagenesis Kit (Promega) and oligonucleotide primers SNV-
Ral (5' CTAGCACTATAGCCACAGTACAAG 3') and SNV-
Ral-reverse (5' CTTGTACTGTGGATATAGTGCTAG 3'. From PERV we investigated the Env proteins of the A and B strains, which exhibit distinct tropism and receptor choice (Takeuchi et al., 1998
R (5' CAGATCATGTAACTTAGGCAACAG 3') and PERV-
R-rev (5' CTGTTGCCTAAGTTACATGATCTG 3').
To investigate the proteolytic processing of the SNV TM protein D17 cells, a dog osteosarcoma cell line permissive for SNV was transfected with plasmid pCG4 encoding the complete genome of SNV (Gelinas & Temin, 1986
). Four days after transfection cells were lysed in 50 µM Tris (pH 8·0), 150 µM NaCl, 15 µM MgCl2, 1% NP40 and 0·1% SDS, and cytoplasmic extract was prepared. Virus particles released from the cells were concentrated by ultracentrifugation (25000 r.p.m., Beckman SW28 rotor, 2 h) through a 25% sucrose cushion. Proteins from cell extracts and virus particles were then separated on a 12% SDSpolyacrylamide gel and subjected to Western blot analysis using the anti-SNV TM antibody 11A25. Fig. 2(A)
shows that TM protein derived from cell lysate migrates at about 20 kDa, while the virus-associated TM protein migrated at a lower molecular mass, about 16 kDa (compare lanes 1 and 2). Next, we expressed the SNV Env protein alone (plasmid pRD134) or in the presence of the MLV Gag/Pol proteins (plasmid pHIT60; Soneoka et al., 1995
). Cell extract from pRD134
R-transfected cells (lane 4) was used as a molecular mass marker. Interestingly, processing of the TM protein was also detectable here, i.e. in the presence of the MLV protease (compare lanes 5 and 6), whereas it was not detected when expressed alone (lane 3).
|
R protein indicated that the cleavage site must be located at or close to the site predicted in Fig. 1
R protein in 293T cells and cocultivated these with D17 cells. Fig. 2(B)
R-co-transfected 293T cells. Compared to the non-modified Env protein deletion of the putative R-peptide resulted in a sevenfold increase of luciferase activity (not shown).
In contrast to SNV, GaLV and PERV are both able to infect the human cell line 293T (Eglitis et al., 1995
; Takeuchi et al., 1998
). To investigate the fusion regulatory capacity of their putative R-peptides 293T cells were transfected with plasmids encoding the Env protein variants truncated at the predicted R-peptide cleavage sites, and as a control with the full-length Env proteins. In repeated experiments 293T cells transfected with plasmids pALF-PERV-A
R formed syncytia at time-points as early as 16 h after transfection. In the following hours these syncytia grew rapidly, containing more than 100 nuclei and finally covering the complete surface of the six-well plate (Fig. 3A
, top row). Syncytia induced by the truncated GaLV Env protein appeared a few hours later and were in general smaller (1050 nuclei) (central row). Cells transfected with pALF-PERV-B
R also developed syncitia which, however, were significantly smaller (510 nuclei) than those observed with the other truncated Env proteins (bottom). No syncytia formation was observed after expression of the wild-type Env proteins (left row). Thus, the Env proteins of all these viruses can be fusion activated by removing the C-terminal amino acids of their cytoplasmic tails.
|
After transfection both cell populations were detached, mixed and co-cultivated for 20 h before cell extracts were prepared and assayed for luciferase activity. Fig. 3(B)
shows the results obtained after expression of the GaLV and PERV Env protein variants. Although the luciferase levels varied between individual experiments expression of the PERV A
R protein resulted, reproducibly, in the highest levels of luciferase activity, approaching those of cells co-transfected with pCMV-T7pol and pT7-luc. None of the unmodified Env proteins mediated luciferase activity significantly exceeding that of the negative control (no Env). In contrast, the truncated GaLV and PERV B Env proteins mediated luciferase activities on average eight- or fivefold above the activities obtained after expression of the corresponding wild-type Env proteins. Thus, the quantitative fusion assay was in line with the results obtained by microscopy. The PERV-A
R variant was the most potent mediator of cellcell fusion in 293T cells followed by the GaLV and PERV-B Env variants.
From the data presented here we conclude that R-peptide cleavage is a common mode of fusion protein activation among C-type retroviruses. This study extends previous publications describing the R-peptide in MLV to viruses of avian, simian and porcine origin. Our sequence analysis indicates that the location and quality of the R-peptide cleavage site is conserved among all C-type retroviruses. Furthermore, within the C-type retroviruses R-peptide cleavage sites can be processed by heterologous proteases, as demonstrated here for the SNV TM protein and the MLV protease. Previously, it was shown that the HIV protease is able to activate the MLV Env protein (Kiernan & Freed, 1998
). Thus, activation through R-peptide cleavage must have developed early in the evolution of retroviruses and must therefore be of fundamental relevance. This is in line with the current mechanistic model according to which the R-peptide controls the conformation of the Env protein, owing to being membrane anchored by a lipid modification (Olsen et al., 1999
).
GaLV and SNV have both attracted attention as gene transfer systems. SNV is one of the few retroviral systems that allows targeted gene transfer upon modification of its Env protein with single chain antibodies specific for the pre-selected cell type (Jiang et al., 1998
; Jiang & Dornburg, 1999
; Engelstädter et al., 2000
). The fusogenic SNV Env variant may form a useful tool to elucidate the molecular mechanism of SNV targeting which is insufficiently understood (Buchholz et al., 1999
). The GaLV Env protein utilizes a receptor that is highly expressed on human haematopoietic stem cells and has therefore been frequently used to pseudotype MLV and also lentiviral vector particles to achieve efficient gene transfer into haematopoietic cells (Stitz et al., 2000
). More recently, a variant of the GaLV Env protein carrying an artificial cytoplasmic tail was shown to fuse, thereby killing tumour cells at high efficiency in vitro and also in vivo (Bateman et al., 2000
). Our data, for example the highly efficient formation of syncytia induced by the PERV-A
R Env protein, provide the basis for optimizing efficacy and safety of this novel class of tumour therapeutic genes. PERVs have recently attracted particular interest as a potential risk after xenotransplantation of swine organs into humans. However, their infectivity for human cells is disputed, especially as their receptor is still unknown (Takeuchi et al., 1998
; Fiane et al., 2000
; Czauderna et al., 2000
). Analysis of syncytia formation in various human cell types upon expression of our fusogenic PERV Env variants offers an attractive approach to predict the biodistribution of PERV in humans and to ascertain the risk of xenotransplantation.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Brody, B. A., Rhee, S. S., Sommerfelt, M. A. & Hunter, E. (1992). A viral protease-mediated cleavage of the transmembrane glycoprotein of MasonPfizer monkey virus can be suppressed by mutations within the matrix protein. Proceedings of the National Academy of Sciences, USA 89, 3443-3447.
Buchholz, C. J., Stitz, J. & Cichutek, K. (1999). Retroviral cell targeting vectors. Current Opinion in Molecular Therapeutics 1, 613-621.[Medline]
Christodoulopoulos, I. & Cannon, P. M. (2001). Sequences in the cytoplasmic tail of the gibbon ape leukemia virus envelope protein that prevent its incorporation into lentivirus vectors. Journal of Virology 75, 4129-4138.
Czauderna, F., Fischer, N., Boller, K., Kurth, R. & Tonjes, R. R. (2000). Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. Journal of Virology 74, 4028-4038.
Eglitis, M. A., Schneiderman, R. D., Rice, P. M. & Eiden, M. V. (1995). Evaluation of retroviral vectors based on the gibbon ape leukemia virus. Gene Therapy 2, 486-492.[Medline]
Engelstädter, M., Bobkova, M., Baier, M., Stitz, J., Holtkamp, N., Chu, T. H., Kurth, R., Dornburg, R., Buchholz, C. J. & Cichutek, K. (2000). Targeting human T cells by retroviral vectors displaying antibody domains selected from a phage display library. Human Gene Therapy 11, 293-303.[Medline]
Fiane, A. E., Mollnes, T. E. & Degre, M. (2000). Pig endogenous retrovirus a threat to clinical xenotransplantation? APMIS 108, 241-250.[Medline]
Fielding, A. K., Chapel-Fernandes, S., Chadwick, M. P., Bullough, F. J., Cosset, F. L. & Russell, S. J. (2000). A hyperfusogenic gibbon ape leukemia envelope glycoprotein: targeting of a cytotoxic gene by ligand display. Human Gene Therapy 11, 817-826.[Medline]
Gelinas, C. & Temin, H. M. (1986). Nondefective spleen necrosis virus-derived vectors define the upper size limit for packaging reticuloendotheliosis viruses. Proceedings of the National Academy of Sciences, USA 83, 9211-9215.
Green, N., Shinnick, T. M., Witte, O., Ponticelli, A., Sutcliffe, J. G. & Lerner, R. A. (1981). Sequence-specific antibodies show that maturation of Moloney leukemia virus envelope polyprotein involves removal of a COOH-terminal peptide. Proceedings of the National Academy of Sciences, USA 78, 6023-6027.
Henderson, L. E., Sowder, R., Copeland, T. D., Smythers, G. & Oroszlan, S. (1984). Quantitative separation of murine leukemia virus proteins by reversed-phase high-pressure liquid chromatography reveals newly described Gag and Env cleavage products. Journal of Virology 52, 492-500.
Jiang, A. & Dornburg, R. (1999). In vivo cell type-specific gene delivery with retroviral vectors that display single chain antibodies. Gene Therapy 6, 1982-1987.[Medline]
Jiang, A., Chu, T. H., Nocken, F., Cichutek, K. & Dornburg, R. (1998). Cell-type-specific gene transfer into human cells with retroviral vectors that display single-chain antibodies. Journal of Virology 72, 10148-10156.
Kiernan, R. E. & Fried, E. O. (1998). Cleavage of the murine leukemia virus transmembrane env protein by human immunodeficiency virus type 1 protease: transdominant inhibition by matrix mutations. Journal of Virology 72, 9621-9627.
Martinez, I. & Dornburg, R. (1995). Mapping of receptor binding domains in the envelope protein of spleen necrosis virus. Journal of Virology 69, 4339-4346.
Nussbaum, O., Broder, C. C. & Berger, E. A. (1994). Fusogenic mechanisms of enveloped-virus glycoproteins analyzed by a novel recombinant vaccinia virus-based assay quantitating cell fusion-dependent reporter gene activation. Journal of Virology 68, 5411-5422.
Ohno, H., Aguilar, R. C., Fournier, M. C., Hennecke, S., Cosson, P. & Bonifacino, J. S. (1997). Interaction of endocytic signals from the HIV-1 envelope glycoprotein complex with members of the adaptor medium chain family. Virology. 238, 305-315.[Medline]
Olsen, K. E. & Andersen, K. B. (1999). Palmitoylation of the intracytoplasmic R peptide of the transmembrane envelope protein in Moloney murine leukemia virus. Journal of Virology 73, 8975-8981.
Patience, C., Switzer, W. M., Takeuchi, Y., Griffiths, D. J., Goward, M. E., Heneine, W., Stoye, J. P. & Weiss, R. A. (2001). Multiple groups of novel retroviral genomes in pigs and related species. Journal of Virology 75, 2771-2775.
Ragheb, J. A. & Anderson, W. F. (1994). pH-independent murine leukemia virus ecotropic envelope-mediated cell fusion: implications for the role of the R peptide and p12E TM in viral entry. Journal of Virology 68, 3220-3231.
Rein, A., Mirro, J., Haynes, J. G., Ernst, S. M. & Nagashima, K (1994). Function of the cytoplasmic domain of a retroviral transmembrane protein: p15E-p2E cleavage activates the membrane fusion capability of the murine leukemia virus Env protein. Journal of Virology 68, 1773-1781.
Rice, N. R., Henderson, L. E., Sowder, R. C., Copeland, T. D., Oroszlan, S. & Edwards, J. F. (1990). Synthesis and processing of the transmembrane envelope protein of equine infectious anemia virus. Journal of Virology 64, 3770-3778.
Skehel, J. J. & Wiley, D. C. (2000). Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annual Review of Biochemistry 69, 531-569.[Medline]
Soneoka, Y., Cannon, P. M., Ramsdale, E. E., Griffiths, J. C., Romano, G., Kingsman, S. M. & Kingsman, A. J. (1995). A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Research 23, 628-633.
Stitz, J., Buchholz, C. J., Engelstädter, M., Uckert, W., Bloemer, U., Schmitt, I. & Cichutek, K. (2000). Lentiviral vectors pseudotyped with envelope glycoproteins derived from gibbon ape leukemia virus and murine leukemia virus 10A1. Virology 273, 16-20.[Medline]
Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P. & Stoye, J. P. (1998). Host range and interference studies of three classes of pig endogenous retrovirus. Journal of Virology 72, 9986-9991.
Ting, Y. T., Wilson, C. A, Farrell, K. B., Chaudry, G. J. & Eiden, M. V. (1998). Simian sarcoma-associated virus fails to infect Chinese hamster cells despite the presence of functional gibbon ape leukemia virus receptors. Journal of Virology 72, 9453-9458.
Yang, C. & Compans, R. W. (1997). Analysis of the murine leukemia virus R peptide: delineation of the molecular determinants which are important for its fusion inhibition activity. Journal of Virology 71, 8490-8496.
Received 2 February 2002;
accepted 3 May 2002.
This article has been cited by other articles:
![]() |
R. Loving, K. Li, M. Wallin, M. Sjoberg, and H. Garoff R-Peptide Cleavage Potentiates Fusion-Controlling Isomerization of the Intersubunit Disulfide in Moloney Murine Leukemia Virus Env J. Virol., March 1, 2008; 82(5): 2594 - 2597. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Murphy and G. N. Gaulton TR1.3 Viral Pathogenesis and Syncytium Formation Are Linked to Env-Gag Cooperation J. Virol., October 1, 2007; 81(19): 10777 - 10785. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stitz, N. Wolfrum, C. J. Buchholz, and K. Cichutek Envelope proteins of spleen necrosis virus form infectious human immunodeficiency virus type 1 pseudotype vector particles, but fail to incorporate upon substitution of the cytoplasmic domain with that of Gibbon ape leukemia virus J. Gen. Virol., June 1, 2006; 87(6): 1577 - 1581. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Andersen, H. A. Diep, and A. Zedeler Murine leukemia virus transmembrane protein R-peptide is found in small virus core-like complexes in cells J. Gen. Virol., June 1, 2006; 87(6): 1583 - 1588. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Song, K. Micoli, and E. Hunter Activity of the Mason-Pfizer Monkey Virus Fusion Protein Is Modulated by Single Amino Acids in the Cytoplasmic Tail J. Virol., September 15, 2005; 79(18): 11569 - 11579. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Merten, J. Stitz, G. Braun, E. M. Poeschla, K. Cichutek, and C. J. Buchholz Directed Evolution of Retrovirus Envelope Protein Cytoplasmic Tails Guided by Functional Incorporation into Lentivirus Particles J. Virol., January 15, 2005; 79(2): 834 - 840. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Niebert and R. R. Tonjes Evolutionary Spread and Recombination of Porcine Endogenous Retroviruses in the Suiformes J. Virol., January 1, 2005; 79(1): 649 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chang, P.-T. Chen, G.-D. Chang, C.-J. Huang, and H. Chen Functional Characterization of the Placental Fusogenic Membrane Protein Syncytin Biol Reprod, December 1, 2004; 71(6): 1956 - 1962. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matsuyama, S. E. Delos, and J. M. White Sequential Roles of Receptor Binding and Low pH in Forming Prehairpin and Hairpin Conformations of a Retroviral Envelope Glycoprotein J. Virol., August 1, 2004; 78(15): 8201 - 8209. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kubo and H. Amanuma Mutational analysis of the R peptide cleavage site of Moloney murine leukaemia virus envelope protein J. Gen. Virol., August 1, 2003; 84(8): 2253 - 2257. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |