|
|
||||||||
Plant |
Department of Plant Biology, Genetics Centre, SLU, Box 7080, S-750 07 Uppsala, Sweden1
Department of Applied Biology, University of Helsinki, Finland2
Author for correspondence: Eugene Savenkov. Fax +46 18 67 3392. e-mail eugene.savenkov{at}vbiol.slu.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Plant viruses encode proteins able to suppress RNA silencing, probably to facilitate virus replication and systemic movement (Anandalakshmi et al., 1998
; Brigneti et al., 1998
; Kasschau & Carrington, 1998
; Mallory et al., 2001
; Voinnet et al., 1999
, 2000
). Virus silencing suppressors have been valuable tools for dissecting RNA silencing pathway(s), consisting of initiation, maintenance and propagation (signalling) phases (reviewed by Carrington et al., 2001
). Initiation of RNA silencing is dependent on the presence of dsRNA and results in establishment of a silent state for targeted genes or RNAs. The maintenance phase is associated with homology-dependent transgene methylation of unknown significance. The propagation phase of silencing is manifested by the spread of silencing from the initially silenced cells to non-silenced cells, tissues and different parts of the plant. The putative signal is transported systemically similarly to viruses and photoassimilates (Palauqui et al., 1997
; Voinnet & Baulcombe, 1997
; Citovsky & Zambryski, 1999
). Short (2126 nt) sense and antisense RNAs complementary to the targeted RNA (Hamilton & Baulcombe, 1999
; Papaefthimiou et al., 2001
) may function as the systemic silencing signal, perhaps as a complex with a nuclease (Hammond et al., 2000
).
Much of the mechanism of RNA silencing is still unknown. No model seems to accommodate all phenomena known to lead to the silent state. Some models predict a threshold level of RNA accumulation to be required for transgene-induced silencing of homologous viral RNAs. Accordingly, an abundance of viral RNA exceeding a threshold level would trigger RNA silencing, consistent with silencing triggered by highly transcribed single-copy loci, and enable plant recovery from virus infection (Lindbo & Dougherty, 1992
; Lindbo et al., 1993
; Mueller et al., 1995
). The term recovery implies here that transgenic plants expressing virus-derived transgenes are initially susceptible to the homologous viruses and become systemically infected and show typical symptoms, but the new leaves, which develop later, are symptomless, virus-free and resistant to new infections with the same virus (Lindbo & Dougherty, 1992
). A threshold sequence similarity between the transgene and the infecting virus is also needed for initiation of silencing. The threshold sequence similarity seems to vary depending on viruses and viral genes used for plant transformation (Longstaff et al., 1993
; Pang et al., 1993
; Mueller et al., 1995
; Taliansky et al., 1998
). In transgenic pea plants expressing the replicase gene (NIb) of Pea seed-borne mosaic potyvirus (PSbMV), 89% sequence identity was required for activation of resistance (Jones et al., 1998a
).
The helper component proteinase (HCpro) of potyviruses (genus Potyvirus) can reverse the maintenance phase of RNA silencing and re-establish transgene expression (Brigneti et al., 1998
). However, it is not known whether an HCpro-encoding transgene can be spontaneously silenced in plants in spite of HCpro expression and whether such transgenic plants are susceptible to infection with the homologous virus. Therefore, the aim of this study was to test the interaction between an HCpro-expressing transgene and virus isolates carrying sequences identical or highly homologous to the transgene mRNA. The results indicate that plants expressing HCpro are initially susceptible to infection with the homologous viruses but later exhibit strong silencing of both the transgene and the homologous virus, revealed as a recovery from infection. The initial stages of recovery were characterized by a peculiar lanceolate leaftip (LLT) phenotype, which suggests that initiation of silencing occurs in close proximity to meristematic tissues. Furthermore, our results indicate that recovery is dependent on the sequence similarity between the virus and the transgene.
| Methods |
|---|
|
|
|---|
Transformation of Nicotiana benthamiana and analysis of the transgenic plants.
Potato virus A (PVA) isolates, inoculation and virus detection.
PVA isolates used in this study have been described (Rajamäki et al., 1998
; Kekarainen et al., 1999
). Concentrations of PVA and HCpro in leaves were estimated by ELISA using rabbit polyclonal antibodies (courtesy of F. Rabenstein, BAFZ, Aschersleben, Germany), as described previously (Savenkov & Valkonen, 2001a
).
RNA extractions and RNA gel blot analysis.
Total RNA was extracted from
100 mg of plant tissue (Verwoerd et al., 1989
). Total RNA (1030 µg) was electrophoresed through 2·2 M formaldehydeagarose gels and blotted onto Hybond-N+ membranes (Amersham). PCR with HCpro gene-specific primers was used to generate [32P]dCTP-labelled deoxyriboprobes. The primer sequences were (5' forward primer) 5' TCACATCAGAGGGTATTAAATC 3' and (3' primer) 5' GAATACAGTGGAGTGCCATCAT 3'. Filters were hybridized in hybridization buffer (5x Denhardts solution, 6x SSC, 0·5% SDS and 0·5 mg/ml boiled herring sperm DNA) overnight at 65 °C and washed twice with a final solution of 2x SSC (1x SSC contains 0·15 M NaCl and 0·015 M sodium citrate) for 10 min each and once with 2x SSC supplemented with 0·1% SDS for 30 min at 70 °C. The filters were exposed to PhosphorImager screens for image detection (Molecular Dynamics). RNA size markers (GibcoBRL) were used to determine the size of the transgene mRNA and genomic viral RNA.
Methylation analyses.
Total genomic DNA was isolated from individual plants of the experimental line ab34 using a DNAeasy Plant Mini kit (Qiagen). Equal amounts of total DNA (
100 ng) were digested for 14 h at 37 °C with 20 units of ClaI or NotI restriction endonucleases (Fermentas). Primers flanking the ClaI or NotI restriction sites were designed. The sequence of the 3' reverse primer (R1) used for all PCR analyses was 5' GAATACAGTGGAGTGCCATCAT 3'. The sequences of the three forward primers used in our experiments were: (F1) 5' CTGGCGAGGATTCAATCGAAC 3'; (F2) 5' TCACATCAGAGGGTATTAAATC 3'; and (F3) 5' CAAGACCCTTCCTCTATATAAG 3'. The F1/R1 primer pair amplified a 0·89 kb fragment, indicative of methylation at the ClaI site, when ClaI-digested samples were used for PCR amplification (see Fig. 6). This same primer pair served for amplification of the short control fragment from NotI-digested samples. The F2/R1 primer pair amplified a 0·60 kb control band for ClaI-digested samples. The F3/R1 primer pair amplified a 1·13 kb fragment, indicative of methylation at the NotI site, when NotI-digested samples were used for PCR amplification.
The samples of total DNA (either undigested or digested with ClaI or NotI) were subjected to PCR amplification using the appropriate primer pair. At least two plants were tested at each time-point and for each PVA isolate. The PCR conditions were as follows: the hot-start represented a 4 min denaturing step at 94 °C, followed by 35 cycles consisting of denaturation (1 min at 94 °C), primer annealing (1 min at 58 °C) and strand elongation (1 min at 72 °C). PCR products were separated by size in 1% agarose gels containing ethidium bromide.
| Results |
|---|
|
|
|---|
|
|
|
However, at 2128 days p.i. with PVA isolate B11, a peculiar phenotype was observed in the expanding sixth (position+6) and seventh (position+7) leaf above the inoculated leaf (position 0) in the HCpro-transgenic plants. These leaves had an elongated, narrow leaftip that was chlorotic (yellow) (Fig. 2A
). All new leaves above those with the LLT phenotype developed without symptoms. The inoculated leaves (position 0) and all leaves above the inoculated leaves (positions 110) from several HCpro-transgenic plants and PVA-infected control plants were tested for PVA by ELISA at 21 days p.i. Only the inoculated leaves and the upper leaves at positions 15 were PVA-infected for the HCpro-transgenic plants, whereas the symptomless leaves at positions 810 were virus-free, as determined by ELISA and Northern blot analysis (Fig. 3
). In contrast, all leaves at positions 010 were PVA-infected in the GUS1 and wt control plants, showed severe symptoms and no LLT phenotype was observed. The response of all HCpro-transgenic lines (ab12, -13 and -34) was similar. These data indicate recovery of the HCpro-transgenic plants from PVA infection (sensu Lindbo et al., 1993
).
|
|
The recovered virus-free leaves of the HCpro-transgenic plants at position +8 or higher were challenged with PVA isolate B11 by mechanical inoculation. Six leaves of the 29 inoculated leaves (21%) were infected in two experiments, as tested by ELISA at 14 days p.i. These data indicate that the recovered leaves were not completely resistant to PVA infection when mechanically inoculated. However, since the leaves at position +8 and above remained symptomless and virus-free in the recovered plants, these leaves were apparently resistant to the virus systemically transported from the infected leaves at positions 05. The controls in these experiments included CP-transgenic plants (10 leaves inoculated, no leaves infected) and GUS-transgenic plants (10 leaves tested, all leaves infected), showing responses consistent with previous studies (Savenkov & Valkonen, 2001b
).
Responses to infection with different isolates of PVA
Three additional PVA isolates (Ali, TamMV and U), differing in their HCpro and CP sequences compared to isolate B11 (Kekarainen et al., 1999
), were used for inoculation of the HCpro-transgenic plants. Also, a mutant of PVA isolate B11 (B11-DAG), bearing two nucleotide substitutions in the CP gene and accumulating to ca. 10-fold lower titres than B11 in tobacco plants (N. tabacum cv. Samsun) (Andrejeva et al., 1999
), was included in the experiments. Accumulation of these PVA isolates in N. benthamiana was first tested in wt and GUS-transgenic plants and found to be different. Isolate B11 (37·7 µg/g leaf, n=18) had very high titres. Isolate Ali (6·86 µg/g, n=13) had moderately high titres, TamMV (3·0 µg/g, n=15) and B11-DAG (2·76 µg/g, n=13) had low titres and isolate U (0·35 µg/g, n=21) had very low titres, as estimated by ELISA on at least 13 inoculated plants per isolate. These differences in virus accumulation were consistent with the differences observed in tobacco plants (Rajamäki et al., 1998
; Andrejeva et al., 1999
; Valkonen et al., 2002
). The T1 progeny plants of the CP-transgenic line were shown previously to be resistant to all these PVA isolates, probably due to a PTGS-based resistance mechanism, as proposed previously (Table 1
) (Savenkov & Valkonen, 2001b
). In this study, these plants were compared to the HCpro-transgenic plants for their response to infection with the aforementioned PVA isolates and the mutant B11-DAG. No infection with any of these viruses was detectable in inoculated or upper non-inoculated leaves in any of nine plants per virus tested in two experiments (data not shown). Thus, the CP-transgenic plants expressed extreme resistance to a range of PVA isolates showing as low as 86·9% sequence identity to the transgene (CP-encoding region; the 5' UTR sequences of TamMV and B11 are only 68·9% identical) (Kekarainen et al., 1999
).
In contrast, initially, all HCpro-transgenic plants became systemically infected with the four PVA isolates and B11-DAG by 14 days p.i. and accumulated to titres not significantly different from the control plants (Fig. 4
). Isolates B11, Ali and B11-DAG induced severe mosaic symptoms in the systemically infected leaves, whereas TamMV and U caused only mild mosaic symptoms. In plants infected with B11, B11-DAG and Ali, the leaves at positions +6 and +7 developed the LLT phenotype at 28 days p.i. and the leaves developing at higher positions were symptomless, showing recovery as before. In contrast, the leaves at positions +6 and above continued to show mild mosaic symptoms in plants infected with TamMV or U. However, by 38 days p.i., in nine plants out of the total of 19 plants infected with isolate U, the new leaves developed without symptoms and were virus-free (Fig. 4
). These symptomless leaves in the nine plants and the corresponding symptomatic leaves of other plants infected with isolate U were compared for accumulation of transgene mRNA and PVA RNA (Fig. 5
). A few leaves at position +9 from plants inoculated with isolate B11 or B11-DAG were included as well. No transgene mRNA or viral RNA was detected in the symptomless leaves, whereas transgene mRNA and viral RNA were detected in all symptomatic leaves (Fig. 5
). Thus, isolate U induced a delayed recovery from infection, which was observed in only a few plants and was devoid of the LLT phenotype, in contrast to B11, B11-DAG and Ali. No recovery was observed in plants infected with TamMV. The data suggest that the PVA isolates showing higher sequence similarity with the transgene (B11, B11-DAG and Ali versus U and TamMV) and/or accumulating to higher titres (B11 and Ali versus U and TamMV) were more likely to induce recovery in the HCpro-transgenic plants.
|
|
Results of the analysis for methylation within the transgene DNA indicated that of the ClaI (NotI)-digested DNA samples from young seedlings, from plants prior to PVA inoculation and from the recovered leaves at 28 days p.i. produced the pattern predicted for unmethylated DNA, since the large fragments were not amplified (Fig. 6B
, panels I and IV), whereas the small fragments (Fig. 6B
, panels II and V) as well as the expected fragment from undigested DNA (Fig. 6B
, panel III) were amplified.
At 38 days p.i., the pattern predicted for methylated DNA was observed for recovered leaves of plants inoculated with PVA isolates B11 or B11-DAG but not in the recovered leaves of plants inoculated with isolate U (Fig. 6B
, panels I and IV) (plants inoculated with isolate U showed recovery by 38 days p.i., 10 days later than the plants inoculated with B11 or B11-DAG). Methylation of the HCpro transgene was not detected in the plants inoculated with isolates U or TamMV and which did not undergo recovery but showed disease symptoms in the upper leaves by 38 days p.i.
A single plant among the over one hundred T1 plants of line ab34 tested in our experiments showed a unique phenotype. Recovery of the upper leaves started 1 week earlier than in other plants and chlorotic vein banding in lower leaves as well as the LTT phenotype developed in this plant. In addition, the steady-state levels of HCpro mRNA (Fig. 3
, lane 11) were somewhat lower than in other plants prior to PVA inoculation. We found that ClaI (NotI)-digested DNA produced the pattern of amplification predicted for methylated DNA at all three time-points: amplification of both the long (Fig. 6B
; panels I and IV, lanes 35) and the short (Fig. 6B
; panels II and V, lanes 35) fragments was observed.
Taken together, these results suggest that these particular ClaI and NotI sites located 300 nt from each other were not methylated during the initiation and the early maintenance stage of silencing (recovery) but became methylated to some extent at the later maintenance stage. Isolates unable to induce recovery and silencing of the transgene failed to induce methylation of the homologous sequence within a transgene. On the other hand, early methylation of the coding sequence of the transgene was associated with a distinct rare recovery phenotype (chlorotic vein banding sample; Fig. 6B
, lanes 35).
| Discussion |
|---|
|
|
|---|
The HCpro-transgenic N. benthamiana plants used in this study express high levels of HCpro (300900 ng HCpro per gram of leaf, as compared to 5001700 ng/g accumulating in wt plants infected with PVA isolate B11) (Savenkov & Valkonen, 2001a
). No spontaneous silencing of the HCpro transgene has been observed in any of the several hundred T1 progeny plants examined from several transgenic lines. Also, all examined plants were initially susceptible to PVA infection. The HCpro-transgenic plants of this study showed no morphological abnormalities, in contrast to another study on TEV HCpro transgenic plants (Anandalakshmi et al., 2000
), possibly due to differences in the viruses or transgene constructs used.
Replication of PVA following systemic spread to newly developing tissues results in a rapid increase of the PVA RNA concentration in the cells. However, meristematic tissues that lack functional plasmodesmal connections and very young leaf primordia which lack veins and phloem tissues supportive to virus transport and unloading (Roberts et al., 1997
) cannot be systemically infected following phloem-dependent virus transport from other parts of the plant (Oparka & Santa Cruz, 2000
). The initiation of recovery (LLT phenotype) was consistently observed in two successive new leaves, in which the tips were found to be virus-infected but the rest of the leaf was symptomless and virus-free. The tip is developmentally the oldest part of the leaf (Roberts et al., 1997
). Thus, it seems likely that RNA silencing is initiated in close proximity to the meristematic tissues. Indeed, meristems do not undergo RNA silencing (Beclin et al., 1998
; Voinnet et al., 1998
) and potyviruses do not access the meristem (Jones et al., 1998b
).
A spatial pattern of RNA silencing resembling the LLT phenotype observed in this study is induced by infection with a homologous virus in transgenic pea plants expressing NIb, the potyviral RNA-dependent RNA polymerase derived from PSbMV (Jones et al., 1998b
). Recovery from PSbMV infection was first observed in the pea leaves at positions +3 and +4 above the inoculated leaf, similar to leaves at positions +6 and +7 in our study, and was characterized by a restriction of symptoms and virus accumulation to the distal part of the leaf. Furthermore, the leaf at position +5 and the subsequent new leaves, similar to the leaf +8 and the subsequent new leaves in our study, were resistant to mechanical inoculation with PSbMV (Jones et al., 1998b
). In the PSbMV NIb-transgenic pea plants and the PVA HCpro-transgenic N. benthamiana plants, the rest of the leaf lamina showed recovery. However, the leaves of N. benthamiana plants transformed with the NIb gene of Plum pox potyvirus (Guo & Garcia, 1997
) show an irregular pattern of dark green islands (bubbles) within otherwise chlorotic leaf lamina, indicating a sporadic induction of RNA silencing in the leaf lamina (Moore et al., 2001
).
Once recovered, the new top leaves did not become systemically infected with PVA transported from the lower, full-grown, PVA-infected source leaves. However, six leaves of the 29 recovered leaves mechanically inoculated with the homologous PVA isolate B11 were infected, showing that the recovered leaves were not completely protected against PVA infection. Apparently, mechanical inoculation of PVA can circumvent the mechanism that prevented infection via systemic, phloem-dependent virus transport from the lower leaves. These data are consistent with the hypothesis that RNA silencing may be hyperactive in phloem cells that control phloem-loading and/or phloem-unloading of viruses (Marathe et al., 2000
). Thus, effective degradation of viral RNA upon infection of the phloem cells could inhibit systemic infection, whereas in the mechanically inoculated leaves, the gate-keeper function of the phloem cells would be circumvented.
A threshold model of RNA silencing predicts that the concentration of silencing target RNA is reduced to just below a threshold level in leaves where silencing has been initiated (Meins, 2000
). It is intriguing in this regard that in the lamina of +6 leaves, PVA accumulated at greatly reduced but detectable titres, which are, in quantitative terms, similar to the titres of PVA-U, an isolate that was able to induce only delayed recovery in some of the infected plants. These findings suggest that viruses replicating to only low titres and/or accumulating low amounts of replicative intermediates (dsRNA) do not reach a threshold level and can evade and/or do not induce the plant RNA surveillance system. However, because no virus and no transgene mRNA were detected in the leaves at position +8 or higher, our data suggest that another mechanism independent of the threshold level contributes to the propagation and maintenance phases of silencing.
Our data indicate that the level of sequence homology between the transgene and the infecting virus constitutes an important factor in induction of recovery. Isolates B11 and B11-DAG are identical to the transgene sequence and induced recovery to the same rate regardless of a more than 10-fold difference in the level of virus accumulation. However, isolate TamMV with a low nucleotide sequence identity to the transgene (81·3% or, more specifically, 68·9% for the 5' UTR and 83·2% for the HCpro cistron) (Kekarainen et al., 1999
) and an accumulation level similar to isolate B11-DAG induced no recovery (Fig. 4
). Isolate U accumulated to titres ca. 10-fold lower than B11-DAG and TamMV, but it induced a delayed recovery in 47·4% of infected plants, probably due to its high levels of sequence similarity with the transgene (97·5%) (Fig. 4
). In contrast to the HCpro-transgenic plants, the CP-transgenic plants were resistant to all five PVA isolates tested and no infection was observed. The sequence identity between TamMV and the CP transgene is 86·9%, which is slightly higher than the identity between TamMV and the HCpro transgene. Taken together, our data suggest that higher levels of virus accumulation and sequence similarity with the transgene both represent factors of great importance for RNA silencing induction by a virus (VIGS).
Methylation of the transgene is often found to be associated with the maintenance phase of RNA silencing (Jones et al., 1998b
, 1999
; Guo et al., 1999
). In order to address the possible role of transgene methylation on RNA silencing in the HCpro-transgenic plants, methylation was assayed at two restriction sites located ca. 300 nt apart at different times after infection with five PVA isolates. No indication of methylation was apparent at the time when many leaves of the plants had recovered from PVA infection. Even though methylation of the transgene was later observed in recovered leaves, its appearance at a late stage of recovery indicated no significant role in the initiation phase of recovery but rather a possible significance in the maintenance stage of transgene silencing (Jones et al., 1999
).
The results of our study are consistent with the previous observations that many viruses encoding functional suppressors of RNA silencing will, nevertheless, trigger RNA silencing during infection (Carrington et al., 2001
) and are, therefore, both suppressors and targets of the silencing (Voinnet et al., 1999
).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Anandalakshmi, R., Pruss, G. J., Ge, X., Marathe, R., Mallory, A. C., Smith, T. H. & Vance, V. B. (1998). A viral suppressor of gene silencing in plants. Proceedings of the National Academy of Sciences, USA 95, 13079-13084.
Anandalakshmi, R., Marathe, R., Ge, X., Herr, J. M.Jr, Mau, C., Mallory, A., Pruss, G., Bowman, L. & Vance, V. B. (2000). A calmodulin-related protein that suppresses posttranscriptional gene silencing in plants. Science 290, 142-144.
Andrejeva, J., Puurand, Ü., Merits, A., Rabenstein, F., Järvekülg, L. & Valkonen, J. P. T. (1999). Potyvirus helper component-proteinase and coat protein (CP) have coordinated functions in virushost interactions and the same CP motif affects virus transmission and accumulation. Journal of General Virology 80, 1133-1139.[Abstract]
Baulcombe, D. C. (1999). Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology 2, 109-113.[Medline]
Beclin, C., Berthome, R., Palauqui, J. C., Tepfer, M. & Vaucheret, H. (1998). Infection of tobacco or Arabidopsis plants by CMV counteracts systemic post-transcriptional silencing of nonviral (trans)genes. Virology 252, 313-317.[Medline]
Brigneti, G., Voinnet, O., Li, W. X., Ji, L. H., Ding, S. W. & Baulcombe, D. C. (1998). Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO Journal 17, 6739-6746.[Medline]
Carrington, J. C., Kasschau, K. D. & Johansen, L. K. (2001). Activation and suppression of RNA silencing by plant viruses. Virology 281, 1-5.[Medline]
Chicas, A. & Macino, G. (2001). Characteristics of post-transcriptional gene silencing. EMBO Reports 2, 992-996.[Medline]
Citovsky, V. & Zambryski, P. (1999). Systemic transport of RNA in plants. Trends in Plant Science 5, 52-54.
Covey, S. N., Al-Kaff, N., Langara, A. & Turner, D. S. (1997). Plants combat infection by gene silencing. Nature 38, 781-782.
Guo, H. S. & Garcia, J. A. (1997). Delayed resistance to plum pox potyvirus mediated by a mutated RNA replicase gene: involvement of a gene-silencing mechanism. Molecular PlantMicrobe Interactions 10, 160-170.
Guo, H. S., López-Moya, J. J. & García, J. A. (1999). Mitotic stability of infection-induced resistance to plum pox potyvirus associated with transgene silencing and DNA methylation. Molecular PlantMicrobe Interactions 12, 103-111.[Medline]
Hamilton, A. J. & Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952.
Hammond, S. M., Bernstein, E., Beach, D. & Hannon, G. J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296.[Medline]
Ingelbrecht, I., Van Houdt, H., Van Montagu, M. & Depicker, A. (1994). Posttranscriptional silencing of reporter transgenes in tobacco correlates with DNA methylation. Proceedings of the National Academy of Sciences, USA 91, 10502-10506.
Jones, A. L., Johansen, I. E., Bean, S. J., Bach, I. & Maule, A. J. (1998a). Specificity of the resistance to pea seed-borne mosaic potyvirus in transgenic peas expressing the viral replicase (NIb) gene. Journal of General Virology 79, 3129-3137.[Abstract]
Jones, A. L., Thomas, C. L. & Maule, A. J. (1998b). De novo methylation and co-suppression induced by a cytoplasmically replicating plant RNA virus. EMBO Journal 17, 6385-6393.[Medline]
Jones, L., Hamilton, A. J., Voinnet, O., Thomas, C. L., Maule, A. J. & Baulcombe, D. C. (1999). RNADNA interactions and DNA methylation in post-transcriptional gene silencing. Plant Cell 11, 2291-2301.
Kasschau, K. D & Carrington, J. C. (1998). A counterdefensive strategy of plant viruses: suppression of posttranscriptional gene silencing. Cell 95, 461-470.[Medline]
Kekarainen, T., Merits, A., Oruetxebarria, I., Rajamäki, M. & Valkonen, J. P. T. (1999). Comparison of the complete sequences of five different isolates of Potato virus A (PVA), genus Potyvirus. Archives of Virology 144, 2355-2366.[Medline]
Lindbo, J. A. & Dougherty, W. G. (1992). Untranslatable transcripts of the tobacco etch virus coat protein gene sequence can interfere with tobacco etch virus replication in transgenic plants and protoplasts. Virology 189, 725-733.[Medline]
Lindbo, J. A., Silva-Rosales, L., Proebsting, W. M. & Dougherty, W. G. (1993). Induction of a highly specific antiviral state in transgenic plants: implications for regulation of gene expression and virus resistance. Plant Cell 5, 1749-1759.[Abstract]
Longstaff, M., Brigneti, G., Boccard, F., Chapman, S. & Baulcombe, D. C. (1993). Extreme resistance to potato virus X infection in plants expressing a modified component of the putative viral replicase. EMBO Journal 12, 379-386.[Medline]
Mallory, A. C., Ely, L., Smith, T. H., Marathe, R., Anandalakshmi, R., Fagard, M., Vaucheret, H., Pruss, G. J., Bowman, L. & Vance, V. B. (2001). HC-Pro suppression of transgene silencing eliminates the small RNAs but not transgene methylation or the mobile signal. Plant Cell 13, 571-583.
Marathe, R., Anandalakshmi, R., Smith, T. H., Pruss, G. J. & Vance, V. B. (2000). RNA viruses as inducers, suppressors and targets of post-transcriptional gene silencing. Plant Molecular Biology 43, 295-306.[Medline]
Matzke, M. A., Matzke, A. J. M., Pruss, G. & Vance, V. B. (2001). RNA-based silencing strategies in plants. Current Opinion in Genetics & Development 11, 221-227.
Meins, F.Jr (2000). RNA degradation and models for post-transcriptional gene-silencing. Plant Molecular Biology 43, 261-273.[Medline]
Mlotshwa, S. (2001). The helper component-proteinase of cowpea aphid-borne mosaic virus. PhD thesis, Wageningen University, Wageningen, The Netherlands.
Moore, C. J., Sutherland, P. W., Forster, R. L. S., Gardner, R. C. & MacDiarmid, R. M. (2001). Dark green islands in plant virus infection are the results of posttranscriptional gene silencing. Molecular PlantMicrobe Interactions 14, 939-946.[Medline]
Mueller, E., Gilbert, J. E., Davenport, G., Brigneti, G. & Baulcombe, D. C. (1995). Homology-dependent resistance: trans-genic virus resistance in plants related to homology-dependent gene silencing. Plant Journal 7, 1001-1013.
Napoli, C., Lemieux, C. & Jorgensen, R. (1990). Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2, 279-289.
Oparka, K. J. & Santa Cruz, S. (2000). The great escape: phloem transport and unloading of macromolecules. Annual Review of Plant Physiology and Plant Molecular Biology 51, 323-347.
Palauqui, J. C. & Vaucheret, H. (1998). Transgenes are dispensable for the RNA degradation step of cosuppression. Proceedings of the National Academy of Sciences, USA 95, 9675-9680.
Pang, S. Z., Slightom, J. L. & Gonsalves, D. (1993). Different mechanisms protect transgenic tobacco against tomato spotted wilt and impatiens necrotic spot tospoviruses. Biotechnology 11, 819-824.[Medline]
Papaefthimiou, I., Hamilton, A. J., Denti, M. A., Baulcombe, D. C., Tsagris, M. & Tabler, M. (2001). Replicating potato spindle tuber viroid RNA is accompanied by short RNA fragments that are characteristic of post-transcriptional gene silencing. Nucleic Acids Research 29, 2395-2400.
Rajamäki, M., Merits, A., Rabenstein, F., Andrejeva, J., Paulin, L., Kekarainen, T., Kreuze, J. F., Forster, R. L. S. & Valkonen, J. P. T. (1998). Biological, serological, and molecular differences among isolates of potato A potyvirus. Phytopathology 88, 311-321.
Ratcliff, F., Harrison, B. & Baulcombe, D. C. (1997). A similarity between viral defense and gene silencing in plants. Science 276, 1558-1560.
Ratcliff, F. G., MacFarlane, S. A. & Baulcombe, D. C. (1999). Gene silencing without DNA. RNA-mediated cross-protection between viruses. Plant Cell 11, 1207-1216.
Roberts, A. G., Santa Cruz, S., Roberts, I. M., Prior, D. A. M., Turgeon, R. & Oparka, K. J. (1997). Phloem unloading in sink leaves of Nicotiana benthamiana: comparison of a fluorescent solute with a fluorescent virus. Plant Cell 9, 1381-1396.[Abstract]
Savenkov, E. I. & Valkonen, J. P. T. (2001a). Potyviral helper component proteinase expressed in transgenic plants enhances titers of Potato leaf roll virus but does not alleviate its phloem-limitation. Virology 283, 285-293.[Medline]
Savenkov, E. I. & Valkonen, J. P. T. (2001b). Coat protein gene-mediated resistance to Potato virus A in transgenic plants is suppressed following infection with another potyvirus. Journal of General Virology 82, 2275-2278.
Taliansky, M. E., Ryabov, E. V. & Robinson, D. J. (1998). Two distinct mechanisms of transgenic resistance mediated by groundnut rosette virus satellite RNA sequences. Molecular PlantMicrobe Interactions 11, 367-374.
Valkonen, J. P. T., Rajamäki, M.-L. & Kekarainen, T. (2002). Mapping of viral genomic regions important for cross-protection between strains of a potyvirus. Molecular PlantMicrobe Interactions 15, 683692.[Medline]
Vance, V. & Vaucheret, H. (2001). RNA silencing in plants: defence and counterdefense. Science 292, 2277-2280.
Vance, V. B., Berger, P. H., Carrington, J. C., Hunt, A. G. & Shi, X. M. (1995). 5' proximal potyviral sequences mediate potato virus X/potyviral synergistic disease in transgenic tobacco. Virology 206, 583-590.[Medline]
van der Krol, A. R., Mur, L. A., Beld, M., Mol, J. N. M. & Stuitje, A. R. (1990). Flavonoid genes in petunia: addition of a limited number of gene copies may lead to suppression of gene expression. Plant Cell 2, 291-299.
Verwoerd, T. C., Dekker, B. M. M. & Hoekema, A. (1989). A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Research 17, 2362.
Voinnet, O. & Baulcombe, D. C. (1997). Systemic signalling in gene silencing. Nature 389, 553.[Medline]
Voinnet, O., Vain, P., Angell, S. & Baulcombe, D. C. (1998). Systemic spread of sequence-specific transgene RNA degradation in plants is initiated by localized introduction of ectopic promoterless DNA. Cell 95, 177-187.[Medline]
Voinnet, O., Pinto, Y. M. & Baulcombe, D. C. (1999). Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proceedings of the National Academy of Sciences, USA 96, 14147-14152.
Voinnet, O., Lederer, C. & Baulcombe, D. C. (2000). A viral movement protein prevents spread of the gene silencing signal in Nicotiana benthamiana. Cell 103, 157-167.[Medline]
Wang, H., Qi, M. & Cutler, A. J. (1993). A simple method for preparing plant samples for PCR. Nucleic Acids Research 21, 4153-4154.
Waterhouse, P. M., Wang, M. B. & Lough, T. (2001). Gene silencing as an adaptive defence against viruses. Nature 411, 834-842.[Medline]
Received 25 March 2002;
accepted 16 May 2002.
This article has been cited by other articles:
![]() |
K. Hirai, K. Kubota, T. Mochizuki, S. Tsuda, and T. Meshi Antiviral RNA Silencing Is Restricted to the Marginal Region of the Dark Green Tissue in the Mosaic Leaves of Tomato Mosaic Virus-Infected Tobacco Plants J. Virol., April 1, 2008; 82(7): 3250 - 3260. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gammelgard, M. Mohan, and J. P. T. Valkonen Potyvirus-induced gene silencing: the dynamic process of systemic silencing and silencing suppression J. Gen. Virol., August 1, 2007; 88(8): 2337 - 2346. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Paalme, E. Gammelgard, L. Jarvekulg, and J. P. T. Valkonen In vitro recombinants of two nearly identical potyviral isolates express novel virulence and symptom phenotypes in plants J. Gen. Virol., March 1, 2004; 85(3): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. E. Yelina, E. I. Savenkov, A. G. Solovyev, S. Y. Morozov, and J. P. T. Valkonen Long-Distance Movement, Virulence, and RNA Silencing Suppression Controlled by a Single Protein in Hordei- and Potyviruses: Complementary Functions between Virus Families J. Virol., November 13, 2002; 76(24): 12981 - 12991. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||