J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 84 (2003), 3393-3403; DOI 10.1099/vir.0.19387-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, R. E.
Right arrow Articles by Whitehouse, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, R. E.
Right arrow Articles by Whitehouse, A.
Agricola
Right arrow Articles by White, R. E.
Right arrow Articles by Whitehouse, A.
© 2003 Society for General Microbiology

Generation and precise modification of a herpesvirus saimiri bacterial artificial chromosome demonstrates that the terminal repeats are required for both virus production and episomal persistence

Robert E. White, Michael A. Calderwood and Adrian Whitehouse

School of Biochemistry and Molecular Biology, University of Leeds, Leeds LS2 9JT, UK

Correspondence
Adrian Whitehouse
a.whitehouse{at}leeds.ac.uk


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Herpesvirus saimiri (HVS) is the prototype gamma-2 herpesvirus, and shares considerable homology with the human gammaherpesviruses Kaposi's sarcoma-associated herpesvirus and Epstein–Barr virus. The generation of herpesvirus mutants is a key facet in the study of virus biology. The use of F-factor-based bacterial artificial chromosomes (BACs) to clone and modify the genomes of herpesviruses has enhanced the variety, precision and simplicity of mutant production. Here we describe the cloning of the genome of HVS non-transforming strain A11-S4 into a BAC. The cloning of the BAC elements disrupts open reading frame (ORF) 15 but the HVS-BAC can still replicate at levels similar to wild-type virus, and can persistently infect fibroblasts. The HVS-BAC was modified by RecA-mediated recombination initially to substitute reporter genes and also to delete the terminal repeats (TR). After deletion of the TR, the HVS-BAC fails to enter a productive virus lytic cycle, and cannot establish a persistent episomal infection when transfected into fibroblast cell lines. This shows that while ORF 15 is dispensable for virus function in vitro, the TR is required for both virus latency and lytic virus production. In addition, the HVS-BAC promises to be a valuable tool that can be used for the routine and precise production and analysis of viral mutants to further explore gammaherpesvirus biology.


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Herpesvirus saimiri (HVS) is the prototype gamma-2 herpesvirus, or rhadinovirus. It has significant homology to the other gammaherpesviruses including Kaposi's sarcoma-associated herpesvirus (KSHV or human herpesvirus 8) and Epstein–Barr virus (EBV) at the levels of both sequence and genome structure (reviewed by Fickenscher & Fleckenstein, 2001Down; Nicholas, 2000Down). HVS has certain features that are typical of the gammaherpesviruses. The genome is approximately 150 kb in length, with 1·4 kb tandem repeats at its termini; the terminal repeats (TR). These GC-rich repeats flank a ‘unique’ region of AT-rich ‘L-DNA’ (so called because of its low density observed on density gradients). HVS subgroups A and C are able to immortalize T-lymphocytes of common marmosets, but only subgroup C is capable of transforming T-cells of other species such as human, rabbit and rhesus monkey. The transforming properties of HVS have been attributed to the first ORF of subgroup A, encoding the saimiri transforming protein A (STP-A) (Jung et al., 1991Down). Subgroup C strains have an STP homologue (STP-C) and a second transforming protein (Tip), expressed from a single transcript at the left end of the L-DNA. These are both essential for immortalization of the host cell by C strain HVS (Duboise et al., 1998Down), although each is independently tumorigenic in transgenic mice (Murphy et al., 1994Down; Wehner et al., 2001Down).

Sequencing of the A11-strain L-DNA revealed 75 open reading frames (Albrecht et al., 1992bDown). A number of these represent homologues of cellular genes. Some (eg ORF 2/vDHFR, ORF 16/vBcl2, ORF 72/vCyclin) are shared by most of the rhadinoviruses, while others (eg ORF 15/vCD59, ORF 13/vIL17) are unique to HVS or carried by only a few viruses. Most of the HVS ORFs are transcribed during the HVS lytic cycle, under the temporal control of ORFs 50 and 57 (Nicholas et al., 1988Down, 1991Down; Whitehouse et al., 1997Down, 1998aDown, bDown).

In contrast, only three genes (ORFs 73, 72 and 71) are transcribed from a common promoter during an HVS latency model in a non-transforming strain (Hall et al., 2000aDown). In KSHV, the latent persistence of the herpesvirus episome requires the action of the protein expressed from ORF 73 (LANA) (Ballestas et al., 1999Down; Ballestas & Kaye, 2001Down), which binds to the TR of the virus to mediate persistence (Ballestas & Kaye, 2001Down) and episome replication (Garber et al., 2002Down; Grundhoff & Ganem, 2003Down; Hu et al., 2002Down). ORF 73 of HVS shows considerable sequence homology to LANA in the region responsible for latent replication of the episome (Grundhoff & Ganem, 2003Down), and both proteins associate with metaphase chromosomes and exhibit similar nuclear distribution during interphase (Hall et al., 2000bDown). The functional relationship of LANA and HVS ORF 73 was confirmed by combining three copies of the HVS terminal repeats with ORF 73 in a plasmid, which is maintained as an episome (Collins et al., 2002Down).

One of the major tools for the functional characterization of viral genes and other non-transcribed elements is the creation of mutants. Conventional mutagenesis strategies require the production of viruses that remain replication competent. This therefore precludes the mutation of genes essential for the replication, packaging and infection aspects of the virus life-cycle. Recently, this problem has been overcome by the use of F-factor-based bacterial artificial chromosomes (BACs) for the cloning and mutagenesis of viral genomes (reviewed in Wagner et al., 2002Down). The initial cloning of murine cytomegalovirus, the prototype betaherpesvirus, into a BAC (Messerle et al., 1997Down) has been followed by the generation of BACs carrying the genomes of herpes simplex virus (Horsburgh et al., 1999Down; Saeki et al., 1998Down; Stavropoulos & Strathdee, 1998Down), human CMV (Borst et al., 1999Down), and the gammaherpesviruses EBV (Delecluse et al., 1998Down), KSHV (Delecluse et al., 2001Down; Zhou et al., 2002Down) and murine gammaherpesvirus 68 (MHV-68) (Adler et al., 2000Down).

BAC elements have recently been cloned into the H-DNA of the HVS C-strain virus C484-77 (Collins et al., 2002Down). The resultant HVS-C-BACs retained one disrupted copy of the terminal repeat unit, and were able to undergo productive lytic infections, but did not directly persist as latent episomes. Persistent episomes were produced by incorporation of four copies of TR into the BAC.

Here we describe the cloning into a BAC of the herpesvirus saimiri A11-S4 strain (Desrosiers et al., 1984Down, 1986Down), which is a non-transforming mutant of the sequenced strain (Desrosiers et al., 1985Down). We elected to target the BAC to ORF 15 (vCD59) of HVS, which lies between conserved gene blocks. This gene is unique among the gammaherpesviruses, and encodes a homologue of mammalian CD59, a complement control protein (Albrecht et al., 1992aDown). Human CD59 inhibits complement action by restricting the formation of the membrane attack complex, the last stage of complement-mediated cytolysis. HVS vCD59 also protects against cytolysis, but over a broader host range, protecting cells from lysis by rat serum as well as human and squirrel monkey serum, and is expressed only during the lytic cycle (Rother et al., 1994Down). While vCD59 may play a role in vivo in protecting infected cells and/or the virus from immune destruction, it seemed unlikely to be required for in vitro replication and infection. We have investigated the cell culture phenotype of the HVS-BAC and compared it to the parental strain. We have then adapted a RecA-based modification system to allow the introduction of precise modifications into the HVS-BAC, and have used this to both exchange marker genes and to delete the HVS terminal repeats.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Construction of BAC-incorporation construct p4348.
The GFP and hygromycin phosphotransferase (Hyg) expression cassettes from p5253 (Wade-Martins et al., 2000Down) were subcloned into pBSKSII+ (Stratagene). The GFP coding region was excised by AgeI/BlpI and replaced by PCR-amplified and AgeI/BlpI-digested dsRed from pDsRed1-C1 (Clontech). BAC elements were excised by SacI/XhoI from pEBV-BAC (White et al., 2002Down) and by NotI/XhoI from pBAC108L (Shizuya et al., 1992Down) and connected by an oligonucleotide linker (GAGCTCGGCGCGCCTAGGCCGGCCAGCGATCGGGCCGC) digested with NotI/SacI. The RFP and Hyg cassettes were cloned into the BAC with NotI/SalI to produce p4343.2. Another linker (CAATTGGCCGGCCTAGGCGCGCCCAATTG) was cloned into the unique MfeI site of the plasmid pKK106 (Knust et al., 1983Down) containing the EcoF fragment of HVS. The BAC was cloned into this modified plasmid, with AscI, in both orientations to produce p4348+ and p4348- (Fig. 1DownA). DNA was purified on a Maxiprep column (Qiagen) using the manufacturer's low copy plasmid protocol.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of construction of HVS-BACs. (A) BAC elements alongside expression cassettes for hygromycin phosphotransferase (Hygr) and dsRed were cloned into the MfeI site of pKK106 (which contains the EcoF fragment of HVS) in the orientation shown to create p4348+ or in the reverse orientation to make p4348-. These constructs were transfected into cells carrying HVS and as a result of homologous recombination (as indicated by grey dashed lines) the BAC elements were introduced into the HVS genome. In its latent state, the HVS genome is circularized at the terminal repeats (TR) flanking the unique region (or L-DNA). (B) Sequencing of the left end of L-DNA confirms the SacI deletion in the A11-S4 strain produced by Desrosiers et al. (1984)Down. Positions are as in published sequence X64346 (Albrecht et al., 1992bDown).

 
Cell culture, transfection and episome rescue assays.
Owl monkey kidney (OMK) cells and A549 cells were grown in DMEM supplemented with 10 % foetal bovine serum (Invitrogen). BAC DNA was purified by alkaline lysis followed by caesium chloride density gradient centrifugation. Transfections were performed using an integrin-targeting peptide combined with Lipofectin (Invitrogen) as described previously (Hart et al., 1998Down). Cells were exposed to lipid–peptide–DNA complexes for 4–6 h in serum-free DMEM. For the selection of A549 cells latently infected with HVS-BAC, media were supplemented with hygromycin B at 200 µg ml-1 2 days after transfection. Circular episomes were recovered from cells grown in six-well dishes by preparation of low molecular mass DNA as described previously (Wade-Martins et al., 1999Down). The DNA (1 µg) was electroporated into Electromax E. coli DH10B (Invitrogen) and plated on LB agar supplemented with 12·5 µg chloramphenicol ml-1.

Virus was titrated as follows. Virus stocks were serially diluted 1 in 10 twice and 1 in 5 twice. Twenty µl of each dilution was added to 1 ml serum-free medium and left on OMK cells in a six-well plate with occasional mixing for 1 h. The medium was replaced with DMEM containing 5 % FCS and left overnight. This medium was replaced with a 1 : 1 mix of DMEM (10 % FCS) and 2 % low melting point agarose in PBS. After the agarose had set, it was overlaid with DMEM (5 % FCS) to prevent drying of the agarose gel. Virus plaques were counted (typically 1–2 weeks post-infection in the two lowest-concentration wells, which contained 0·2 and 0·04 µl of neat virus) to assess virus titre.

RNA analysis.
Total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's instructions and reverse transcribed with Superscript II (Invitrogen) for 1 h at 42 °C using an oligo(dT) primer. cDNA was then amplified by PCR using specific primers for ORFs 57 and 73 as appropriate, with primers for GAPDH as a cellular control as described previously (Smith et al., 2001Down). ORF 15 was amplified with a forward primer, ORF15-Fwd (TGCAAGCCAATACACAGCTTGC), and reverse primer, ORF15-mid-rev (GTCATCAAACTTCCACACCTG).

RecA-mediated recombination.
Recombination plasmids pKOV-KanF and pDF25-Tet are described previously (Lalioti & Heath, 2001Down). The NotI–BbsI fragment containing the chloramphenicol gene was deleted from pKOV-KanF to produce pKOV-Kan-{Delta}Cm. The targeting construct pKOV-Kan-GFP was constructed by cloning the CMV-GFP expression cassette (NotI–ClaI from p5253; Wade-Martins et al., 2000Down), via pBSKSII+, into BamHI–XhoI of pKOV-Kan-{Delta}Cm. pKOV-Kan (and derivatives) and pDF25-Tet (a RecA expression plasmid) were grown at 30 °C in 10 ml LB cultures. DNA was isolated by a standard alkaline lysis miniprep protocol.

The deletion of the terminal repeats was achieved with the construct pKOV-Kan-{Delta}TR. This contained PCR products from the left end (primers CGCGGTGACCTTACTGCAGCACTATGTGATTC and GCCATCGATGACTACTACATCTTCTGTACCAG) and the right end (primers CGCACGCGTGCAGAGGCTTGTGAGTGCAGAG and CGCGGTCACCGGCTTAATTACTACAGCAGCAG) of the HVS L-DNA. The left end region (positions 186 to 451 and 4271 to 4421 of L-DNA; accession no. X64346) includes the S4 strain deletion site, whereas the right end region (position 109620 to 110029) is in the middle of ORF75. These two regions were cloned together in pBluescript, through the BstEII sites designed into the PCR primers. This targeting region was then subcloned into pKOV-Kan-{Delta}Cm with BamHI/SalI to construct pKOV-Kan-{Delta}TR.

DH10B cells carrying the BAC pHVS15+.1 were made transformation-competent with calcium chloride. These were co-transformed with 1 µg of targeting construct (pKOV-Kan-GFP) and 5 µg of pDF25-Tet, and plated onto LB agar supplemented with chloramphenicol (cm), tetracycline (tet) and kanamycin (kan) at 30 °C overnight. A streak of colonies (5–50) was picked into 1 ml LB, and 100 µl plated immediately onto LB agar (cm+kan) and incubated overnight at 43 °C. Larger colonies were picked into 10 ml LB, grown overnight and analysed by restriction enzyme digestion to identify cointegrants.

E. coli carrying the correct cointegrant were made transformation-competent, transformed with 2 µl of pDF25-Tet and grown overnight on LB agar (cm+tet) at 30 °C. Pools of colonies were then picked into 1 ml of LB (cm+tet) supplemented with sucrose to 5 % w/v. This was grown for 8 h at 30 °C and then 1–10 µl streaked on LB agar supplemented with sucrose (5 %) and cm, and grown at 43 °C overnight. The colonies were replica plated onto cm+kan LB agar plates to screen for colonies surviving due to mutation in the sacB gene. Colonies that failed to grow on kanamycin were picked and BAC DNA analysed by restriction enzyme digestion and PCR to distinguish recombinants from revertants and to check the integrity of the BAC.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Production of a herpesvirus saimiri BAC
The BAC vector sequences, alongside expression cassettes for the selectable marker hygromycin phosphotransferase and the visible marker dsRed, were cloned into the HVS EcoF plasmid, in both possible orientations to create p4348+ and p4348- (Fig. 1AUp). The BAC was cloned into ORF 15, flanked by homology regions of 4·0 kb (ORFs 11–14) and 4·6 kb (ORFs 16–19), which were used to recombine the BAC sequences into the viral genome. The vCD59 ORF was thereby truncated from 120 codons to encoding amino acids 1–72 of vCD59, plus ten further amino acids before the stop codon. Human CD59 is held together by five disulphide bonds, and is anchored into the cell membrane by a GPI anchor, which is attached during cleavage of the C-terminal part of the protein. Homology between vCD59 and human CD59 shows that these key elements are conserved between the two proteins (Albrecht et al., 1992aDown). The truncation removes three key cysteine residues involved in linkages and removes the site at which the GPI anchor is attached. This makes it extremely unlikely that the truncated protein (if expressed) has retained its function in the virus. The two BAC constructs were transfected into A549 lung carcinoma cells that carry the S4 non-transforming mutant of the A11 strain of HVS as a stable episome (Hall et al., 2000aDown). To achieve this, the virus had been modified by incorporation of neomycin resistance and GFP expression cassettes into the right end of the viral genome, by homologous recombination in ORF 75 (Hall et al., 2000aDown). After two weeks of selection with hygromycin, low molecular mass DNA from resistant cells was transformed into bacteria, and BAC DNA was extracted and screened for integrity by restriction analysis. Two apparently intact HVS-BACs were recovered from transfection with p4348+, and one from p4348-. These were named pHVS15+1, pHVS15+2 and pHVS15-1 respectively.

Restriction analyses of the BACs produced band sizes that were consistent with those expected from the published sequence (Albrecht et al., 1992bDown). Bands containing ORF 15 were changed in ways consistent with the incorporation of the BAC elements by homologous recombination at ORF 15. The three BACs differed only in the orientation of the BAC elements (which depended on the targeting construct from which they were derived), and the size of their terminal repeats. pHVS15+1 and +2 had TRs of about 55 kb (pHVS15+2 marginally the larger) whereas that of pHVS15-1 was approximately 25 kb. PCR analysis showed that all three BACs lacked an intact ORF 15, but contained appropriate junctions between ORF 15 and BAC elements. This confirmed the restriction analyses that suggested that the BAC had been incorporated by homologous recombination at both flanking regions.

The S4 variant of the A11 strain of HVS is non-transforming and non-oncogenic as a result of a constructed deletion in the left end of the virus (Desrosiers et al., 1984Down, 1985Down, 1986Down). This deletion between SacI sites, where both ORF 1 (STP-A) and ORF 2 (vDHFR) and the region of dyad symmetry that lies in between (Fig. 1BUp) have been removed, was confirmed by subcloning and sequencing of the left end of the viral genome.

However, as determined by PCR and restriction analysis, none of the BACs contained the GFP and neomycin cassettes that were in the virus used to create the A549 cell line from which the BACs were cloned. These cassettes were originally recombined into the junction between ORF75 and the terminal repeats. To analyse this region, pHVS+.1 was digested with MfeI and NotI and the right end was subcloned and sequenced. Both restriction analysis and sequencing showed that the ORF75 end of pHVS15+.1 was identical to the published sequence (Albrecht et al., 1992bDown).

The HVS-BAC produces virus at approximately wild-type levels
The first stage of analysis of the HVS-BAC was to establish whether it was capable of lytic virus replication. In most cell types, HVS infection generates a latent episome, but can be switched to its program of lytic replication and virus production by chemical stimuli such as n-butyrate or TPA. In contrast, OMK cells support the constitutive activity of the HVS lytic cycle. After transfection into OMK cells, all three HVS-BACs efficiently entered a productive lytic cycle, producing characteristic plaques surrounded by cells that expressed dsRed, indicative of a lytic infection by the HVS-BAC-derived virus (Fig. 2DownA). The supernatant from these cells was harvested and used to infect further OMK cells, in order to scale up the production of virus. Titres of HVS-BAC in the supernatant were approximately 1x106 p.f.u. ml-1, similar to titres attained from wild-type virus. RT-PCR analysis of OMK cells infected with the HVS-BACs was able to detect polyadenylated ORF 15 RNA from parental virus, but could not demonstrate any RNA predicted to produce the vCD59 truncated by insertion of the BAC elements. Other ORFs tested were transcribed normally (Fig. 2BDown).



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of BAC-derived virus. (A) Upon transfection into OMK cells, pHVS15+.1 produces a lytic plaque characteristic of HVS expression. Fluorescence microscopy reveals dsRed expression from the incorporated BAC. (B) RT-PCR of lytic infections in OMK cells. Several viral ORFs (with GAPDH as a cellular control) were analysed as indicated. The cell lines had been infected by: no virus (lane 1); strain A11-S4 (lane 2); HVS15+.1 (lane 3). ORF 15 RNA was amplified using ORF15-fwd and ORF15-mid-rev primers. Other PCRs are as described previously (Smith et al., 2001Down).

 
To study the time-course of virus production, OMK cells were infected with HVS at both a high (5x104 p.f.u. per well) and low (1x103 p.f.u. per well) m.o.i. in a six-well dish. The supernatant was harvested on days 2 to 7 post-infection and the virus titre measured (Fig. 3Down). Similar maximum virus titres were observed for A11-S4 and HVS-BACs. At high titres, A11-S4 was marginally more productive, but the BAC and parental viruses behaved identically at the lower titre (Fig. 3BDown). Taken together, this suggests that the HVS-BACs represent a valid model for wild-type virus behaviour, and also demonstrates that ORF15 is dispensable in vitro for virus production.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Time-course of virus production. Six wells of OMK cells (approx. 1x106 cells per well) were exposed to (A) 5x104 p.f.u. per well (m.o.i. of 0·05) or (B) 1x103 p.f.u. per well (m.o.i. of 0·001) of virus. The supernatant was harvested from one well each day and assayed for virus titre. Solid lines/open circles indicate wild-type A11-S4 virus. Dashed lines indicate the three HVS-BACs: pHVS15-.1 (filled triangles); pHVS15+.1 (filled squares); pHVS15+.2 (filled diamonds).

 
pHVS15 virus can infect and adopt a latent state in A549 lung carcinoma cells
To assess the ability of the BAC-derived viruses to enter a latent state, A549 cells were infected with the virus from the three HVS-BACs, split into six subpopulations and grown in the presence of hygromycin B to select for infected cells. Red fluorescence from dsRed expression developed slowly, but was apparent at low levels in most latently infected cells. Approximately 3 weeks after infection, low molecular mass DNA was extracted from the cells and transformed into bacteria. BAC clones rescued into bacteria were analysed by restriction enzyme digestion and pulsed-field gel electrophoresis. Approximately half of the rescued episomes gave an identical NotI restriction pattern to that of the parental BAC (Fig. 4DownA). NotI cuts once in the BAC elements and once per 1·4 kb repeat unit in the TR. Further analysis of these apparently intact BACs with AgeI showed a reduction in TR size compared with the parental BAC (Fig. 4BDown). It is unclear whether these differences have been introduced during the packaging of viral DNA or if they represent a tendency of the TR to reduce in size during latency in A549 cells.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 4. Episomes rescued from A549 cells latently infected with HVS-BACs. Low molecular mass DNA was extracted from populations of A549 cells that had been infected with HVS-BACs and selected with hygromycin. For each population, DNA was transformed into bacteria, two bacterial colonies were picked and DNA extracted. (A) After digestion with NotI, and analysis by pulsed-field gel electrophoresis, approximately half of the episomes are seen to differ from their parental BAC (marked M). (B) Further analysis of intact rescues by AgeI digestion shows band variation. This is due to differences in terminal repeats, which are digested by NotI, but not AgeI.

 
HVS-BAC can be modified precisely using RecA-mediated recombination
One of the major advantages of BACs is that they can be precisely modified by recombination in bacteria. We have used a RecA-mediated recombination strategy that uses a targeting construct containing positive and negative selection markers alongside the recombination target (pKOV-Kan and derivatives) while supplying RecA in trans from a separate plasmid (pDF25-Tet). The transient expression of RecA provided by this system has been reported to stabilize the recombination intermediates, and to reduce unwanted internal rearrangements (Lalioti & Heath, 2001Down). As proof of principle for the system, we exchanged the dsRed coding region for that of GFP, using the CMV promoter (750 bp) and the SV40 polyA (480 bp) as regions of homology. Initial attempts to modify the BAC were complicated by the presence of the chloramphenicol resistance (Cmr) gene in the targeting construct pKOV-Kan, which was prone to homologous recombination with the Cmr gene of the BAC, a phenomenon not previously observed in this system (Lalioti & Heath, 2001Down). The Cmr gene was deleted to produce pKOV-Kan-{Delta}Cm, which was used to construct pKOV-Kan-GFP. This mediated the replacement of the dsRed gene of pHVS15+.1 with GFP according to the scheme shown in Fig. 5DownA. An initial cointegrant was isolated, and the second recombination event produced several BACs of which two recombinants (pHVS15+GFP.1 and .10) and one revertant (pHVS15+rGFP.9) were analysed further. Transfection of the BACs into OMK cells yielded characteristic lytic plaques, with the pHVS15+GFP showing strong GFP expression and no red fluorescence (Fig. 5BDown). Restriction analysis indicated that the GFP coding region had precisely replaced the dsRed coding region (data not shown). Furthermore, viral episomes were rescued intact from A549 cells latently infected with pHVS15+GFP virus, indicating that the recombination process does not interfere with the basic functions of the virus.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5. Modification of HVS-BAC by recombination. (A) Schematic showing the process by which the dsRed cassette was replaced by GFP using RecA-mediated recombination. Briefly, the transfection of the targeting construct (pKOV-Kan-GFP) and RecA into cells carrying pHVS15+.1 allows the homologous recombination between identical regions (in this case the CMV promoter). These are selected by growth on chloramphenicol (Cm) and kanamycin (Kan) at 43 °C (non-permissive for the origin of pKOV-Kan-GFP) to isolate cointegrants. These are then resolved by a second recombination mediated by RecA. This can either be between the same elements that produced the cointegrant (single headed arrow) to produce a revertant (identical to the original BAC) or between the other homology regions (containing the polyA site in this case; double-headed arrow) to produce a recombinant incorporating the change (dsRed to GFP). These are selected by growth at 43 °C on Cm and 5 % sucrose (suc). Random mutations in the SacB gene will produce cointegrants that also survive this selection. These are screened out by replica plating onto kanamycin. (B) OMK cells transfected with recombinant HVS15+GFP produce characteristic plaques, indicating that viral function is not impaired by the recombination process.

 
Deletion of the viral terminal repeats prevents a productive lytic replication cycle and virus latency
To assess the importance of the terminal repeats to the virus life-cycle, we constructed pKOV-Kan-{Delta}TR, which carried regions from near the left and right ends of the HVS genome, cloned together as a recombination target. RecA-mediated recombination of pHVS15+1 produced one HVS-BAC (pHVS15+{Delta}TR.5) from which the TR had been deleted, along with 2900 bp of the right end of the viral L-DNA and 180 bp of the left end of the genome.

To determine the impact of the deletion, pHVS15+{Delta}TR.5 was transfected into OMK cells alongside pHVS15+1. Four days after transfection, pHVS15+.1 had generated viral plaques, whereas pHVS15+{Delta}TR.5 formed a few abortive foci of infection (Fig. 6DownA), but was unable to generate functional virus or conventional viral plaques. To assess the behaviour of these BACs as latent episomes, pHVS15+{Delta}TR.5 and pHVS15+.1 were transfected into SW480 cells, split into 96-well plates after 48 h (250 cells per well) and selected with hygromycin. The majority of wells containing cells transfected with pHVS15+.1 generated colonies, while only a tiny minority of wells containing pHVS15+{Delta}TR.5 produced colonies, and did so no more frequently than a BAC vector containing no HVS elements (Fig. 6BDown). Furthermore, episome was rescued from pHVS+.1 colonies, but could not be recovered from cells transfected with pHVS15+{Delta}TR.5.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6. Behaviour of pHVS15+{Delta}TR.5. (A) pHVS15+1 and pHVS15+{Delta}TR.5 were transfected into OMK cells. After 4 days, cells were fixed and imaged by fluorescent microscopy. (B) Colony forming assay. BACs were transfected into SW480 cells. After 48 h, cells were counted and separated into wells of a 96-well dish, at 250 cells per well. Cells were grown for 2 weeks in the presence of hygromycin (125 µg ml-1) and then the percentage of wells containing colonies was counted. Histogram shows the mean and standard deviation of three independent experiments.

 

   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
In recent years, the BAC has become a valuable tool in the analysis of herpesvirus function (Wagner et al., 2002Down). Here we demonstrate the production of a BAC containing the genome of the non-transforming herpesvirus saimiri A11 strain S4. As with all viral BACs the first decision to make is where to insert the BAC elements. Some groups have tried to minimize the disruption of virus function, for instance by duplicating part of the region into which the BAC was introduced (Saeki et al., 1998Down) or by inserting BAC elements into intergenic regions, such as the site of the natural deletion in EBV strain B95-8 (Delecluse et al., 1998Down). Alternatively, the targeted disruption of virus function might be sought, such as the ORF56 gene of KSHV, whose deletion prevented spontaneous entry into lytic replication (Delecluse et al., 2001Down). Even targeted insertions of BAC elements cannot prevent unintended consequences for virus function. Where BAC elements were inserted between ORFs 18 and 19 of KSHV, both ORFs were expressed at a raised level in both latent and lytic life-cycles (Zhou et al., 2002Down). The insertion of the BAC between the TRs and the first ORF of murine gammaherpesvirus-68 produced a virus that behaved as wild-type in cell culture (Adler et al., 2000Down). However, in vivo, the virus was impaired unless the BAC elements were deleted by Cre–loxP recombination (Adler et al., 2001Down). The reason for such disruptions are not yet clear, but may be associated with size constraints for the packaging of the virus imposed by the extra sequence represented by the BAC. Also, most of the herpesvirus BACs cloned to date carry an antibiotic-selectable marker and a visible marker gene, driven by strong promoters. These may have a disruptive effect on the expression of viral genes that are crucial for the delicate virus-host balance observed in vivo, whereas such an effect may go unnoticed in vitro. Given the highly restrictive expression patterns associated with latent herpesviruses, and the precision with which the lytic replication cycle is controlled, a relatively minor change might have a substantial effect on virulence.

We chose to introduce the BAC elements into a gene that we hoped would minimally affect the viability of the virus. Since ORF 15 is unique to HVS, and lies within a region that is highly variable between different herpesviruses, it seemed unlikely to be essential for the virus tissue culture phenotype. This proved to be the case, as the HVS-BACs produced virus at levels similar to the parental A11-S4 strain. Like its cellular homologue CD59, ORF 15 is able to down-regulate complement activation in a number of different species (Rother et al., 1994Down). Undoubtedly this plays a role in vivo, but the nature of the gene suggests that the disruption will have almost no effect on any aspects of its life-cycle except those related to evasion of the complement response. The introduction of the BAC elements into ORF 15 as described here has not impaired the growth of HVS in vitro, and provides a potentially useful model for the future analysis of HVS. The recently reported HVS C488-77 strain BAC has been cloned by insertion of BAC elements in place of the H-DNA (Collins et al., 2002Down). This BAC, although capable of creating infectious virions, does not generate latent episomes unless the TR are re-incorporated into the BAC.

The sensitivity of the episome rescue technique permits the analysis of individual latent episomes, and has shown that a number of episomes maintained in A549 cells have undergone rearrangements. Investigations of HVS-transformed cell lines that had lost their ability to produce infectious virus have identified a reduced quantity of unique sequences (L-DNA) when compared to terminal repeats (H-DNA) (Fleckenstein et al., 1977Down; Kaschka-Dierich et al., 1982Down; Werner et al., 1977Down). Analysis of these deletions demonstrated that, at their most substantial, they retained only the 15 kb regions at the flanks of the L-DNA (Schirm et al., 1984Down). Analysis of three rearranged HVS-BAC episomes suggest that they consistently lose the region of the genome around ORF 50 (data not shown), which is responsible for the switch from the latent to lytic replication cycle, suggesting a growth advantage for cells carrying episomes that are unable to reactivate from latency. Rearranged HVS genomes were also observed in a persisting form of the C484-77 strain BAC (Collins et al., 2002Down).

One of the major advantages of BACs is that the DNA insert can be precisely manipulated by recombination (reviewed in Wagner et al., 2002Down). We have used a RecA-based system previously shown to efficiently mediate homologous recombination with a very low incidence of unwanted rearrangements (Lalioti & Heath, 2001Down). Furthermore, this approach, in which a cointegrant intermediate is resolved into a recombinant (see Fig. 4AUp) allows any change (substitutions, deletions or insertions) to be achieved. The chief alternative to RecA is the use of ET recombination. This requires only short regions of homology, which may be advantageous for modification strategies but raises problems of illegitimate recombination between repeats within the herpesvirus genome. Use of the recently described GET recombination system (Narayanan et al., 1999Down) allowed the targeted deletion of genes from bovine herpesvirus with no such complications apparent, with a requirement for only 50 bp of homology (Mahony et al., 2002Down).

We have used the RecA system to modify the HVS-BAC. As with ET recombination, a high degree of precision can be achieved, as shown by the precise replacement of dsRed with GFP. The deletion of the HVS terminal repeats and ORF75 produced a genome that is unable to produce infectious virions or to persist as a latent episome. ORF75 encodes a homologue of FGARAT, an enzyme of purine synthesis. The protein is found in the viral tegument, alongside ORF3, another FGARAT homologue encoded by HVS (Fickenscher & Fleckenstein, 2001Down). While this enzyme may have a transforming role, the apparent redundancy and enzymatic function of ORF75 makes it seem unlikely that it would be essential to either the lytic or latent cycle of the virus in vitro. Work with KSHV has shown that the terminal repeats, in conjunction with the gene product of ORF73 are sufficient to mediate the persistence of KSHV episomes (Ballestas & Kaye, 2001Down; Fejér et al., 2003Down; Grundhoff & Ganem, 2003Down). The C484-77 HVS-BAC was constructed by cloning the BAC elements, with NotI, into the TR of HVS. This deleted most of the TR, leaving only 80 bp on one side of the BAC elements, and approximately 1350 bp on the other. This BAC is also unable to establish itself as a latent episome, although recombining the TR into the BAC restored latency (Collins et al., 2002Down). However, in contrast to pHVS15+{Delta}TR.5, three of the five C484-77 HVS-BACs were able to undergo a productive lytic infection. This observation implies that at least one of the junctions between the TR and the remainder of the genome, or a single copy of an element within the C484-BAC's remnant of H-DNA, plays a key role in the packaging of HVS. An interesting comparison can be made with EBV, where a unique 9 bp sequence at the junction between the right end of the terminal repeats and the left end of the unique region of the genome is essential for virus packaging (Zimmermann & Hammerschmidt, 1995Down). Deletion of the EBV TR (including this flanking sequence) from an EBV-BAC produced a virus that was unable to package itself into infectious virions, but because latency was unaffected it could be used as a helper virus to package other constructs in trans (Delecluse et al., 1999Down). The abrogation of both lytic and latent function of HVS by deletion of TR impedes further characterization of pHVS15+{Delta}TR.5, but taken with the data from the C484-77 HVS-BAC provides strong evidence for a role of the TR-flanking regions in generating infectious HVS particles.

In conclusion, we have cloned the strain A11-S4 herpesvirus saimiri genome into a BAC. We have shown that the virus exhibits essentially wild-type function, despite the deletion of ORF 15. We have then demonstrated the use of a RecA-based system for introducing changes into the HVS-BAC. We used recombination to substitute dsRed for GFP, and to delete the viral terminal repeats. This has demonstrated that the TR is essential for both the lytic and latent function of the virus. The use of herpesvirus BACs is set to play a major role in the analysis of viral gene function in the future. The precision with which modifications can be made in E. coli will allow both simple deletions and more complex substitutions and modifications to be made in viral genomes. This promises to accelerate the study of the many herpesvirus genes, with the consequent promise of anti-viral drug design as productive targets are identified. There is further potential in the development of herpesviruses as high capacity gene delivery vectors or as vaccines designed against a wide range of strains.


   ACKNOWLEDGEMENTS
 
The authors wish to thank Maria Lalioti for pKOV-Kan and pDF25-tet, and for advice on their use. This work was supported in parts by grants to A. W. from the Candlelighter's Trust and Yorkshire Cancer Research.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Adler, H., Messerle, M., Wagner, M. & Koszinowski, U. H. (2000). Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. J Virol 74, 6964–6974.[Abstract/Free Full Text]

Adler, H., Messerle, M. & Koszinowski, U. H. (2001). Virus reconstituted from infectious bacterial artificial chromosome (BAC)-cloned murine gammaherpesvirus 68 acquires wild-type properties in vivo only after excision of BAC vector sequences. J Virol 75, 5692–5696.[Abstract/Free Full Text]

Albrecht, J. C., Nicholas, J., Cameron, K. R., Newman, C., Fleckenstein, B. & Honess, R. W. (1992a). Herpesvirus saimiri has a gene specifying a homologue of the cellular membrane glycoprotein CD59. Virology 190, 527–530.[CrossRef][Medline]

Albrecht, J. C., Nicholas, J., Biller, D. & 7 other authors (1992b). Primary structure of the herpesvirus saimiri genome. J Virol 66, 5047–5058.[Abstract/Free Full Text]

Ballestas, M. E. & Kaye, K. M. (2001). Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J Virol 75, 3250–3258.[Abstract/Free Full Text]

Ballestas, M. E., Chatis, P. A. & Kaye, K. M. (1999). Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284, 641–644.[Abstract/Free Full Text]

Borst, E. M., Hahn, G., Koszinowski, U. H. & Messerle, M. (1999). Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol 73, 8320–8329.[Abstract/Free Full Text]

Collins, C. M., Medveczky, M. M., Lund, T. & Medveczky, P. G. (2002). The terminal repeats and latency-associated nuclear antigen of herpesvirus saimiri are essential for episomal persistence of the viral genome. J Gen Virol 83, 2269–2278.[Abstract/Free Full Text]

Delecluse, H. J., Hilsendegen, T., Pich, D., Zeidler, R. & Hammerschmidt, W. (1998). Propagation and recovery of intact, infectious Epstein–Barr virus from prokaryotic to human cells. Proc Natl Acad Sci U S A 95, 8245–8250.[Abstract/Free Full Text]

Delecluse, H. J., Pich, D., Hilsendegen, T., Baum, C. & Hammerschmidt, W. (1999). A first-generation packaging cell line for Epstein–Barr virus-derived vectors. Proc Natl Acad Sci U S A 96, 5188–5193.[Abstract/Free Full Text]

Delecluse, H. J., Kost, M., Feederle, R., Wilson, L. & Hammerschmidt, W. (2001). Spontaneous activation of the lytic cycle in cells infected with a recombinant Kaposi's sarcoma-associated virus. J Virol 75, 2921–2928.[Abstract/Free Full Text]

Desrosiers, R. C., Burghoff, R. L., Bakker, A. & Kamine, J. (1984). Construction of replication-competent Herpesvirus saimiri deletion mutants. J Virol 49, 343–348.[Abstract/Free Full Text]

Desrosiers, R. C., Bakker, A., Kamine, J., Falk, L. A., Hunt, R. D. & King, N. W. (1985). A region of the Herpesvirus saimiri genome required for oncogenicity. Science 228, 184–187.[Abstract/Free Full Text]

Desrosiers, R. C., Silva, D. P., Waldron, L. M. & Letvin, N. L. (1986). Nononcogenic deletion mutants of herpesvirus saimiri are defective for in vitro immortalization. J Virol 57, 701–705.[Abstract/Free Full Text]

Duboise, S. M., Guo, J., Czajak, S., Desrosiers, R. C. & Jung, J. U. (1998). STP and Tip are essential for herpesvirus saimiri oncogenicity. J Virol 72, 1308–1313.[Abstract/Free Full Text]

Fejér, G., Medveczky, M. M., Horvath, E., Lane, B., Chang, Y. & Medveczky, P. G. (2003). The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus interacts preferentially with the terminal repeats of the genome in vivo and this complex is sufficient for episomal DNA replication. J Gen Virol 84, 1451–1462.[Abstract/Free Full Text]

Fickenscher, H. & Fleckenstein, B. (2001). Herpesvirus saimiri. Philos Trans R Soc Lond B Biol Sci 356, 545–567.[Abstract/Free Full Text]

Fleckenstein, B., Muller, I. & Werner, J. (1977). The presence of Herpesvirus Saimiri genomes in virus-transformed cells. Int J Cancer 19, 546–554.[Medline]

Garber, A. C., Hu, J. & Renne, R. (2002). Latency-associated nuclear antigen (LANA) cooperatively binds to two sites within the terminal repeat, and both sites contribute to the ability of LANA to suppress transcription and facilitate DNA replication. J Biol Chem 277, 27401–27411.[Abstract/Free Full Text]

Grundhoff, A. & Ganem, D. (2003). The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus permits replication of terminal repeat-containing plasmids. J Virol 77, 2779–2783.[Abstract/Free Full Text]

Hall, K. T., Giles, M. S., Goodwin, D. J., Calderwood, M. A., Carr, I. M., Stevenson, A. J., Markham, A. F. & Whitehouse, A. (2000a). Analysis of gene expression in a human cell line stably transduced with herpesvirus saimiri. J Virol 74, 7331–7337.[Abstract/Free Full Text]

Hall, K. T., Giles, M. S., Goodwin, D. J., Calderwood, M. A., Markham, A. F. & Whitehouse, A. (2000b). Characterization of the herpesvirus saimiri ORF73 gene product. J Gen Virol 81, 2653–2658.[Abstract/Free Full Text]

Hart, S. L., Arancibia-Carcamo, C. V., Wolfert, M. A. & 12 other authors (1998). Lipid-mediated enhancement of transfection by a nonviral integrin-targeting vector. Hum Gene Ther 9, 575–585.[Medline]

Horsburgh, B. C., Hubinette, M. M., Qiang, D., MacDonald, M. L. & Tufaro, F. (1999). Allele replacement: an application that permits rapid manipulation of herpes simplex virus type 1 genomes. Gene Ther 6, 922–930.[CrossRef][Medline]

Hu, J., Garber, A. C. & Renne, R. (2002). The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus supports latent DNA replication in dividing cells. J Virol 76, 11677–11687.[Abstract/Free Full Text]

Jung, J. U., Trimble, J. J., King, N. W., Biesinger, B., Fleckenstein, B. W. & Desrosiers, R. C. (1991). Identification of transforming genes of subgroup A and C strains of herpesvirus saimiri. Proc Natl Acad Sci U S A 88, 7051–7055.[Abstract/Free Full Text]

Kaschka-Dierich, C., Werner, F. J., Bauer, I. & Fleckenstein, B. (1982). Structure of nonintegrated, circular Herpesvirus saimiri and Herpesvirus ateles genomes in tumor cell lines and in vitro-transformed cells. J Virol 44, 295–310.[Abstract/Free Full Text]

Knust, E., Schirm, S., Dietrich, W., Bodemer, W., Kolb, E. & Fleckenstein, B. (1983). Cloning of herpesvirus saimiri DNA fragments representing the entire L-region of the genome. Gene 25, 281–289.[CrossRef][Medline]

Lalioti, M. & Heath, J. (2001). A new method for generating point mutations in bacterial artificial chromosomes by homologous recombination in Escherichia coli. Nucleic Acids Res 29, E14.

Mahony, T. J., McCarthy, F. M., Gravel, J. L., West, L. & Young, P. L. (2002). Construction and manipulation of an infectious clone of the bovine herpesvirus 1 genome maintained as a bacterial artificial chromosome. J Virol 76, 6660–6668.[Abstract/Free Full Text]

Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H. & Koszinowski, U. H. (1997). Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci U S A 94, 14759–14763.[Abstract/Free Full Text]

Murphy, C., Kretschemer, C., Biesinger, B., Beckers, J., Jung, J., Desrosiers, R., Müller, H., H., Fleckenstein, B. & Rüther, U. (1994). Epithelial tumours induced by a herpesvirus oncogene in transgenic mice. Oncogene 9, 221–226.[Medline]

Narayanan, K., Williamson, R., Zhang, Y., Stewart, A. F. & Ioannou, P. A. (1999). Efficient and precise engineering of a 200 kb {beta}-globin human/bacterial artificial chromosome in E. coli DH10B using an inducible homologous recombination system. Gene Ther 6, 442–447.[CrossRef][Medline]

Nicholas, J. (2000). Evolutionary aspects of oncogenic herpesviruses. Mol Pathol 53, 222–237.[Abstract/Free Full Text]

Nicholas, J., Gompels, U. A., Craxton, M. A. & Honess, R. W. (1988). Conservation of sequence and function between the product of the 52 kDa immediate-early gene of herpesvirus saimiri and the BMLF1-encoded transcriptional effector (EB2) of Epstein–Barr virus. J Virol 62, 3250–3257.[Abstract/Free Full Text]

Nicholas, J., Coles, L. S., Newman, C. & Honess, R. W. (1991). Regulation of the herpesvirus saimiri (HVS) delayed-early 110-kilodalton promoter by HVS immediate-early gene products and a homolog of the Epstein–Barr virus R trans activator. J Virol 65, 2457–2466.[Abstract/Free Full Text]

Rother, R. P., Rollins, S. A., Fodor, W. L., Albrecht, J. C., Setter, E., Fleckenstein, B. & Squinto, S. P. (1994). Inhibition of complement-mediated cytolysis by the terminal complement inhibitor of herpesvirus saimiri. J Virol 68, 730–737.[Abstract/Free Full Text]

Saeki, Y., Ichikawa, T., Saeki, A., Chiocca, E. A., Tobler, K., Ackermann, M., Breakefield, X. O. & Fraefel, C. (1998). Herpes simplex virus type 1 DNA amplified as bacterial artificial chromosome in Escherichia coli: rescue of replication-competent virus progeny and packaging of amplicon vectors. Hum Gene Ther 9, 2787–2794.[Medline]

Schirm, S., Muller, I., Desrosiers, R. C. & Fleckenstein, B. (1984). Herpesvirus saimiri DNA in a lymphoid cell line established by in vitro transformation. J Virol 49, 938–946.[Abstract/Free Full Text]

Shizuya, H., Birren, B., Kim, U. J., Mancino, V., Slepak, T., Tachiiri, Y. & Simon, M. (1992). Cloning and stable maintenance of 300 kbp fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc Natl Acad Sci U S A 89, 8794–8797.[Abstract/Free Full Text]

Smith, P. G., Coletta, P. L., Markham, A. F. & Whitehouse, A. (2001). In vivo episomal maintenance of a herpesvirus saimiri-based gene delivery vector. Gene Ther 8, 1762–1769.[CrossRef][Medline]

Stavropoulos, T. A. & Strathdee, C. A. (1998). An enhanced packaging system for helper-dependent herpes simplex virus vectors. J Virol 72, 7137–7143.[Abstract/Free Full Text]

Wade-Martins, R., Frampton, J. & James, M. R. (1999). Long-term stability of large insert genomic DNA episomal shuttle vectors in human cells. Nucleic Acids Res 27, 1674–1682.[Abstract/Free Full Text]

Wade-Martins, R., White, R. E., Kimura, H., Cook, P. R. & James, M. R. (2000). Stable correction of a genetic deficiency in human cells by an episome carrying a 115 kb genomic transgene. Nat Biotechnol 18, 1311–1314.[CrossRef][Medline]

Wagner, M., Ruzsics, Z. & Koszinowski, U. H. (2002). Herpesvirus genetics has come of age. Trends Microbiol 10, 318–324.[CrossRef][Medline]

Wehner, L.-E., Schröder, N., Kamino, K., Friedrich, U., Biesinger, B. & Rüther, U. (2001). Herpesvirus saimiri tip gene causes T-cell lymphomas in transgenic mice. DNA Cell Biol 20, 81–88.[CrossRef][Medline]

Werner, F. J., Bornkamm, G. W. & Fleckenstein, B. (1977). Episomal viral DNA in a Herpesvirus saimiri-transformed lymphoid cell line. J Virol 22, 794–803.[Abstract/Free Full Text]

White, R. E., Wade-Martins, R. & James, M. R. (2002). Infectious delivery of 120 kb genomic DNA by an Epstein–Barr virus amplicon vector. Mol Ther 5, 427–435.[CrossRef][Medline]

Whitehouse, A., Carr, I. M., Griffiths, J. C. & Meredith, D. M. (1997). The herpesvirus saimiri ORF50 gene, encoding a transcriptional activator homologous to the Epstein–Barr virus R protein, is transcribed from two distinct promoters of different temporal phases. J Virol 71, 2550–2554.[Abstract/Free Full Text]

Whitehouse, A., Cooper, M., Hall, K. T. & Meredith, D. M. (1998a). The open reading frame (ORF) 50a gene product regulates ORF 57 gene expression in herpesvirus saimiri. J Virol 72, 1967–1973.[Abstract/Free Full Text]

Whitehouse, A., Cooper, M. & Meredith, D. M. (1998b). The immediate-early gene product encoded by open reading frame 57 of herpesvirus saimiri modulates gene expression at a post-transcriptional level. J Virol 72, 857–861.[Abstract/Free Full Text]

Zhou, F. C., Zhang, Y. J., Deng, J. H., Wang, X. P., Pan, H. Y., Hettler, E. & Gao, S. J. (2002). Efficient infection by a recombinant Kaposi's sarcoma-associated herpesvirus cloned in a bacterial artificial chromosome: application for genetic analysis. J Virol 76, 6185–6196.[Abstract/Free Full Text]

Zimmermann, J. & Hammerschmidt, W. (1995). Structure and role of the terminal repeats of Epstein–Barr virus in processing and packaging of virion DNA. J Virol 69, 3147–3155.[Abstract/Free Full Text]

Received 2 June 2003; accepted 15 August 2003.


This article has been cited by other articles:


Home page
Proc R Soc BHome page
K. M Feeney and J. L Parish
Targeting mitotic chromosomes: a conserved mechanism to ensure viral genome persistence
Proc R Soc B, May 7, 2009; 276(1662): 1535 - 1544.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
R. Griffiths, S. M. Harrison, S. Macnab, and A. Whitehouse
Mapping the minimal regions within the ORF73 protein required for herpesvirus saimiri episomal persistence
J. Gen. Virol., November 1, 2008; 89(11): 2843 - 2850.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. E. White, L. Carline, and M. J. Allday
Mutagenesis of the Herpesvirus Saimiri Terminal Repeat Region Reveals Important Elements for Virus Production
J. Virol., June 15, 2007; 81(12): 6765 - 6770.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Griffiths and A. Whitehouse
Herpesvirus Saimiri Episomal Persistence Is Maintained via Interaction between Open Reading Frame 73 and the Cellular Chromosome-Associated Protein MeCP2
J. Virol., April 15, 2007; 81(8): 4021 - 4032.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. D. Estep, M. F. Powers, B. K. Yen, H. Li, and S. W. Wong
Construction of an Infectious Rhesus Rhadinovirus Bacterial Artificial Chromosome for the Analysis of Kaposi's Sarcoma-Associated Herpesvirus-Related Disease Development
J. Virol., March 15, 2007; 81(6): 2957 - 2969.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Calderwood, R. E. White, R. A. Griffiths, and A. Whitehouse
Open reading frame 73 is required for herpesvirus saimiri A11-S4 episomal persistence
J. Gen. Virol., October 1, 2005; 86(10): 2703 - 2708.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, R. E.
Right arrow Articles by Whitehouse, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, R. E.
Right arrow Articles by Whitehouse, A.
Agricola
Right arrow Articles by White, R. E.
Right arrow Articles by Whitehouse, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS