J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 84 (2003), 403-414; DOI 10.1099/vir.0.18501-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dollenmaier, G.
Right arrow Articles by Weitz, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dollenmaier, G.
Right arrow Articles by Weitz, M.
Agricola
Right arrow Articles by Dollenmaier, G.
Right arrow Articles by Weitz, M.
© 2003 Society for General Microbiology

Interaction of glyceraldehyde-3-phosphate dehydrogenase with secondary and tertiary RNA structural elements of the hepatitis A virus 3' translated and non-translated regions

Günter Dollenmaier and Manfred Weitz

Institute of Clinical Microbiology and Immunology, Frohbergstrasse 3, 9001 St Gallen, Switzerland

Correspondence
Günter Dollenmaier
Guenter.Dollenmaier{at}gd-ikmi.sg.ch


   ABSTRACT
TOP
ABSTRACT
Introduction
Methods
Results
Discussion
REFERENCES
 
Proteins interacting with RNA structures at the 3' non-translated region (3'NTR) of picornaviruses are probably important during viral RNA replication. We have shown previously that a dominant cellular cytoplasmic protein of 38 kDa (p38) interacts with the 3'NTR and upstream regions of the hepatitis A virus (HAV) RNA (Kusov et al., J Virol 70, 1890–1897, 1996Down). Immunological and biochemical analyses of p38 have indicated that it is identical to GAPDH, which has previously been described as modulating translational regulation of the HAV RNA by interacting with the 5'NTR (Schultz et al., J Biol Chem 271, 14134–14142, 1996Down). Three separate binding regions for GAPDH in the 3'NTR and in the upstream 3D polymerase-coding region were identified. Structural analysis of these RNA regions by computer modelling and direct enzymatic cleavage suggested the presence of several AU-rich stem–loop structures having the potential for tertiary interactions. Binding of GAPDH to these structures was confirmed by RNA footprint analysis and resulted in the loss of double-stranded RNA regions. A different panel of RNA binding proteins (p28, p41 and p65) was detected in the ribosomal fractions of several cell lines (BSC-1, FRhK-4 and HeLa), whereas RNA binding of the GAPDH that was also present in these fractions was only marginal or absent.


   Introduction
TOP
ABSTRACT
Introduction
Methods
Results
Discussion
REFERENCES
 
The distinct characteristics of the virus particle, the genome organization and the replication in vivo in hepatocytes have led to classification of hepatitis A virus (HAV) as the prototype virus of the genus Hepatovirus among the Picornaviridae. The HAV genome is a single-stranded RNA of plus-strand polarity, which is divided into a large open reading frame (6681 nucleotides) flanked by a 5' non-translated region (5'NTR, 734 nucleotides) and a 3' non-translated region (3'NTR, 63 nucleotides). The RNA terminates with a poly(A) tract of 40–80 nucleotides (Hollinger & Ticehurst, 1990Down). The 5'NTR has extensive secondary structures and part of it comprises an internal ribosome entry site (IRES), which drives cap-independent translation (Brown et al., 1991Down) and has been shown to form an RNA/protein complex with simian glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Chang et al., 1993Down; Schultz et al., 1996Down). This ubiquitous glycolytic enzyme was found to be the major RNA-binding factor in HAV-permissive BSC-1 and FRhK-4 cells but not in HeLa cells. The binding of GAPDH to the IRES occurred at the RNA stem–loop IIIa and was competetively inhibited by addition of exogenous 57 kDa polypyrimidine tract-binding protein (PTB), which also binds to the 5'NTRs of other picornaviruses (Borman et al., 1993Down; Hellen et al., 1993Down). The destabilization of the IRES by GAPDH reduces RNA translation, whilst PTB dramatically increases translation when examined in a bicistronic construct (Yi et al., 2000Down).

In contrast to the 5'NTRs, comparatively little light has been shed on the putative functions of the picornavirus 3'NTR in virus replication. For entero- and rhinoviruses, the existence of tRNA-like 3'-terminal structures has been proposed (Pilipenko et al., 1992Down). Functional analysis of the human rhinovirus 14 (HRV14) 3' stem–loop structure in particular has lent support to the importance of higher-order structure for RNA replication (Rohll et al., 1995Down). Several investigators have shown evidence for the existence of a putative tertiary ‘kissing’ interaction within the two terminal stem–loop structures of poliovirus (PV) and coxsackievirus (Pilipenko et al., 1996Down; Melchers et al., 1997Down, 2000Down; Mirmomeni et al., 1997Down). In stark contrast, Todd et al. (1997)Down have recently reported that synthetic PV and HRV RNAs from which the 3'NTRs had been completely removed, although leaving the poly(A) tract intact, were infectious on transfection of tissue culture cells, albeit at a very low efficiency.

Picornavirus 3'NTRs have been demonstrated to interact with virus proteins and with various cellular factors. HAV RNAs comprising all or part of the 3'NTR and/or sequences of the 3D polymerase (3Dpol)-coding region have been previously demonstrated to interact specifically with proteins from HAV-infected and uninfected cells, among which a protein of apparent molecular mass 38 kDa was the most prominent (Nuesch et al., 1993Down; Kusov et al., 1996Down). Furthermore, computer-aided secondary structure modelling of complete genomes of several picornaviruses, including HAV, has implied that both the 5'- and 3'-terminal regions of individual genomes may, by extensive molecular folding/coiling, be brought into very close spatial proximity to each other (Palmenberg & Sgro, 1997Down). Hence, interaction of proteins with one end of a picornavirus genome may direct virus replication and also influence replicative activity by simultaneous or concerted interaction with the other contiguous end of the RNA. Because detailed knowledge of the interaction of identified proteins with defined nucleic acid structures is crucial to a better understanding of the virus/host relationship, we set out to identify individual proteins that interact with the 3'-terminal region of HAV RNA, to characterize these interactions and to determine the RNA elements involved. Our studies were aimed at the previously unidentified 38 kDa factor and other host proteins that we found to bind to the 3'-terminal virus RNA.

In this report we describe the characterization of p38 by immunological and biochemical means and by UV cross-linking binding experiments, which strongly suggest that the protein is identical to the cellular glycolytic enzyme GAPDH of simian cells. We were able to identify three non-overlapping protein-binding domains in the 3'-terminal HAV RNA that mapped to AU-rich double-stranded regions forming parts of RNA higher-order structures.


   Methods
TOP
ABSTRACT
Introduction
Methods
Results
Discussion
REFERENCES
 
Plasmids.
Subcloning and PCR procedures were performed according to standard protocols (Sambrook et al., 1989Down; Ausubel et al., 1991Down). Oligonucleotides were synthesized by the phosphoramidite method on an Applied Biosystems DNA synthesizer 392. All recombinant plasmids contained sequences from HAV strain HAV7/MK-5 and the nucleotide positions are according to the nucleotide numbering of plasmid pHAV/7 (Cohen et al., 1987Down). Plasmids pGEM-500 and pGEM-90 have been described previously (Kusov et al., 1996Down). Plasmid pGEM-400 was constructed by PCR amplification of HAV sequence nt 7104–7499 using forward primer 7104 (5'-GGACTCGAG7104GCTGAAACCAGTTTCGGAAT7123-3') (XhoI site is underlined) and reverse primer rT7P (5'-AGCTGGCTTATCGAAATTAA-3') and pHAV/7 as template. The PCR product was cut with EcoRI and XhoI and ligated into EcoRI- and SalI-restricted pGEM-1. To obtain pGEM-400{Delta}A, amplification of the HAV region nt 7104–7473, lacking the poly(A)26 tail, was carried out in a similar way using primer r7473 (5'-GCCGGATCCTCTAGAGCGCT7473ATTTACTGATAAAAGAAATA7454-3') (BamHI, XbaI and HaeII sites are underlined) as reverse primer. The PCR product was cleaved with XhoI and BamHI and ligated into SalI- and BamHI-digested pGEM-1. The construction of plasmids pGEM-300, pGEM-300{Delta}A, pGEM-200 and pGEM-200{Delta}A was performed as above using direct primers 7196 (5'-GAACTCGAG7196GGTCTTTAATAGCATGGCAG7215-3') and 7305 (5'-TGGCTCGAG7305TTTTGTTCAGTCCTGTTTGG7324-3'), respectively (XhoI site is underlined).

In vitro synthesis of RNA transcripts.
Recombinant pGEM-1 plasmids were linearized with XbaI within the multiple cloning site (MCS) or with BspHI (nt 7410) or NsiI (nt 7270) within the HAV sequence, for generation of positive-sense RNAs. Radioactively labelled RNA probes were generated by run-off transcription with SP6 RNA polymerase (MAXIscript, SP6/T7 In vitro transcription kit; Ambion) and [{alpha}-33P]UTP (2000 Ci mmol-1; NEN) according to the manufacturer's protocol. Unlabelled RNAs, which were used for competition experiments, were generated with the MEGAscript (SP6/T7) In vitro transcription kit (Ambion).

For generation of control RNAs, MCS plasmid pGEM-1 was linearized with XbaI and subsequently used for in vitro transcription with SP6 RNA polymerase as described above. Control RNA 2C3A was obtained by restriction of pP3 (Gosert et al., 1997Down) with PvuII and subsequent in vitro transcription with T7 RNA polymerase.

Preparation of cellular extracts.
The preparation of cellular extracts was carried out essentially as described by Chang et al. (1993)Down. To avoid contamination of the ribosomal salt wash (RSW) with proteins from the cytoplasmic S-100 fraction, the ribosome-containing pellet was carefully washed two to three times with hypotonic lysis buffer prior to the preparation of the RSW fraction. The protein contents of the extracts were determined by the Bradford procedure (Bio-Rad Protein Assay).

UV cross-linking of protein/RNA complexes.
UV cross-linking of protein/RNA complexes was performed as described by Chang et al. (1993)Down. 33P-labelled RNA (1x106 c.p.m.) and 2–3 µg protein were incubated for 20 min at 30 °C in binding buffer (5 mM HEPES, pH 7·9, 15 mM KCl, 2 mM MgCl2, 1·75 mM ATP, 6 mM DTT, 0·05 mM PMSF, 0·05 mM EDTA, 5 % glycerol) in 60 µl total volume. To prevent interaction of non-specific RNA binding factors with HAV RNA, tRNA (2–20 µg from E. coli or yeast as indicated; Roche) was included as non-specific competitor in the binding reactions. In competition binding experiments, the protein was pre-incubated with the competitor for 10 min at 30 °C before the 33P-labelled RNA probe was added. Subsequently, samples were placed on ice and irradiated for 60 min at 254 nm with a UV light source (Stratalinker 1800). After digestion with 20 µg RNase A (Sigma) and 20 units RNase T1 (Roche) per sample at 37 °C for 30 min, analysis of the UV cross-linking products was performed by SDS-PAGE. The gel was fixed, dried and exposed to X-ray film at -70 °C.

Immunoblot analysis.
Cellular extract (0·3–3·0 µg S-100 or RSW) or human erythrocyte GAPDH (Sigma) was separated by 12 % SDS-PAGE and electroblotted onto a nitrocellulose membrane (Schleicher and Schuell). After incubation with murine monoclonal antibody (mAb) 40.10.09 (kindly provided by M. Sirover, Philadelphia, USA), which was raised against the uracil DNA glycosylase subunit of GAPDH (Meyer-Siegler et al., 1991Down), and subsequent incubation with alkaline phosphatase-conjugated goat anti-mouse IgG, detection of the immune complexes was performed with an NBT/BCIP colour development system (ProtoBlot; Promega).

Immunoprecipitation.
Immunoprecipitation of UV cross-linked GAPDH was carried out essentially as described by Schultz et al. (1996)Down.

RNA secondary structure predictions.
RNA representing the 3' end of the HAV genome was subjected to computer-assisted modelling using either the MFOLD program (Mathews et al., 1999Down) or the STAR program (kindly performed by C. W. A. Pleij and A. P. Gultyaev, Leiden, The Netherlands), which allowed the prediction of secondary and tertiary RNA structures (Gultyaev et al., 1995Down).

Enzymatic probing of the 3'NTR and direct analysis of specifically fragmented HAV RNA.
Enzymatic mapping of secondary and tertiary interactions in HAV RNA and direct analysis of 5'-end-labelled RNA were essentially carried out as described by Krol & Carbon (1989)Down. For primer extension analysis, 5'-33P-labelled oligonucleotides r7468 (complementary to nt 7468–7487) and r7387 (complementary to nt 7368–7387) were used.

Footprinting of GAPDH.
Binding reactions between 1 µg unlabelled RNA300 or RNA90 (see Fig. 1Down) and 2·5–5·0 µg purified human erythrocyte GAPDH (Sigma) were performed under the same conditions as described above for cellular extracts. At the end of the binding reaction, 0·2–0·7 units RNase V1 or T1 (Pharmacia) were added and incubation was continued at 30 °C for 5 min (RNase V1) or 10 min (RNase T1). The reactions were stopped by the addition of 8 µg yeast tRNA and an equal volume of phenol and incubation for 2 min on a shaker. Nucleic acid from the supernatant was ethanol-precipitated in the presence of 300 mM sodium acetate and the subsequent primer extensions with avian myeloblastosis virus reverse transcriptase and 5'-33P-labelled oligonucleotides were carried out according to Krol & Carbon (1989)Down. The extension products were separated on an 8 M urea/10 % sequencing gel, fixed, dried and exposed to X-ray film.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 1. 3'-Proximal synthetic HAV RNAs and their ability to interact with BSC-1/p38. Linear representation of 3'-proximal positive-sense HAV RNAs that were generated from recombinant pGEM-1 transcription vectors represented by the largest construct pGEM-500. Synthetic RNAs were produced by in vitro transcription with SP6 RNA polymerase to obtain positive-sense RNAs. Nucleotide numbering of the HAV genome is according to Cohen et al. (1987)Down and regions corresponding to the 3Dpol-coding region and the 3'NTR are schematically shown. The p38-binding domains {alpha}, {beta} and {gamma} are represented by stippled boxes. The extent of label transfer to BSC-1/p38 in UV cross-linking experiments is indicated, ranging from very strong (++++) to absent (-).

 

   Results
TOP
ABSTRACT
Introduction
Methods
Results
Discussion
REFERENCES
 
Identification of GAPDH and characterization of complexes with HAV RNA
To investigate the identity of the polypeptide p38 from BSC-1 cells that binds to the HAV 3'NTR, various experiments were performed. Human GAPDH (huGAPDH), anti-GAPDH mAb 40.10.09 and cytoplasmic S-100 extract from BSC-1 cells were used in immunoprecipitation and Western blotting/immunodetection analyses. First, positive-sense 33P-labelled RNA300 (Fig. 1Up) was synthesized and subjected to UV cross-linking/label transfer with cytoplasmic (S-100) extract from uninfected BSC-1 cells or huGAPDH under standard conditions. After treatment with RNase A/T1, labelled proteins were directly analysed by SDS-PAGE (Fig. 2DownA, lanes 1 and 4) or were first subjected to immunoprecipitation (Fig. 2ADown, lanes 2 and 5). Immunoprecipitation with mAb 40.10.09 resulted in the isolation of a single antigen with an apparent molecular mass of approximately 38 kDa when either purified huGAPDH or BSC-1 cytoplasmic lysate were subjected to the analysis. The antigenic relatedness of these proteins was further substantiated by their reactivity in Western blot analysis as denatured proteins (Fig. 2BDown). The antigenic similarity of the two proteins extended to a second, independent mAb 374, which had been raised against rabbit muscle GAPDH (data not shown).



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of BSC-1/p38 and huGAPDH. (A) HuGAPDH (huGAPDH) or BSC-1 cytoplasmic S-100 extract were UV cross-linked to 33P-labelled HAV RNA300 by a standard procedure (lanes 1 and 4). After UV cross-linking and RNase digestion, labelled proteins were tested for their ability to be immunoprecipitated by primary anti-huGAPDH mAb 40.10.09 and secondary rabbit anti-mouse IgG (lanes 2 and 5), or by rabbit anti-mouse IgG alone (lanes 3 and 6). (B) Immunoblot of purified huGAPDH or BSC-1/S-100 cytoplasmic cellular extract with anti-huGAPDH mAb 40.10.09 and alkaline phosphatase-conjugated secondary goat anti-mouse IgG. (C) Proteins in the cytoplasmic S-100 extract from BSC-1 cells were UV cross-linked to 33P-labelled HAV RNA300 under standard conditions (lane 1). Immunoprecipitation of specific antigens with primary mAb 40.10.09 and secondary rabbit anti-mouse IgG was carried out (lane 2). In order to compete with BSC-1 antigens in immune complex formation, increasing amounts (0·15–15·0 µg) of huGAPDH were added to the reactions prior to addition of antibodies (lanes 3–6). (D) Standard UV cross-linking reactions of RNA300 with the S-100 extract of BSC-1 cells (lanes 1–3) or with huGAPDH (lanes 4–6). To inhibit complex formation, increasing amounts of NAD+ were added to the binding reaction (lanes 2, 3, 5 and 6). Note the absence of tRNA and ATP in the binding buffer in this particular experiment. Proteins were separated by 12 % SDS-PAGE. Molecular mass markers are indicated.

 
Immune complex formation between p38 and mAb 40.10.09 was highly specific because it could be effectively inhibited in a concentration-dependent manner by the addition of exogenous huGAPDH as competitor (Fig. 2CUp). In addition, NAD+ and ATP were tested for their ability to inhibit the RNA-binding activity of both proteins, as has been described previously for huGAPDH (Singh & Green, 1993Down; Nagy & Rigby, 1995Down). The results showed that NAD+ (Fig. 2DUp) or ATP (data not shown) specifically reduced protein/RNA300 complex formation for both proteins.

In summary, the observed close antigenic and biochemical relatedness of p38 from BSC-1 cells and huGAPDH strongly suggested that the former represents GAPDH of the simian cell line. The simian p38 was therefore referred to as sGAPDH.

Identification of RNA domains interacting with sGAPDH
To characterize in detail the RNA regions responsible for the formation of cytoplasmic sGAPDH and HAV RNA, a number of synthetic RNAs were subjected to a standard binding assay (Fig. 1Up). The observed sGAPDH/RNA association was specific for HAV RNA because residual vector-specific RNA sequences (i.e. MCS of pGEM-1) showed no interaction with sGAPDH (Fig. 3DownA, lane 6). Also tRNA or control RNA of the HAV 2C3A coding region (nt 4938–5213), unrelated to the 3'NTR, showed negligible capacity to form complexes with sGAPDH in binding or competition experiments (data not shown). Five different synthetic RNAs representing 3'-coterminal fragments of RNA500 (i.e. RNA400, RNA300, RNA200 and RNA90) were individually used as substrates in the binding assay (Fig. 3ADown). The substrate RNA90 represented only the 3'NTR, whereas the other RNAs contained additional sequences from the upstream 3Dpol-coding region. Furthermore, additional variant HAV RNA molecules were synthesized with truncations of 90 and 230 nucleotides from the 3' end (designated RNA400{Delta}90, RNA300{Delta}90, RNA200{Delta}90, and RNA400{Delta}230 and RNA300{Delta}230, respectively) and used in the binding assay (Fig. 3BDown). The results from these experiments indicated the existence of three non-overlapping sGAPDH-binding domains, {alpha}, {beta} and {gamma}, within the 3'-terminal 400 nucleotides of the HAV genome (Fig. 1Up). The precise limits of each domain were not determined, but the range of sequences was clearly located at positions between nt 7104–7196 ({alpha} domain), nt 7270–7305 ({beta} domain) and nt 7410–7499 ({gamma} domain). While the {gamma} domain lay within the 3'NTR, the {alpha} and {beta} domains were part of the coding region (3Dpol).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. UV cross-linking of BSC-1/p38 with different 3'-proximal HAV RNA probes. (A) The 33P-labelled 3'-coterminal HAV RNA500, RNA400, RNA300, RNA200 and RNA90 were subjected to UV cross-linking with cytoplasmic (S-100) extract from BSC-1 cells and analysed by 10 % SDS-PAGE. Control RNA MCS represented the MCS of the transcription vector pGEM-1. (B) 33P-labelled HAV RNA400, RNA300 and RNA200 were deleted at their 3' end by 90 or 230 nucleotides (designated {Delta}90 or {Delta}230) and subjected to a standard UV cross-linking reaction and electrophoretic analysis as above.

 
Role of the poly(A) tail in sGAPDH/RNA complex formation
To investigate whether the poly(A) tail of HAV RNA plays a role in the interaction with sGAPDH, RNA400, RNA300, RNA200 and RNA90 were individually synthesized with or without the poly(A) tail and subjected to a standard binding reaction (Fig. 4Down). The results showed that deletion of the poly(A) tail from RNA300 and RNA200 resulted in a strong decrease in sGAPDH binding. In particular, the relatively weak interaction of sGAPDH with the {gamma} domain in the context of RNA200 in this experiment was completely abolished by poly(A) deletion (Fig. 4Down, lanes 5 and 6). In contrast, removal of the poly(A) tail did not have a significant effect on complexes with RNA400 (Fig. 4Down, lanes 1 and 2) or RNA90 (data not shown). These findings were confirmed by additional binding/competition experiments in which unlabelled synthetic RNA molecules that lacked or included the poly(A) tail were used as competitors of complex formation (data not shown).



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 4. Role of the poly(A) tail in p38/RNA complex formation. 33P-labelled HAV RNA400, RNA300 and RNA200 were synthesized with or without ({Delta}A) the poly(A) tail and subjected to standard UV cross-linking reactions with the S-100 extract from BSC-1 cells. Labelled proteins were analysed by 10 % SDS-PAGE.

 
In summary, the results indicated that the poly(A) tail might promote binding of sGAPDH in some RNA molecules, either by direct interaction with the protein or by influencing the structure of sGAPDH-binding domains. However, poly(A)-dependent interaction depended on the additional presence of unidentified surrounding RNA regions. Therefore, the poly(A) tail appears to be part of the {gamma} domain, but additional unidentified sequences may influence its contribution to the sGAPH-binding capacity and the RNA folding of the {gamma} domain.

RNA structural determinants of GAPDH binding
RNA footprint analyses were performed to investigate the interactions between huGAPDH and the binding domains {beta} and {gamma} of HAV RNA. Briefly, unlabelled RNA300 or RNA90 were subjected to a standard binding reaction in the presence or absence of huGAPDH. After treatment with the single-strand-specific RNase T1 and the double-strand specific nuclease V1, the fragmented RNA was characterized by primer extension analysis using 33P-labelled oligonucleotides (Fig. 5Down).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5. RNA footprint analysis of the interaction of huGAPDH with the HAV 3'NTR and {beta} binding domain. (A) Synthetic HAV RNA90 was subjected to a standard binding reaction in the presence (+) or absence (-) of 5·0 µg huGAPDH. Subsequently, partial cleavage with increasing amounts of RNase V1 (0·2 and 0·5 units, lanes 3–6), RNase T1 (0·25 units, lanes 7 and 8; 0·5 units, lanes 9 and 10; 0·7 units, lanes 11 and 12) or control reaction without RNase (lanes 1 and 2) was performed and corresponding cDNAs were produced by primer extension with 33P-labelled oligonucleotide r7468. (B) RNA300 was used in a standard binding reaction in the presence (+) or absence (-) of 2·5 µg huGAPDH and subsequently subjected to RNase cleavage with RNase V1 (0·25 units, lanes 3 and 4), RNase T1 (0·25 units, lanes 5 and 6) or control reaction without RNase (lanes 1 and 2). Primer extension was performed with 33P-labelled oligonucleotide r7387. Lanes C, U, A and G correspond to the dideoxy sequencing ladder. Nucleotide positions are indicated on the left. Filled arrows or triangles indicate the increase in RNase T1- or RNase V1-susceptible positions in the presence of huGAPDH, whereas open arrows or triangles point to a decrease in the respective RNase sensitivity.

 
Binding of huGAPDH to the {gamma} domain in RNA90 resulted in a decrease in V1 sensitivity at positions G7451, U7452 and U7453, whereas other V1-sensitive nucleotide positions were not affected (Fig. 5AUp, compare lanes 5 and 6). RNase T1 cleavage was detected at positions G7446 and G7447 by addition of huGAPDH (lanes 7–12). Control reactions without RNases (lanes 1 and 2) showed that the presence of the protein caused strong termination of primer extension at positions 7413, 7421, 7425, 7435 and 7455, all of which corresponded to an adenosine ribonucleotide. However, the prominence of these stops was variable between experiments (Fig. 5A, BUp and data not shown) and might be an effect of incomplete removal of huGAPDH from the RNA prior to enzymatic cleavage.

To investigate the binding of huGAPDH to the {beta} domain, the analysis was extended using RNA300 as the target. In the presence of huGAPDH, a significant decrease in V1 sensitivity occurred within the {beta} domain in the otherwise highly sensitive stretches from U7281 to U7287 and from G7293 to U7300, respectively (Fig. 5BUp, lanes 3 and 4). Furthermore, a significant reduction in V1 sensitivity was also observed in adjacent regions for nt 7266–7274, nt 7314–7316 and nt 7318–7321. Moreover, addition of huGAPDH resulted in a singular RNase T1 resistance of the {beta} domain at position G7284, while other RNase T1-sensitive positions remained unprotected by the protein (Fig. 5BUp, lanes 5 and 6).

The major effects of huGAPDH binding on RNase sensitivity were thus observed on nucleotide stretches 7446–7453 and 7281–7300. Therefore, footprint analyses demonstrated that the two regions of interaction between huGAPDH and HAV RNA lie within the sGAPDH {beta} and {gamma} binding domains. The observation that regions outside the {beta} domain were also affected by huGAPDH interaction further indicated that additional sequences are involved in RNA folding of this binding domain.

Secondary structure predictions for the 3'NTR
RNA90 was subjected to computer-assisted modelling with two different algorithms, which revealed two different structures. Calculation with the MFOLD program (Mathews et al., 1999Down) resulted in the most thermodynamically stable structure of two contiguous hairpins with a calculated free energy of -7·6 kcal mol-1 (Fig. 6ADown). By analogy to similar structures formed by the 3'NTRs of enteroviruses (Pilipenko et al., 1992Down), the small 3'-terminal hairpin was designated domain X and the large upstream hairpin was designated hairpin Y. The first four 5'-proximal A residues of the otherwise single-stranded poly(A) tail were involved in part of stem X. Weak interactions, however, between the immediate downstream A residues A7478–A7480 and U7456–U7458 may potentially occur (indicated by dotted lines). Furthermore, complementary sequences, mainly in the loop regions, may allow for tertiary ‘kissing’ interactions between the two basic structural elements, X and Y.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6. Alternative models of higher-order structures for the HAV 3'NTR and summary of physical structure analysis. HAV 3'NTR including a poly(A)26 tail was subjected to computer-aided prediction of secondary structure. (A) The most stable model of secondary structure as predicted by MFOLD. Following the nomenclature of Pilipenko et al. (1992)Down, the 3'-terminal short stem–loop that involved the poly(A) tail in stem formation is designated domain X. The larger upstream stem–loop is designated domain Y. The first stop codon of the HAV open reading frame is highlighted by a shaded box. Putative tertiary ‘kissing’ interactions are indicated by closed lines and additional possible base-pairing interactions of the poly(A) tail are indicated by dotted lines. (B) Folding of the 3'NTR according to the STAR program (Gultyaev et al., 1995Down). The proposed model represents a pseudoknot (PK) structure of the H type. Stem regions are designated S1 and S2, whereas loop regions are designated L1 and L2 according to the nomenclature of Pleij et al. (1985)Down. Nuclease cleavage sites identified by enzymatic probing of the HAV 3'NTR are indicated. Strong cleavages are indicated by filled symbols, whereas moderate nuclease sensitivity is represented by open symbols.

 
Similar computer calculations were performed with the STAR program, which allowed prediction of secondary and tertiary structure (Gultyaev et al., 1995Down). This analysis resulted in the generation of a classical pseudoknot (PK) of the H type with a calculated free energy of -4·5 kcal mol-1 (Fig. 6BUp) (Pleij et al., 1985Down). Stem S1 was very similar to the stem of domain Y but base pairs U7430–A7445 and U7431–G7444 were not included. Loop L1 contained nine residues (7430–7438), seven of which were also present in the loop of domain Y (C7432–A7438). Nucleotide stretches U7439–A7445 and U7465–A7472 formed stem S2 with one unpaired nucleotide U7469 creating a bulge loop. With respect to their immediate contiguity, stems S1 and S2 formed a quasi-continuous helix characteristic of PKs. The poly(A) tail remained completely single-stranded. Analysis with the STAR program predicted an additional structure comprising three contiguous hairpins with a calculated free energy of -9·5 kcal mol-1 (not shown). However, this was not supported by enzymatic analysis of the RNA, as described below.

Enzymatic probing of the 3'NTR
In order to test the proposed model structures, enzymatic secondary structure analysis of RNA90 was carried out using nucleases S1 and V1 and RNase T1.

Only viral RNA upstream of nt 7466 was analysable by the primer extension technique (Fig. 7DownA). The major sensitivities to individual RNases are shown in Fig. 6Up. Nuclease S1 caused strong cleavage in the region of nt 7433–7438, representing the major part of loop L1 in the PK model or half of the loop of domain Y in the stem–loop model. RNase T1-sensitive positions were not found over the entire RNA region examined, indicating that most G residues were located in double-stranded RNA regions or were inaccessible for other reasons. The observed V1 sensitivity of nt 7450–7454 correlated well with the formation of stem S1 that was predicted for both structural models (of domain Y and S1).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 7. Enzymatic probing of HAV 3'NTR. (A) Synthetic RNA90 was treated with increasing amounts of nuclease S1 (0, 50, 250, 500 and 750 units, lanes 1–5), RNase T1 (0, 0·05, 0·1, 0·5 and 0·75 units, lanes 6–10) or RNase V1 (0, 0·005, 0·01, 0·05 and 0·1 units, lanes 11–15) and was subsequently used for cDNA synthesis by primer extension with 33P-labelled oligonucleotide r7468. Products of extension were separated on an 8 M urea/10 % sequencing gel and detected by autoradiography. Lanes C, U, A and G correspond to RNA sequencing reactions. (B) Synthetic RNA90 or RNA90{Delta}A were individually 33P-labelled at their 5' terminus. Gel-purified RNA was subsequently treated with different amounts of nuclease S1 (0, 100 and 500 units, lanes 1–3, 9–11), RNase T1 (0, 0·75 and 1·5 units, lanes 4–6, 12–14) or RNase V1 (0·25 and 1·0 units, lanes 7, 8, 15 and 16). After limited digestion, RNA fragments were separated on an 8 M urea/5 % sequencing gel and detected by autoradiography. Lane G corresponds to a ‘G ladder’ that was obtained after partial RNase T1 digestion of the denatured target RNA. Lane OH represents an RNA ladder resulting from alkaline hydrolysis of the RNA with formamide. Nucleotide numbers are indicated on the left. (C) Linear representation of the pseudoknot structure allowing correlation of predicted structure to the RNase cleavage pattern.

 
In order to analyse the sequence downstream of nt 7466, enzymatic probing and fragment analysis were directly applied to radiolabelled RNA90 and RNA90{Delta}A (Fig. 7BUp). The results for RNA90 demonstrated that the 5' moiety of the poly(A) tail was highly susceptible to nuclease S1 but not to RNase V1 (compare lanes 2 and 3 with 7 and 8), thereby strongly supporting the PK model. The resistance of the complete loop L2 of the PK against nuclease S1 cleavage in all experiments may be indicative of potential interactions between loop L2 and stem S1 that could further stabilize the PK structure. Cleavage with RNase V1 was inefficient in these experiments; however, weak but significant fragmentation at nt 7450–7455 supported the double-stranded structure predicted by both models. With the exception of G7468, which showed weak sensitivity to RNase T1, all other potential cleavage sites were inaccessible to the enzyme. Analysis of RNA90{Delta}A demonstrated that deletion of the poly(A) tail had no overall impact on nuclease sensitivity, thereby further supporting the PK model.

In summary, enzymatic probing of RNA90 supported both proposed model structures. Based on the free energy values for the individual structures, the hairpin structure ({Delta}G=-7·6 kcal mol-1) is more stable than the PK model ({Delta}G=-4·5 kcal mol-1). However, possible interactions between loop L2 and stem S1 may stabilize the PK and lower its free energy by another few kilocalories. In contrast, the pronounced nuclease S1 sensitivity of the poly(A) tail and the lack of any detectable structural changes following its deletion suggest a single-stranded conformation of the poly(A) tail and thereby strongly support the PK structure.

Variable mechanisms of sGAPDH/RNA formation and cell-type specificity
To investigate whether the interaction between GAPDH and HAV RNA was limited to BSC-1 cells, we also used HeLa and FRhK-4 cells in standard binding assays. Previous studies have shown that GAPDH of the ribosomal fractions of BSC-1, FRhK-4 and HeLa cells interacts with the HAV 5'NTR. Therefore, in addition to the S-100 extracts, GAPDH in RSWs was investigated for its capacity to bind to the HAV 3' proximal 300 nucleotides.

The typical complex of cytoplasmic GAPDH and RNA300 was observed in the S-100 fraction of all cell lines investigated (Fig. 8DownA, lanes 1, 3 and 5). In contrast, with RSWs, the complex was either detected in low amounts (BSC-1 cells), or not detected at all (HeLa and FRhK-4 cells) (Fig. 8Down, lanes 2, 4 and 6), whereas three additional factors (p28, p41, p65) represented the major RNA-binding proteins in BSC-1 (p28), HeLa (p41, p65) and FRhK-4 cells (p65). To elucidate whether the absence of the complex was due to GAPDH depletion from the ribosomal fractions or whether it was possibly caused by complete capture of substrate RNA by other highly abundant factors, the amounts of GAPDH present in S-100 extracts and in RSWs were compared by Western blot analysis. As shown in Fig. 8(B)Down, both cellular preparations of all three cell lines contained very similar amounts of GAPDH, indicating that fractionation of cells did not lead to preferential segregation of the protein into S-100 extracts.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 8. Binding characteristics of cytoplasmic and ribosome-associated GAPDH. (A) Protein (2–3 µg) from cytoplasmic (S) or ribosomal salt wash (R) extracts from different simian (BSC-1, lanes 1 and 2; FRhK-4, lanes 5 and 6) or human (HeLa, lanes 3 and 4) cell lines were subjected to standard UV cross-linking reactions with 33P-labelled HAV RNA300. Marker proteins are indicated. (B) Immunoblot analysis of identical relative amounts of cytoplasmic or ribosomal salt wash extracts of BSC-1, HeLa and FRhK-4 cells as used for the UV cross-linking analysis. Antigens were probed with mouse anti-huGAPDH mAb 40.10.09 and with secondary alkaline phosphatase-conjugated goat anti-mouse IgG. RNA binding proteins were analysed by 10 % SDS-PAGE.

 

   Discussion
TOP
ABSTRACT
Introduction
Methods
Results
Discussion
REFERENCES
 
Interactions between cellular proteins and the termini of viral RNAs seem to be important for both translation and RNA replication, e.g. by providing template specificity for the viral RNA polymerase during the transcription and replication of the viral RNA genomes (reviewed in Lai, 1998Down). Previously reported interactions of the 3'NTR of HAV with cellular factors (Nuesch et al., 1993Down; Kusov et al., 1996Down) were the focus of this investigation. We have shown that among various binding factors of human and simian cell lines (HeLa, BSC-1 and FRhK-4), GAPDH was the predominant component interacting with HAV RNA. Binding of this protein to the RNA was specific and correlated to the presence of three distinct nucleic acid domains within the 3'NTR and within the virus protein 3Dpol-coding region. Recently, simian GAPDH from BSC-1 cells has been described to interact specifically with stem–loop IIIa of the HAV 5'NTR and to downregulate translation (Schultz et al., 1996Down; Yi et al., 2000Down). Our results have demonstrated that sGAPDH is also the major cellular factor interacting with the 3'-terminal region of HAV RNA. The identification of the protein was based not only on immunochemical but also functional comparisons with purified huGAPDH, as shown by using NAD+ as a specific competitor for the RNA-binding capacity of GAPDH. In agreement with previous reports, the presence of NAD+ in our binding studies was also inhibitory to the interaction of both sGAPDH and huGAPDH with HAV RNA (Perucho et al., 1980Down; Singh & Green, 1993Down; Nagy & Rigby, 1995Down). Hence, sGAPDH and huGAPDH are, as well as being antigenically related, apparently functionally (and probably structurally) similar with respect to RNA binding. The high degree of similarity was, furthermore, evident in the footprint analyses, which revealed that huGAPDH interacted with the same {beta} and {gamma} domains as sGAPDH. Also, the comparison of available GAPDH amino acid sequence data of human and simian (squirrel monkey) origin revealed that, although of variant sizes, both proteins are 99 % identical by amino acid sequence in the overlap region. In spite of the apparently close relationship, however, in the absence of amino acid sequence data, one may not completely rule out the possibility that the sGAPDH detected in our studies is not simian GAPDH. We believe this is unlikely, and the functional similarities of sGAPDH and huGAPDH observed and the specificity with which huGAPDH interacted with HAV RNA may reflect a functional role of the human enzyme in replication of virus in the natural host.

Interaction of GAPDH has been described to occur with secondary structures such as AU-rich helices of RNA. GAPDH has also been reported to possess helix-destabilizing activity, probably by preferentially binding to single-stranded regions (Karpel & Burchard, 1981Down; Schultz et al., 1996Down). The prominent effect of huGAPDH on the HAV 3'-terminal RNA was promotion of local resistance to RNase V1 and the parallel increase in sensitivity to RNase T1. Hence, complex formation was apparently associated with an increase in single-stranded areas of the RNA and would be in agreement with the nucleic acid helix destabilizing activity of the protein. The similar loss in double-strandedness within domain {beta} would also be due to the activity of the protein and would, in addition, support involvement of the {beta} domain in the formation of RNA of higher-order structure. However, regions surrounding the {beta} binding domain were also affected by huGAPDH interaction, and in a similar way sequences outside the {gamma} binding domain seemed to be important for poly(A) tail-dependent binding of sGAPDH for some RNA species (RNA200 and RNA300). These observations indicate that the RNA structure of the {beta} and {gamma} domains, and thereby the binding of sGAPDH to these domains, could depend on the presence and/or folding of surrounding RNA regions in a given RNA.

Binding of GAPDH to RNA is mediated through discontinuous AUUUA pentamers. Specific binding of GAPDH to AU-rich elements (AREs) in the 3'NTRs and association with polysomes has led to the suggestion that the protein may play a role in both regulation of ARE-dependent turnover and translation of mRNA (Nagy & Rigby, 1995Down). Furthermore, De et al. (1996)Down demonstrated that GAPDH and La protein interact with two cis-acting RNAs of human parainfluenza virus type 3. Both RNAs contain AU-rich sequences and have the potential to form similar stem–loop structures. The 3'NTR of HAV RNA also has a high propensity to form higher-order structures. Computer-aided calculation using two different algorithms gave rise to two structural models: (i) a stem–loop structure of two consecutive hairpins; and (ii) a classical PK structure. Physical analysis by probing with specific RNases demonstrated that the 3'NTR was highly ordered and supported individual structures common to both models. However, the high susceptibility of the poly(A) tail, up to its 5' end, to single-strand-specific nuclease S1 was strong evidence in favour of the PK structure. This structure may suffice to mediate the interaction with sGAPDH. Moreover, the sGAPDH {beta} binding domain has a high potential to participate in the formation of a stem–loop structure. Hence, sGAPDH binding to these structures may be associated with induction of single-stranded regions in RNA. This hypothesis is clearly supported by the change towards increased single-strand-specific RNase sensitivity observed on complex formation.

It has previously been reported that GAPDH is localized in the perinuclear region and in polysomes in addition to its well-documented localization in the cytoplasm (De et al., 1996Down). Our investigations revealed that GAPDH is the major cytoplasmic (S-100) RNA-binding activity of BSC-1, HeLa and FRhK-4 cells, and that its association with ribosomal components (RSW) highly impaired this activity. Whether this is because of a strong interaction with other ribosomal proteins/RNA or, less likely, due to a different isomer being present in the RSW is not known. However, the RSW contained a variety of factors that interacted with the HAV RNA and that were expressed in a cell-type-specific manner.

So far, the mechanisms that regulate translation and replication of picornavirus genomes are not well known. Recently, binding of heterogeneous nuclear ribonucleoprotein A1 to the 3'NTR of mouse hepatitis virus RNA was shown potentially to mediate cross talks between both ends, thereby affecting virus replication (Huang & Lai, 2001Down). It may therefore be possible that binding of ribosome-associated proteins to the 3' terminus of the HAV genome is part of a mechanism regulating translation and/or replication of the genome. The implicit hypothesis of a close regulatory link of translation and RNA replication is supported by computer-assisted structure modelling of complete picornavirus genomes, which place the 3' and 5' ends of the viral RNA into close proximity (Palmenberg & Sgro, 1997Down). Binding of GAPDH to either terminus of the HAV RNA may promote the establishment of their close spatial proximity.

The GAPDH enzyme plays an important role in cellular glycolysis. However, it may also serve a variety of other functions through its RNA binding and structure-modulating activity. Our observations clearly support a functional role of the enzyme in HAV replication. Apparently this role is complex and governed by factors other than the simple binding of sGAPDH to the RNA. In agreement with published data, regulation of the protein/RNA interaction occurred through NAD+ and putative isoforms of GAPDH in the cytoplasmic and ribosomal fraction of the investigated cell lines (Nagy & Rigby, 1995Down). There are several possibilities that allow modulation of its specific interaction with HAV RNA, e.g. local concentrations of NAD+ in different subcellular compartments or the presence of various other cellular proteins may affect complex formation. Thus, subcellular distribution and/or availability of these factors might influence permissivity to and efficiency of growth of HAV by their influence on the interaction of GAPDH with virus RNA.


   ACKNOWLEDGEMENTS
 
We are very much indebted to Cornelis W. A. Pleij and Alexander P. Gultyaev for computer-assisted RNA structure modelling and for helpful discussion. We thank David Sanger for excellent support during preparation of the manuscript. The generous financial support by and the continuing interest of Günter Siegl are highly appreciated.


   REFERENCES
TOP
ABSTRACT
Introduction
Methods
Results
Discussion
REFERENCES
 
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1991). Current Protocols in Molecular Biology. New York: John Wiley & Sons.

Borman, A., Howell, M. T., Patton, J. G. & Jackson, R. J. (1993). The involvement of a spliceosome component in internal initiation of human rhinovirus RNA translation. J Gen Virol 74, 1775–1788.[Abstract/Free Full Text]

Brown, E. A., Day, S. P., Jansen, R. W. & Lemon, S. M. (1991). Genetic variability within the 5' nontranslated region of hepatitis A virus RNA. Implications for secondary structure and function. J Hepatol 13 (Suppl. 4), S138–S143.

Chang, K. H., Brown, E. A. & Lemon, S. M. (1993). Cell type-specific proteins which interact with the 5' nontranslated region of hepatitis A virus RNA. J Virol 67, 6716–6725.[Abstract/Free Full Text]

Cohen, J. I., Ticehurst, J. R., Feinstone, S. M., Rosenblum, B. & Purcell, R. H. (1987). Hepatitis A virus cDNA and its RNA transcripts are infectious in cell culture. J Virol 61, 3035–3039.[Abstract/Free Full Text]

De, B. P., Gupta, S., Zhao, H., Drazba, J. A. & Banerjee, A. K. (1996). Specific interaction in vitro and in vivo of glyceraldehyde-3-phosphate dehydrogenase and LA protein with cis-acting RNAs of human parainfluenza virus type 3. J Biol Chem 271, 24728–24735.[Abstract/Free Full Text]

Gosert, R., Dollenmaier, G. & Weitz, M. (1997). Identification of active-site residues in protease 3C of hepatitis A virus by site-directed mutagenesis. J Virol 71, 3062–3068.[Abstract]

Gultyaev, A. P., van Batenburg, F. H. & Pleij, C. W. (1995). The computer simulation of RNA folding pathways using a genetic algorithm. J Mol Biol 250, 37–51.[CrossRef][Medline]

Hellen, C. U., Witherell, G. W., Schmid, M., Shin, S. H., Pestova, T. V., Gil, A. & Wimmer, E. (1993). A cytoplasmic 57-kDa protein that is required for translation of picornavirus RNA by internal ribosomal entry is identical to the nuclear pyrimidine tract-binding protein. Proc Natl Acad Sci U S A 90, 7642–7646.[Abstract/Free Full Text]

Hollinger, F. B. & Ticehurst, J. R. (1990). Hepatitis A virus. In Virology, 2nd edn, pp. 631–667. Edited by B. N. Fields & D. M. Knipe. New York: Raven Press.

Huang, P. & Lai, M. M. (2001). Heterogeneous nuclear ribonucleoprotein A1 binds to the 3'-untranslated region and mediates potential 5'–3'-end cross talks of mouse hepatitis virus RNA. J Virol 75, 5009–5017.[Abstract/Free Full Text]

Karpel, R. L. & Burchard, A. C. (1981). A basic isozyme of yeast glyceraldehyde-3-phosphate dehydrogenase with nucleic acid helix-destabilizing activity. Biochim Biophys Acta 654, 256–267.[Medline]

Krol, A. & Carbon, P. (1989). A guide for probing native small nuclear RNA and ribonucleoprotein structures. Methods Enzymol 180, 212–227.[Medline]

Kusov, Y., Weitz, M., Dollenmaier, G., Gauss-Mueller, V. & Siegl, G. (1996). RNA–protein interactions at the 3' end of the hepatitis A virus RNA. J Virol 70, 1890–1897.[Abstract]

Lai, M. M. (1998). Cellular factors in the transcription and replication of viral RNA genomes: a parallel to DNA-dependent RNA transcription. Virology 244, 1–12.[CrossRef][Medline]

Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288, 911–940.[CrossRef][Medline]

Melchers, W. J., Hoenderop, J. G., Bruins, S. H., Pleij, C. W., Pilipenko, E. V., Agol, V. I. & Galama, J. M. (1997). Kissing of the two predominant hairpin loops in the coxsackie B virus 3' untranslated region is the essential structural feature of the origin of replication required for negative-strand RNA synthesis. J Virol 71, 686–696.[Abstract]

Melchers, W. J., Bakkers, J. M., Bruins, S. H., Galama, J. M., Agol, V. I. & Pilipenko, E. V. (2000). Cross-talk between orientation-dependent recognition determinants of a complex control RNA element, the enterovirus oriR. RNA 6, 976–987.[Abstract]

Meyer-Siegler, K., Mauro, D. J., Seal, G., Wurzer, J., deRiel, J. K. & Sirover, M. A. (1991). A human nuclear uracil DNA glycosylase is the 37-kDa subunit of glyceraldehyde-3-phosphate dehydrogenase. Proc Natl Acad Sci U S A 88, 8460–8464.[Abstract/Free Full Text]

Mirmomeni, M. H., Hughes, P. J. & Stanway, G. (1997). An RNA tertiary structure in the 3' untranslated region of enteroviruses is necessary for efficient replication. J Virol 71, 2363–2370.[Abstract]

Nagy, E. & Rigby, W. F. (1995). Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD+-binding region (Rossmann fold). J Biol Chem 270, 2755–2763.[Abstract/Free Full Text]

Nuesch, J. P., Weitz, M. & Siegl, G. (1993). Proteins specifically binding to the 3' untranslated region of hepatitis A virus RNA in persistently infected cells. Arch Virol 128, 65–79.[CrossRef][Medline]

Palmenberg, A. C. & Sgro, J.-Y. (1997). Topological organization of picornaviral genomes: statistical prediction of RNA structural signals. Semin Virol 8, 231–241.[CrossRef]

Perucho, M., Salas, J. & Salas, M. L. (1980). Study of the interaction of glyceraldehyde-3-phosphate dehydrogenase with DNA. Biochim Biophys Acta 606, 181–195.[Medline]

Pilipenko, E. V., Maslova, S. V., Sinyakov, A. N. & Agol, V. I. (1992). Towards identification of cis-acting elements involved in the replication of enterovirus and rhinovirus RNAs: a proposal for the existence of tRNA-like terminal structures. Nucleic Acids Res 20, 1739–1745.[Abstract/Free Full Text]

Pilipenko, E. V., Poperechny, K. V., Maslova, S. V., Melchers, W. J., Slot, H. J. & Agol, V. I. (1996). Cis-element, oriR, involved in the initiation of (-)strand poliovirus RNA: a quasi-globular multi-domain RNA structure maintained by tertiary (‘kissing’) interactions. EMBO J 15, 5428–5436.[Medline]

Pleij, C. W., Rietveld, K. & Bosch, L. (1985). A new principle of RNA folding based on pseudoknotting. Nucleic Acids Res 13, 1717–1731.[Abstract/Free Full Text]

Rohll, J. B., Moon, D. H., Evans, D. J. & Almond, J. W. (1995). The 3' untranslated region of picornavirus RNA: features required for efficient genome replication. J Virol 69, 7835–7844.[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schultz, D. E., Hardin, C. C. & Lemon, S. M. (1996). Specific interaction of glyceraldehyde 3-phosphate dehydrogenase with the 5'-nontranslated RNA of hepatitis A virus. J Biol Chem 271, 14134–14142.[Abstract/Free Full Text]

Singh, R. & Green, M. R. (1993). Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase. Science 259, 365–368.[Abstract/Free Full Text]

Todd, S., Towner, J. S., Brown, D. M. & Semler, B. L. (1997). Replication-competent picornaviruses with complete genomic RNA 3' noncoding region deletions. J Virol 71, 8868–8874.[Abstract]

Yi, M., Schultz, D. E. & Lemon, S. M. (2000). Functional significance of the interaction of hepatitis A virus RNA with glyceraldehyde 3-phosphate dehydrogenase (GAPDH): opposing effects of GAPDH and polypyrimidine tract binding protein on internal ribosome entry site function. J Virol 74, 6459–6468.[Abstract/Free Full Text]

Received 8 April 2002; accepted 26 September 2002.


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. Backlund, K. Paukku, L. Daviet, R. A. De Boer, E. Valo, S. Hautaniemi, N. Kalkkinen, A. Ehsan, K. K. Kontula, and J. Y. A. Lehtonen
Posttranscriptional regulation of angiotensin II type 1 receptor expression by glyceraldehyde 3-phosphate dehydrogenase
Nucleic Acids Res., April 1, 2009; 37(7): 2346 - 2358.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Rodriguez-Pascual, M. Redondo-Horcajo, N. Magan-Marchal, D. Lagares, A. Martinez-Ruiz, H. Kleinert, and S. Lamas
Glyceraldehyde-3-Phosphate Dehydrogenase Regulates Endothelin-1 Expression by a Novel, Redox-Sensitive Mechanism Involving mRNA Stability
Mol. Cell. Biol., December 1, 2008; 28(23): 7139 - 7155.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
Y. Zhou, X. Yi, J. B. Stoffer, N. Bonafe, M. Gilmore-Hebert, J. McAlpine, and S. K. Chambers
The Multifunctional Protein Glyceraldehyde-3-Phosphate Dehydrogenase Is Both Regulated and Controls Colony-Stimulating Factor-1 Messenger RNA Stability in Ovarian Cancer
Mol. Cancer Res., August 1, 2008; 6(8): 1375 - 1384.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Serva and P. D. Nagy
Proteomics Analysis of the Tombusvirus Replicase: Hsp70 Molecular Chaperone Is Associated with the Replicase and Enhances Viral RNA Replication
J. Virol., March 1, 2006; 80(5): 2162 - 2169.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Angenstein, A. M. Evans, S.-C. Ling, R. E. Settlage, S. Ficarro, F. A. Carrero-Martinez, J. Shabanowitz, D. F. Hunt, and W. T. Greenough
Proteomic Characterization of Messenger Ribonucleoprotein Complexes Bound to Nontranslated or Translated Poly(A) mRNAs in the Rat Cerebral Cortex
J. Biol. Chem., February 25, 2005; 280(8): 6496 - 6503.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Graff, H. Nguyen, C. Kasorndorkbua, P. G. Halbur, M. St. Claire, R. H. Purcell, and S. U. Emerson
In Vitro and In Vivo Mutational Analysis of the 3'-Terminal Regions of Hepatitis E Virus Genomes and Replicons
J. Virol., January 15, 2005; 79(2): 1017 - 1026.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Samuilova, C. Krogerus, T. Poyry, and T. Hyypia
Specific Interaction between Human Parechovirus Nonstructural 2A Protein and Viral RNA
J. Biol. Chem., September 3, 2004; 279(36): 37822 - 37831.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dollenmaier, G.
Right arrow Articles by Weitz, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dollenmaier, G.
Right arrow Articles by Weitz, M.
Agricola
Right arrow Articles by Dollenmaier, G.
Right arrow Articles by Weitz, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS