|
|
||||||||
Institute of Clinical Microbiology and Immunology, Frohbergstrasse 3, 9001 St Gallen, Switzerland
Correspondence
Günter Dollenmaier
Guenter.Dollenmaier{at}gd-ikmi.sg.ch
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In contrast to the 5'NTRs, comparatively little light has been shed on the putative functions of the picornavirus 3'NTR in virus replication. For entero- and rhinoviruses, the existence of tRNA-like 3'-terminal structures has been proposed (Pilipenko et al., 1992
). Functional analysis of the human rhinovirus 14 (HRV14) 3' stemloop structure in particular has lent support to the importance of higher-order structure for RNA replication (Rohll et al., 1995
). Several investigators have shown evidence for the existence of a putative tertiary kissing interaction within the two terminal stemloop structures of poliovirus (PV) and coxsackievirus (Pilipenko et al., 1996
; Melchers et al., 1997
, 2000
; Mirmomeni et al., 1997
). In stark contrast, Todd et al. (1997)
have recently reported that synthetic PV and HRV RNAs from which the 3'NTRs had been completely removed, although leaving the poly(A) tract intact, were infectious on transfection of tissue culture cells, albeit at a very low efficiency.
Picornavirus 3'NTRs have been demonstrated to interact with virus proteins and with various cellular factors. HAV RNAs comprising all or part of the 3'NTR and/or sequences of the 3D polymerase (3Dpol)-coding region have been previously demonstrated to interact specifically with proteins from HAV-infected and uninfected cells, among which a protein of apparent molecular mass 38 kDa was the most prominent (Nuesch et al., 1993
; Kusov et al., 1996
). Furthermore, computer-aided secondary structure modelling of complete genomes of several picornaviruses, including HAV, has implied that both the 5'- and 3'-terminal regions of individual genomes may, by extensive molecular folding/coiling, be brought into very close spatial proximity to each other (Palmenberg & Sgro, 1997
). Hence, interaction of proteins with one end of a picornavirus genome may direct virus replication and also influence replicative activity by simultaneous or concerted interaction with the other contiguous end of the RNA. Because detailed knowledge of the interaction of identified proteins with defined nucleic acid structures is crucial to a better understanding of the virus/host relationship, we set out to identify individual proteins that interact with the 3'-terminal region of HAV RNA, to characterize these interactions and to determine the RNA elements involved. Our studies were aimed at the previously unidentified 38 kDa factor and other host proteins that we found to bind to the 3'-terminal virus RNA.
In this report we describe the characterization of p38 by immunological and biochemical means and by UV cross-linking binding experiments, which strongly suggest that the protein is identical to the cellular glycolytic enzyme GAPDH of simian cells. We were able to identify three non-overlapping protein-binding domains in the 3'-terminal HAV RNA that mapped to AU-rich double-stranded regions forming parts of RNA higher-order structures.
| Methods |
|---|
|
|
|---|
A, amplification of the HAV region nt 71047473, lacking the poly(A)26 tail, was carried out in a similar way using primer r7473 (5'-GCCGGATCCTCTAGAGCGCT7473ATTTACTGATAAAAGAAATA7454-3') (BamHI, XbaI and HaeII sites are underlined) as reverse primer. The PCR product was cleaved with XhoI and BamHI and ligated into SalI- and BamHI-digested pGEM-1. The construction of plasmids pGEM-300, pGEM-300
A, pGEM-200 and pGEM-200
A was performed as above using direct primers 7196 (5'-GAACTCGAG7196GGTCTTTAATAGCATGGCAG7215-3') and 7305 (5'-TGGCTCGAG7305TTTTGTTCAGTCCTGTTTGG7324-3'), respectively (XhoI site is underlined).
In vitro synthesis of RNA transcripts.
Recombinant pGEM-1 plasmids were linearized with XbaI within the multiple cloning site (MCS) or with BspHI (nt 7410) or NsiI (nt 7270) within the HAV sequence, for generation of positive-sense RNAs. Radioactively labelled RNA probes were generated by run-off transcription with SP6 RNA polymerase (MAXIscript, SP6/T7 In vitro transcription kit; Ambion) and [
-33P]UTP (2000 Ci mmol-1; NEN) according to the manufacturer's protocol. Unlabelled RNAs, which were used for competition experiments, were generated with the MEGAscript (SP6/T7) In vitro transcription kit (Ambion).
For generation of control RNAs, MCS plasmid pGEM-1 was linearized with XbaI and subsequently used for in vitro transcription with SP6 RNA polymerase as described above. Control RNA 2C3A was obtained by restriction of pP3 (Gosert et al., 1997
) with PvuII and subsequent in vitro transcription with T7 RNA polymerase.
Preparation of cellular extracts.
The preparation of cellular extracts was carried out essentially as described by Chang et al. (1993)
. To avoid contamination of the ribosomal salt wash (RSW) with proteins from the cytoplasmic S-100 fraction, the ribosome-containing pellet was carefully washed two to three times with hypotonic lysis buffer prior to the preparation of the RSW fraction. The protein contents of the extracts were determined by the Bradford procedure (Bio-Rad Protein Assay).
UV cross-linking of protein/RNA complexes.
UV cross-linking of protein/RNA complexes was performed as described by Chang et al. (1993)
. 33P-labelled RNA (1x106 c.p.m.) and 23 µg protein were incubated for 20 min at 30 °C in binding buffer (5 mM HEPES, pH 7·9, 15 mM KCl, 2 mM MgCl2, 1·75 mM ATP, 6 mM DTT, 0·05 mM PMSF, 0·05 mM EDTA, 5 % glycerol) in 60 µl total volume. To prevent interaction of non-specific RNA binding factors with HAV RNA, tRNA (220 µg from E. coli or yeast as indicated; Roche) was included as non-specific competitor in the binding reactions. In competition binding experiments, the protein was pre-incubated with the competitor for 10 min at 30 °C before the 33P-labelled RNA probe was added. Subsequently, samples were placed on ice and irradiated for 60 min at 254 nm with a UV light source (Stratalinker 1800). After digestion with 20 µg RNase A (Sigma) and 20 units RNase T1 (Roche) per sample at 37 °C for 30 min, analysis of the UV cross-linking products was performed by SDS-PAGE. The gel was fixed, dried and exposed to X-ray film at -70 °C.
Immunoblot analysis.
Cellular extract (0·33·0 µg S-100 or RSW) or human erythrocyte GAPDH (Sigma) was separated by 12 % SDS-PAGE and electroblotted onto a nitrocellulose membrane (Schleicher and Schuell). After incubation with murine monoclonal antibody (mAb) 40.10.09 (kindly provided by M. Sirover, Philadelphia, USA), which was raised against the uracil DNA glycosylase subunit of GAPDH (Meyer-Siegler et al., 1991
), and subsequent incubation with alkaline phosphatase-conjugated goat anti-mouse IgG, detection of the immune complexes was performed with an NBT/BCIP colour development system (ProtoBlot; Promega).
Immunoprecipitation.
Immunoprecipitation of UV cross-linked GAPDH was carried out essentially as described by Schultz et al. (1996)
.
RNA secondary structure predictions.
RNA representing the 3' end of the HAV genome was subjected to computer-assisted modelling using either the MFOLD program (Mathews et al., 1999
) or the STAR program (kindly performed by C. W. A. Pleij and A. P. Gultyaev, Leiden, The Netherlands), which allowed the prediction of secondary and tertiary RNA structures (Gultyaev et al., 1995
).
Enzymatic probing of the 3'NTR and direct analysis of specifically fragmented HAV RNA.
Enzymatic mapping of secondary and tertiary interactions in HAV RNA and direct analysis of 5'-end-labelled RNA were essentially carried out as described by Krol & Carbon (1989)
. For primer extension analysis, 5'-33P-labelled oligonucleotides r7468 (complementary to nt 74687487) and r7387 (complementary to nt 73687387) were used.
Footprinting of GAPDH.
Binding reactions between 1 µg unlabelled RNA300 or RNA90 (see Fig. 1
) and 2·55·0 µg purified human erythrocyte GAPDH (Sigma) were performed under the same conditions as described above for cellular extracts. At the end of the binding reaction, 0·20·7 units RNase V1 or T1 (Pharmacia) were added and incubation was continued at 30 °C for 5 min (RNase V1) or 10 min (RNase T1). The reactions were stopped by the addition of 8 µg yeast tRNA and an equal volume of phenol and incubation for 2 min on a shaker. Nucleic acid from the supernatant was ethanol-precipitated in the presence of 300 mM sodium acetate and the subsequent primer extensions with avian myeloblastosis virus reverse transcriptase and 5'-33P-labelled oligonucleotides were carried out according to Krol & Carbon (1989)
. The extension products were separated on an 8 M urea/10 % sequencing gel, fixed, dried and exposed to X-ray film.
|
| Results |
|---|
|
|
|---|
|
In summary, the observed close antigenic and biochemical relatedness of p38 from BSC-1 cells and huGAPDH strongly suggested that the former represents GAPDH of the simian cell line. The simian p38 was therefore referred to as sGAPDH.
Identification of RNA domains interacting with sGAPDH
To characterize in detail the RNA regions responsible for the formation of cytoplasmic sGAPDH and HAV RNA, a number of synthetic RNAs were subjected to a standard binding assay (Fig. 1
). The observed sGAPDH/RNA association was specific for HAV RNA because residual vector-specific RNA sequences (i.e. MCS of pGEM-1) showed no interaction with sGAPDH (Fig. 3
A, lane 6). Also tRNA or control RNA of the HAV 2C3A coding region (nt 49385213), unrelated to the 3'NTR, showed negligible capacity to form complexes with sGAPDH in binding or competition experiments (data not shown). Five different synthetic RNAs representing 3'-coterminal fragments of RNA500 (i.e. RNA400, RNA300, RNA200 and RNA90) were individually used as substrates in the binding assay (Fig. 3A
). The substrate RNA90 represented only the 3'NTR, whereas the other RNAs contained additional sequences from the upstream 3Dpol-coding region. Furthermore, additional variant HAV RNA molecules were synthesized with truncations of 90 and 230 nucleotides from the 3' end (designated RNA400
90, RNA300
90, RNA200
90, and RNA400
230 and RNA300
230, respectively) and used in the binding assay (Fig. 3B
). The results from these experiments indicated the existence of three non-overlapping sGAPDH-binding domains,
,
and
, within the 3'-terminal 400 nucleotides of the HAV genome (Fig. 1
). The precise limits of each domain were not determined, but the range of sequences was clearly located at positions between nt 71047196 (
domain), nt 72707305 (
domain) and nt 74107499 (
domain). While the
domain lay within the 3'NTR, the
and
domains were part of the coding region (3Dpol).
|
domain in the context of RNA200 in this experiment was completely abolished by poly(A) deletion (Fig. 4
|
domain, but additional unidentified sequences may influence its contribution to the sGAPH-binding capacity and the RNA folding of the
domain.
RNA structural determinants of GAPDH binding
RNA footprint analyses were performed to investigate the interactions between huGAPDH and the binding domains
and
of HAV RNA. Briefly, unlabelled RNA300 or RNA90 were subjected to a standard binding reaction in the presence or absence of huGAPDH. After treatment with the single-strand-specific RNase T1 and the double-strand specific nuclease V1, the fragmented RNA was characterized by primer extension analysis using 33P-labelled oligonucleotides (Fig. 5
).
|
domain in RNA90 resulted in a decrease in V1 sensitivity at positions G7451, U7452 and U7453, whereas other V1-sensitive nucleotide positions were not affected (Fig. 5A
To investigate the binding of huGAPDH to the
domain, the analysis was extended using RNA300 as the target. In the presence of huGAPDH, a significant decrease in V1 sensitivity occurred within the
domain in the otherwise highly sensitive stretches from U7281 to U7287 and from G7293 to U7300, respectively (Fig. 5B
, lanes 3 and 4). Furthermore, a significant reduction in V1 sensitivity was also observed in adjacent regions for nt 72667274, nt 73147316 and nt 73187321. Moreover, addition of huGAPDH resulted in a singular RNase T1 resistance of the
domain at position G7284, while other RNase T1-sensitive positions remained unprotected by the protein (Fig. 5B
, lanes 5 and 6).
The major effects of huGAPDH binding on RNase sensitivity were thus observed on nucleotide stretches 74467453 and 72817300. Therefore, footprint analyses demonstrated that the two regions of interaction between huGAPDH and HAV RNA lie within the sGAPDH
and
binding domains. The observation that regions outside the
domain were also affected by huGAPDH interaction further indicated that additional sequences are involved in RNA folding of this binding domain.
Secondary structure predictions for the 3'NTR
RNA90 was subjected to computer-assisted modelling with two different algorithms, which revealed two different structures. Calculation with the MFOLD program (Mathews et al., 1999
) resulted in the most thermodynamically stable structure of two contiguous hairpins with a calculated free energy of -7·6 kcal mol-1 (Fig. 6A
). By analogy to similar structures formed by the 3'NTRs of enteroviruses (Pilipenko et al., 1992
), the small 3'-terminal hairpin was designated domain X and the large upstream hairpin was designated hairpin Y. The first four 5'-proximal A residues of the otherwise single-stranded poly(A) tail were involved in part of stem X. Weak interactions, however, between the immediate downstream A residues A7478A7480 and U7456U7458 may potentially occur (indicated by dotted lines). Furthermore, complementary sequences, mainly in the loop regions, may allow for tertiary kissing interactions between the two basic structural elements, X and Y.
|
Enzymatic probing of the 3'NTR
In order to test the proposed model structures, enzymatic secondary structure analysis of RNA90 was carried out using nucleases S1 and V1 and RNase T1.
Only viral RNA upstream of nt 7466 was analysable by the primer extension technique (Fig. 7
A). The major sensitivities to individual RNases are shown in Fig. 6
. Nuclease S1 caused strong cleavage in the region of nt 74337438, representing the major part of loop L1 in the PK model or half of the loop of domain Y in the stemloop model. RNase T1-sensitive positions were not found over the entire RNA region examined, indicating that most G residues were located in double-stranded RNA regions or were inaccessible for other reasons. The observed V1 sensitivity of nt 74507454 correlated well with the formation of stem S1 that was predicted for both structural models (of domain Y and S1).
|
A (Fig. 7B
A demonstrated that deletion of the poly(A) tail had no overall impact on nuclease sensitivity, thereby further supporting the PK model.
In summary, enzymatic probing of RNA90 supported both proposed model structures. Based on the free energy values for the individual structures, the hairpin structure (
G=-7·6 kcal mol-1) is more stable than the PK model (
G=-4·5 kcal mol-1). However, possible interactions between loop L2 and stem S1 may stabilize the PK and lower its free energy by another few kilocalories. In contrast, the pronounced nuclease S1 sensitivity of the poly(A) tail and the lack of any detectable structural changes following its deletion suggest a single-stranded conformation of the poly(A) tail and thereby strongly support the PK structure.
Variable mechanisms of sGAPDH/RNA formation and cell-type specificity
To investigate whether the interaction between GAPDH and HAV RNA was limited to BSC-1 cells, we also used HeLa and FRhK-4 cells in standard binding assays. Previous studies have shown that GAPDH of the ribosomal fractions of BSC-1, FRhK-4 and HeLa cells interacts with the HAV 5'NTR. Therefore, in addition to the S-100 extracts, GAPDH in RSWs was investigated for its capacity to bind to the HAV 3' proximal 300 nucleotides.
The typical complex of cytoplasmic GAPDH and RNA300 was observed in the S-100 fraction of all cell lines investigated (Fig. 8
A, lanes 1, 3 and 5). In contrast, with RSWs, the complex was either detected in low amounts (BSC-1 cells), or not detected at all (HeLa and FRhK-4 cells) (Fig. 8
, lanes 2, 4 and 6), whereas three additional factors (p28, p41, p65) represented the major RNA-binding proteins in BSC-1 (p28), HeLa (p41, p65) and FRhK-4 cells (p65). To elucidate whether the absence of the complex was due to GAPDH depletion from the ribosomal fractions or whether it was possibly caused by complete capture of substrate RNA by other highly abundant factors, the amounts of GAPDH present in S-100 extracts and in RSWs were compared by Western blot analysis. As shown in Fig. 8(B)
, both cellular preparations of all three cell lines contained very similar amounts of GAPDH, indicating that fractionation of cells did not lead to preferential segregation of the protein into S-100 extracts.
|
| Discussion |
|---|
|
|
|---|
and
domains as sGAPDH. Also, the comparison of available GAPDH amino acid sequence data of human and simian (squirrel monkey) origin revealed that, although of variant sizes, both proteins are 99 % identical by amino acid sequence in the overlap region. In spite of the apparently close relationship, however, in the absence of amino acid sequence data, one may not completely rule out the possibility that the sGAPDH detected in our studies is not simian GAPDH. We believe this is unlikely, and the functional similarities of sGAPDH and huGAPDH observed and the specificity with which huGAPDH interacted with HAV RNA may reflect a functional role of the human enzyme in replication of virus in the natural host.
Interaction of GAPDH has been described to occur with secondary structures such as AU-rich helices of RNA. GAPDH has also been reported to possess helix-destabilizing activity, probably by preferentially binding to single-stranded regions (Karpel & Burchard, 1981
; Schultz et al., 1996
). The prominent effect of huGAPDH on the HAV 3'-terminal RNA was promotion of local resistance to RNase V1 and the parallel increase in sensitivity to RNase T1. Hence, complex formation was apparently associated with an increase in single-stranded areas of the RNA and would be in agreement with the nucleic acid helix destabilizing activity of the protein. The similar loss in double-strandedness within domain
would also be due to the activity of the protein and would, in addition, support involvement of the
domain in the formation of RNA of higher-order structure. However, regions surrounding the
binding domain were also affected by huGAPDH interaction, and in a similar way sequences outside the
binding domain seemed to be important for poly(A) tail-dependent binding of sGAPDH for some RNA species (RNA200 and RNA300). These observations indicate that the RNA structure of the
and
domains, and thereby the binding of sGAPDH to these domains, could depend on the presence and/or folding of surrounding RNA regions in a given RNA.
Binding of GAPDH to RNA is mediated through discontinuous AUUUA pentamers. Specific binding of GAPDH to AU-rich elements (AREs) in the 3'NTRs and association with polysomes has led to the suggestion that the protein may play a role in both regulation of ARE-dependent turnover and translation of mRNA (Nagy & Rigby, 1995
). Furthermore, De et al. (1996)
demonstrated that GAPDH and La protein interact with two cis-acting RNAs of human parainfluenza virus type 3. Both RNAs contain AU-rich sequences and have the potential to form similar stemloop structures. The 3'NTR of HAV RNA also has a high propensity to form higher-order structures. Computer-aided calculation using two different algorithms gave rise to two structural models: (i) a stemloop structure of two consecutive hairpins; and (ii) a classical PK structure. Physical analysis by probing with specific RNases demonstrated that the 3'NTR was highly ordered and supported individual structures common to both models. However, the high susceptibility of the poly(A) tail, up to its 5' end, to single-strand-specific nuclease S1 was strong evidence in favour of the PK structure. This structure may suffice to mediate the interaction with sGAPDH. Moreover, the sGAPDH
binding domain has a high potential to participate in the formation of a stemloop structure. Hence, sGAPDH binding to these structures may be associated with induction of single-stranded regions in RNA. This hypothesis is clearly supported by the change towards increased single-strand-specific RNase sensitivity observed on complex formation.
It has previously been reported that GAPDH is localized in the perinuclear region and in polysomes in addition to its well-documented localization in the cytoplasm (De et al., 1996
). Our investigations revealed that GAPDH is the major cytoplasmic (S-100) RNA-binding activity of BSC-1, HeLa and FRhK-4 cells, and that its association with ribosomal components (RSW) highly impaired this activity. Whether this is because of a strong interaction with other ribosomal proteins/RNA or, less likely, due to a different isomer being present in the RSW is not known. However, the RSW contained a variety of factors that interacted with the HAV RNA and that were expressed in a cell-type-specific manner.
So far, the mechanisms that regulate translation and replication of picornavirus genomes are not well known. Recently, binding of heterogeneous nuclear ribonucleoprotein A1 to the 3'NTR of mouse hepatitis virus RNA was shown potentially to mediate cross talks between both ends, thereby affecting virus replication (Huang & Lai, 2001
). It may therefore be possible that binding of ribosome-associated proteins to the 3' terminus of the HAV genome is part of a mechanism regulating translation and/or replication of the genome. The implicit hypothesis of a close regulatory link of translation and RNA replication is supported by computer-assisted structure modelling of complete picornavirus genomes, which place the 3' and 5' ends of the viral RNA into close proximity (Palmenberg & Sgro, 1997
). Binding of GAPDH to either terminus of the HAV RNA may promote the establishment of their close spatial proximity.
The GAPDH enzyme plays an important role in cellular glycolysis. However, it may also serve a variety of other functions through its RNA binding and structure-modulating activity. Our observations clearly support a functional role of the enzyme in HAV replication. Apparently this role is complex and governed by factors other than the simple binding of sGAPDH to the RNA. In agreement with published data, regulation of the protein/RNA interaction occurred through NAD+ and putative isoforms of GAPDH in the cytoplasmic and ribosomal fraction of the investigated cell lines (Nagy & Rigby, 1995
). There are several possibilities that allow modulation of its specific interaction with HAV RNA, e.g. local concentrations of NAD+ in different subcellular compartments or the presence of various other cellular proteins may affect complex formation. Thus, subcellular distribution and/or availability of these factors might influence permissivity to and efficiency of growth of HAV by their influence on the interaction of GAPDH with virus RNA.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Borman, A., Howell, M. T., Patton, J. G. & Jackson, R. J. (1993). The involvement of a spliceosome component in internal initiation of human rhinovirus RNA translation. J Gen Virol 74, 17751788.
Brown, E. A., Day, S. P., Jansen, R. W. & Lemon, S. M. (1991). Genetic variability within the 5' nontranslated region of hepatitis A virus RNA. Implications for secondary structure and function. J Hepatol 13 (Suppl. 4), S138S143.
Chang, K. H., Brown, E. A. & Lemon, S. M. (1993). Cell type-specific proteins which interact with the 5' nontranslated region of hepatitis A virus RNA. J Virol 67, 67166725.
Cohen, J. I., Ticehurst, J. R., Feinstone, S. M., Rosenblum, B. & Purcell, R. H. (1987). Hepatitis A virus cDNA and its RNA transcripts are infectious in cell culture. J Virol 61, 30353039.
De, B. P., Gupta, S., Zhao, H., Drazba, J. A. & Banerjee, A. K. (1996). Specific interaction in vitro and in vivo of glyceraldehyde-3-phosphate dehydrogenase and LA protein with cis-acting RNAs of human parainfluenza virus type 3. J Biol Chem 271, 2472824735.
Gosert, R., Dollenmaier, G. & Weitz, M. (1997). Identification of active-site residues in protease 3C of hepatitis A virus by site-directed mutagenesis. J Virol 71, 30623068.[Abstract]
Gultyaev, A. P., van Batenburg, F. H. & Pleij, C. W. (1995). The computer simulation of RNA folding pathways using a genetic algorithm. J Mol Biol 250, 3751.[CrossRef][Medline]
Hellen, C. U., Witherell, G. W., Schmid, M., Shin, S. H., Pestova, T. V., Gil, A. & Wimmer, E. (1993). A cytoplasmic 57-kDa protein that is required for translation of picornavirus RNA by internal ribosomal entry is identical to the nuclear pyrimidine tract-binding protein. Proc Natl Acad Sci U S A 90, 76427646.
Hollinger, F. B. & Ticehurst, J. R. (1990). Hepatitis A virus. In Virology, 2nd edn, pp. 631667. Edited by B. N. Fields & D. M. Knipe. New York: Raven Press.
Huang, P. & Lai, M. M. (2001). Heterogeneous nuclear ribonucleoprotein A1 binds to the 3'-untranslated region and mediates potential 5'3'-end cross talks of mouse hepatitis virus RNA. J Virol 75, 50095017.
Karpel, R. L. & Burchard, A. C. (1981). A basic isozyme of yeast glyceraldehyde-3-phosphate dehydrogenase with nucleic acid helix-destabilizing activity. Biochim Biophys Acta 654, 256267.[Medline]
Krol, A. & Carbon, P. (1989). A guide for probing native small nuclear RNA and ribonucleoprotein structures. Methods Enzymol 180, 212227.[Medline]
Kusov, Y., Weitz, M., Dollenmaier, G., Gauss-Mueller, V. & Siegl, G. (1996). RNAprotein interactions at the 3' end of the hepatitis A virus RNA. J Virol 70, 18901897.[Abstract]
Lai, M. M. (1998). Cellular factors in the transcription and replication of viral RNA genomes: a parallel to DNA-dependent RNA transcription. Virology 244, 112.[CrossRef][Medline]
Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288, 911940.[CrossRef][Medline]
Melchers, W. J., Hoenderop, J. G., Bruins, S. H., Pleij, C. W., Pilipenko, E. V., Agol, V. I. & Galama, J. M. (1997). Kissing of the two predominant hairpin loops in the coxsackie B virus 3' untranslated region is the essential structural feature of the origin of replication required for negative-strand RNA synthesis. J Virol 71, 686696.[Abstract]
Melchers, W. J., Bakkers, J. M., Bruins, S. H., Galama, J. M., Agol, V. I. & Pilipenko, E. V. (2000). Cross-talk between orientation-dependent recognition determinants of a complex control RNA element, the enterovirus oriR. RNA 6, 976987.[Abstract]
Meyer-Siegler, K., Mauro, D. J., Seal, G., Wurzer, J., deRiel, J. K. & Sirover, M. A. (1991). A human nuclear uracil DNA glycosylase is the 37-kDa subunit of glyceraldehyde-3-phosphate dehydrogenase. Proc Natl Acad Sci U S A 88, 84608464.
Mirmomeni, M. H., Hughes, P. J. & Stanway, G. (1997). An RNA tertiary structure in the 3' untranslated region of enteroviruses is necessary for efficient replication. J Virol 71, 23632370.[Abstract]
Nagy, E. & Rigby, W. F. (1995). Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD+-binding region (Rossmann fold). J Biol Chem 270, 27552763.
Nuesch, J. P., Weitz, M. & Siegl, G. (1993). Proteins specifically binding to the 3' untranslated region of hepatitis A virus RNA in persistently infected cells. Arch Virol 128, 6579.[CrossRef][Medline]
Palmenberg, A. C. & Sgro, J.-Y. (1997). Topological organization of picornaviral genomes: statistical prediction of RNA structural signals. Semin Virol 8, 231241.[CrossRef]
Perucho, M., Salas, J. & Salas, M. L. (1980). Study of the interaction of glyceraldehyde-3-phosphate dehydrogenase with DNA. Biochim Biophys Acta 606, 181195.[Medline]
Pilipenko, E. V., Maslova, S. V., Sinyakov, A. N. & Agol, V. I. (1992). Towards identification of cis-acting elements involved in the replication of enterovirus and rhinovirus RNAs: a proposal for the existence of tRNA-like terminal structures. Nucleic Acids Res 20, 17391745.
Pilipenko, E. V., Poperechny, K. V., Maslova, S. V., Melchers, W. J., Slot, H. J. & Agol, V. I. (1996). Cis-element, oriR, involved in the initiation of (-)strand poliovirus RNA: a quasi-globular multi-domain RNA structure maintained by tertiary (kissing) interactions. EMBO J 15, 54285436.[Medline]
Pleij, C. W., Rietveld, K. & Bosch, L. (1985). A new principle of RNA folding based on pseudoknotting. Nucleic Acids Res 13, 17171731.
Rohll, J. B., Moon, D. H., Evans, D. J. & Almond, J. W. (1995). The 3' untranslated region of picornavirus RNA: features required for efficient genome replication. J Virol 69, 78357844.[Abstract]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schultz, D. E., Hardin, C. C. & Lemon, S. M. (1996). Specific interaction of glyceraldehyde 3-phosphate dehydrogenase with the 5'-nontranslated RNA of hepatitis A virus. J Biol Chem 271, 1413414142.
Singh, R. & Green, M. R. (1993). Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase. Science 259, 365368.
Todd, S., Towner, J. S., Brown, D. M. & Semler, B. L. (1997). Replication-competent picornaviruses with complete genomic RNA 3' noncoding region deletions. J Virol 71, 88688874.[Abstract]
Yi, M., Schultz, D. E. & Lemon, S. M. (2000). Functional significance of the interaction of hepatitis A virus RNA with glyceraldehyde 3-phosphate dehydrogenase (GAPDH): opposing effects of GAPDH and polypyrimidine tract binding protein on internal ribosome entry site function. J Virol 74, 64596468.
Received 8 April 2002;
accepted 26 September 2002.
This article has been cited by other articles:
![]() |
M. Backlund, K. Paukku, L. Daviet, R. A. De Boer, E. Valo, S. Hautaniemi, N. Kalkkinen, A. Ehsan, K. K. Kontula, and J. Y. A. Lehtonen Posttranscriptional regulation of angiotensin II type 1 receptor expression by glyceraldehyde 3-phosphate dehydrogenase Nucleic Acids Res., April 1, 2009; 37(7): 2346 - 2358. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rodriguez-Pascual, M. Redondo-Horcajo, N. Magan-Marchal, D. Lagares, A. Martinez-Ruiz, H. Kleinert, and S. Lamas Glyceraldehyde-3-Phosphate Dehydrogenase Regulates Endothelin-1 Expression by a Novel, Redox-Sensitive Mechanism Involving mRNA Stability Mol. Cell. Biol., December 1, 2008; 28(23): 7139 - 7155. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhou, X. Yi, J. B. Stoffer, N. Bonafe, M. Gilmore-Hebert, J. McAlpine, and S. K. Chambers The Multifunctional Protein Glyceraldehyde-3-Phosphate Dehydrogenase Is Both Regulated and Controls Colony-Stimulating Factor-1 Messenger RNA Stability in Ovarian Cancer Mol. Cancer Res., August 1, 2008; 6(8): 1375 - 1384. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Serva and P. D. Nagy Proteomics Analysis of the Tombusvirus Replicase: Hsp70 Molecular Chaperone Is Associated with the Replicase and Enhances Viral RNA Replication J. Virol., March 1, 2006; 80(5): 2162 - 2169. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Angenstein, A. M. Evans, S.-C. Ling, R. E. Settlage, S. Ficarro, F. A. Carrero-Martinez, J. Shabanowitz, D. F. Hunt, and W. T. Greenough Proteomic Characterization of Messenger Ribonucleoprotein Complexes Bound to Nontranslated or Translated Poly(A) mRNAs in the Rat Cerebral Cortex J. Biol. Chem., February 25, 2005; 280(8): 6496 - 6503. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Graff, H. Nguyen, C. Kasorndorkbua, P. G. Halbur, M. St. Claire, R. H. Purcell, and S. U. Emerson In Vitro and In Vivo Mutational Analysis of the 3'-Terminal Regions of Hepatitis E Virus Genomes and Replicons J. Virol., January 15, 2005; 79(2): 1017 - 1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Samuilova, C. Krogerus, T. Poyry, and T. Hyypia Specific Interaction between Human Parechovirus Nonstructural 2A Protein and Viral RNA J. Biol. Chem., September 3, 2004; 279(36): 37822 - 37831. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |