|
|
||||||||
1 Department of Genetics, Faculty of Biological and Agricultural Sciences, University of Pretoria, Hillcrest, Pretoria 0002, South Africa
2 Onderstepoort Veterinary Institute, Private Bag X5, Onderstepoort 0110, South Africa
3 Equine Research Centre, Faculty of Veterinary Science, University of Pretoria, Private Bag X4, Onderstepoort 0110, South Africa
Correspondence
Henk Huismans
hhuisman{at}postino.up.ac.za
| ABSTRACT |
|---|
|
|
|---|
GenBank accession numbers of the sequences reported in this paper are AF512905AF512924, AY115864AY115878 and AY120938.
| INTRODUCTION |
|---|
|
|
|---|
Several orbivirus serogroups occur in South Africa. This includes the prototype, BTV, as well as other serogroups, such as African horse sickness virus (AHSV), equine encephalosis virus (EEV) and Palyam virus (PALV) (Coetzer & Erasmus, 1994
; Whistler et al., 1989
). The dispersion of the serogroups is closely linked to the distribution of the associated arthropod vectors. Orbivirus vectors include species of biting midges of the genus Culicoides and in the case of PALV, Culicine mosquitoes (Calisher & Mertens, 1998
). The NS3 protein mediates the release of virus particles from infected cells (Hyatt et al., 1993
). The protein may also be involved in virus virulence (O'Hara et al., 1998
) and can significantly influence vector competence (Riegler et al., 2000
). It may therefore play an important role in transmission of the virus in the vector and its subsequent dissemination. This impacts directly on the epidemiology of the specific orbivirus disease. The role of NS3/NS3A in the dissemination of the virus in the field is under investigation. Variation levels for bluetongue virus (BTV) NS3 are in the order of 9 %, which is approximately 28 % less than that for AHSV NS3 (van Niekerk et al., 2001
). The reason for this difference is unclear. Inter-serotype NS3 variation levels for other orbiviruses is unknown.
BTV has 24 serotypes and is enzootic in temporal and tropical regions of the world (Calisher & Mertens, 1998
). Serotypes 117, 19, 20, 22 and 24 occur in Africa. The phylogeny of the NS3 gene sequences of BTV strains, including serotypes 2, 10, 11, 13 and 17 from the United States and serotypes 14, 12, 15 and 16 from China, have grouped BTV strains into three monophyletic clusters, with a possible segregation based on geographical location (Bonneau et al., 1999
). These clusters are independent of BTV serotype, year of isolation and host species of isolation (Pierce et al., 1998
).
The EEV serogroup is known to be prevalent in South Africa, Kenya and Botswana (Barnard, 1997
) and seven serotypes can be distinguished (Howell et al., 2002
). Seroprevalence of antibodies against EEV was found to be uniformly high in horses and donkeys throughout South Africa (Paweska et al., 1999
), with EEV appearing to be more prevalent than AHSV in South Africa (Venter et al., 1999b
). The full-length S10 sequence of a single EEV serotype (EEV-1) has been determined recently (A. C. Potgieter, unpublished data).
NS3 gene sequences of only two South African BTV strains (serotypes 2 and 10) have been reported and none have been published for EEV NS3. It was of interest to investigate the level of intra-serogroup NS3 gene and protein sequence variation of South African BTV and EEV isolates and to compare this variation to that found in parallel studies with other orbiviruses. The NS3 gene sequences of 15 EEV isolates, 18 South African and 3 Indian BTV isolates were determined by direct RT-PCR sequencing and the sequence data analysed, compared and used for further phylogenetic studies. Several historical isolates dating to the early 1900s were included in the investigation, which enabled a comparison of NS3 gene sequence variation over a period of ca. 100 years in South Africa. EEV NS3 variation was found to be higher than that of BTV but significantly less than that for the cognate gene and protein of AHSV. Phylogenetic analysis of EEV NS3 indicated the presence of two distinct clusters that correlate with the distribution of two different species of the Culicoides vector.
| METHODS |
|---|
|
|
|---|
|
DNA sequencing and analysis.
S10 PCR amplicons were purified using a commercial purification kit (Roche) and sequenced, according to the manufacturer's recommendations, using the ABI 377 automated sequencer (Perkin Elmer). In addition to the above-mentioned primers, additional internal primers, BTVR2 (5'-245gcgtacgatgcgaatgcagc265-3'), EEVNS3INTF (5'-402cgacsttyttgatggcyatgatgc425-3') and EEVNS3INTR (5'-200cktttatcacaytcrtcygc219-3'), were used in S10 sequencing reactions to obtain the full-length BTV and EEV NS3 gene sequences. The letters s, y, k and r indicate a base wobble of c/g, c/t, g/t and a/g, respectively. The cycle sequencing annealing temperature was lowered to 50 °C for sequencing reactions with the EEV internal S10 primers.
The NS3 gene and translated amino acid sequences were aligned using CLUSTAL X, version 1.81 (Thompson et al., 1997
), and aligned sequences were used to generate a table of pairwise distances (PAUP, version 4.0b8) to evaluate genetic distances. Pairwise distances between the aligned S10 sequences were calculated using the uncorrected p parameter settings of PAUP and the mean distance setting was used to calculate the distances between the aligned amino acid sequences. Accession numbers for related orbivirus NS3 sequences retrieved from GenBank are listed in Table 1
. The phylogeny of BTV and EEV NS3 genes was investigated with phylogenetic trees constructed using neighbour-joining and maximum-parsimony methods (PAUP, version 4.0b8). The HKY85 distance setting was used to construct the neighbour-joining trees. Bootstrap analysis was done (1000 replicates) and confidence scores are shown on the branches of the trees (PAUP, version 4.0b8).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
BTV and EEV NS3 sequence alignments are shown in Figs 1
and 2
, respectively. The NS3 gene of the BTV strains that were sequenced all encoded a protein of 229 aa, while the EEV NS3 protein was found to be 11 aa longer (240 residues). Orbivirus NS3 proteins have five highly conserved domains. These regions include a second in-phase AUG start codon, a proline-rich domain, a stretch of approximately 50 aa between the proline-rich domain and first hydrophobic domain, which has a high level of sequence conservation, and two hydrophobic regions. A comparison of these domains in AHSV, BTV and EEV is summarized in Table 2
. The conserved NS3 domains in BTV and EEV contain a putative myristylation motif (Figs 1 and 2![]()
) followed by a highly positively charged region, as described for AHSV NS3 and other orbivirus NS3 proteins (van Niekerk et al., 2001
). Only one of the cysteine residues in NS3 of BTV, located at position 137, was highly conserved. The glycosylation motif at position 150153 was conserved among all the isolates and this site has been shown to be glycosylated for BTV NS3 (Bansal et al., 1998
). Other highly conserved regions for EEV NS3 include a glycosylation motif at position 5557 and four cysteine residues located at positions 65, 149, 161 and 184, respectively. The most variable region within NS3 of BTV and EEV was located between the two hydrophobic domains.
|
|
|
|
The NS3 gene and protein sequences of EEV were analysed in a similar manner to determine the percentage variation within and across the EEV serotypes and to compare these levels of variation to those observed for other orbivirus NS3 genes and proteins (Fig. 4
). The NS3 gene and protein of EEV is less conserved than the cognate gene and protein of BTV. These levels are, however, substantially lower than the variation of 46 % for the NS3 gene and 37 % for the NS3 protein of AHSV (van Niekerk et al., 2001
). The highest level of EEV NS3 gene sequence variation (25·2 %) was between isolates from diverse geographical locations (S5REF and S1REF; S5REF and S1FLD1). Intra-serotype levels of gene variation were very low, irrespective of the geographical distance between the strains and ranged between 0 and 1·7 %. The EEV NS3 proteins differed by a maximum of 16·7 % and this was, once again, between geographically distinct isolates (S1FLD1 and S5REF as well as S7REF). The highest level of intra-serotype variation for NS3 proteins (2·1 %) was found between EEV-1 samples that all originated from the Western Cape but had a difference in isolation dates of 23 years. The NS3 proteins of the EEV-1 field isolates were particularly conserved in this investigation and all originated from the same geographical location. When EEV NS3 was compared to the NS3 proteins of other orbiviruses, it was found to differ from the AHSV NS3 proteins by 76·979·1 %, from BTV NS3 by 77·879·2 %, from PALV NS3 by 77·479·4 % and from epizootic haemorrhagic disease virus (EHDV) NS3 by 76·778·5 %.
|
Inferred BTV and EEV NS3 gene phylogeny
The 21 BTV NS3 genes in this study were aligned with the cognate genes of other BTV isolates, AHSV and EHDV, and used to infer phylogenetic trees. Neighbour-joining and maximum-parsimony methods generated identical branching patterns, of which the neighbour-joining tree is shown (Fig. 5
). Bootstrap analysis generally indicated branch confidence levels of more than 70 % for the trees.
|
Cluster I included seven South African virus isolates of serotypes 1, 2, 8 and 11 and serotypes 11 and 17 from the United States (Pierce et al., 1998
). The United States BTV isolates, BTV 11US (1962) and BTV 17VUS, grouped as a distinct subcluster that was not directly related to any of the South African BTV isolates. There was no evidence of branch segregation between the older and recent BTV strains that could indicate variation occurring over the time period in this study. Neither was any segregation based on geographical location of the isolates observed. The serotype 11 vaccine and reference strains isolated in 1944 in the Western Cape were the closest relatives to the recent field isolates some distance away. The two field isolates, S2F (Free State) and S11F (Gauteng), both isolated in 1999, NS3 genes were most closely related, despite the fact that they originated from different geographical areas and possibly different outbreaks. The highest amount of variation in NS3 genes for the South African isolates in this group was 8·3 %, while the variation between the South African and United states isolates reached a maximum of 9·4 % (S1REF and BTV 11US). The serotype 8 and serotype 11 vaccine strains were likely to have been derived from the corresponding reference strains as the NS3 genes of these isolates were closely related. The serotype 1 reference strain was, however, not closely related to the corresponding vaccine strain (cluster II).
Cluster II contained most of the South African BTV isolates, including serotypes 14, 8 and 18. Two United States strains, BTV 13US (1989) and BTV 17FUS (1981), grouped into a separate branch in this cluster but branched among the South African BTV isolates. In the study undertaken by Pierce et al. (1998)
, these two isolates were distantly related members of the same cluster. The highest level of NS3 gene variation (9·2 %) in this cluster was between South African isolates (S1VAC and S4VAC), unlike that observed in cluster I where the highest variation was between United States and South African isolates (Fig. 3
). It was again evident in this cluster that the geographical locality of the isolates did not influence tree branching and thus was not as a result of NS3 gene variation. The BTV-3 and BTV-4 field isolates grouped together in a subcluster, while the BTV-8 field isolate formed the single taxa of another branch, despite the same geographical location of these isolates. Similar to that observed in cluster I, the serotype 3 and 4 vaccine strains were probably derived from the corresponding reference strains. The S1VAC, S2REF and S18REF strains appeared to be independent lineages in this cluster with no close relatives.
The only cluster in this analysis that did not contain United States or African isolates was the Asian or Eastern cluster, cluster III. This cluster consisted of BTV isolates from India isolated in 1999 (S1F1, S1F2 and S18F) and China, namely, BTV 12C (1996), BTV 15C (1996) and BTV 16C (1998) (Bonneau et al., 1999
). An Australian BTV isolate also grouped in this cluster (data not shown). The BTV-1 field isolates were closely related to a Chinese isolate, again implying that the geographical origin of the isolates has little or no influence on the variation found in the NS3 genes. The Indian isolate, S18F, and the other Chinese strains were more distantly related and formed individual branches in this cluster. From the phylogenetic analysis, it is evident that segment shifting of S10 is likely to occur. This also occurs in the case of AHSV and has been found in other studies of BTV S10 epidemiology (Pierce et al., 1998
; Bonneau et al., 1999
).
Determination of the NS3 gene sequences of several EEV strains enabled us to investigate the genetic relationship between the EEV serotypes and serogroups to those of other orbivirus serogroups. The phylogeny of EEV inferred using either NS3 gene or protein sequence data grouped the EEV strains into identical groups, as did the use of either the neighbour-joining or maximum-parsimony tree construction methods. The phylogenetic tree inferred using the NS3 gene sequence data, however, enhanced the resolution of the virus clusters due to the greater level of sequence variation and therefore best illustrated the phylogeny of these viruses (Fig. 6
).
|
Cluster A grouped serotypes 1, 2, 4 and 7. The NS3 genes of serotype 1 field isolates from the outbreak in Western Cape (1999) encoded identical proteins, except that of the S1FLD1 strain, which differed by a single amino acid at position 11; this indicates a high level of NS3 conservation in the Stellenbosch outbreak. There was no apparent subclustering based on geographical locality of the isolates in this group. The closest relative to the serotype 1 field isolates, on the level of NS3 gene sequence, was the EEV-7 reference strain isolated on the distant eastern coast of South Africa (KwaZulu-Natal) in 2000. The most divergent member in this cluster was S4REF, which also had the most northerly location of the viruses in this cluster.
Cluster B included serotypes 3, 5 and 6, which clustered independently of isolation date. The serotype 3 reference and field strains were closely related, despite a 30 year time difference in isolation dates. Serotype 6 field isolates were related most closely to the serotype 6 reference strain that was isolated 9 years prior to that of the field strains. No subclustering could be attributed to different geographical locations of the EEV isolates within the central northern region, as the serotype 6 field isolates were isolated some distance from each other (Gauteng and Limpopo provinces), but were close relatives of a branch in this cluster. There is no evidence of restricted NS3 gene-flow within each of these virus clusters, as virus isolates made from distant geographical locations within these two regions can harbour closely related S10 dsRNA segments (Fig. 6
).
The occurrence of the EEV NS3 gene clusters may be related to the distribution of the Culicoides vectors, which differs with climatic changes. The prevalence of EEV was further noted to have increased over the 12 year period from 1983 to 1995 (Lord et al., 2002
). To date, two species in the Culicoides imicola species complex, C. imicola (senso stricto) and C. bolitinos are known to transmit EEV (Venter et al., 1998
, 1999a
). There is a high degree of polymorphism in the C. imicola species complex (Sebastiani et al., 2001
). C. imicola (senso stricto) is the most abundant and widespread of the species in the complex, while C. bolitinos is the second most abundant species. Unlike C. imicola (senso stricto), C. bolitinos is largely independent of environmental changes in rainfall and temperature and is subsequently common in areas where C. imicola (senso stricto) is scarce (Sebastiani et al., 2001
). The high degree of genetic diversity within these Culicoides species may effect efficacy of virus release from the midges. Certain NS3 genotypes of EEV may be better adapted to release virus from certain species in the C. imicola species complex. The two EEV NS3 types that differ by up to 16·7 % in amino acid sequence identity occur in two regions of South Africa and this broadly corresponds to the occurrence of the two different Culicoides species (Sebastiani et al., 2001
). C. imicola predominates in the northern regions of the country, where EEV NS3 gene cluster B occurs, while C. bolitinos was locally more abundant in the southern districts where EEV NS3 gene cluster A occurs. The genetic variability and distribution of C. imicola (senso stricto) in the Southern regions of the country is likely to differ from season to season depending on the pattern of rainfall. This may influence the dominance of certain EEV strains in specific outbreaks as well as their distribution in South Africa. If this assumption is correct, it would imply that EEV strains that harbour the cluster A NS3 type are likely to occur in the southern regions of South Africa, while the strains that harbour the cluster B NS3 type will have a more northerly distribution. The overlap region may sustain either of the Culicoides subspecies, therefore allowing for the occurrence of EEV isolates with either NS3 type in this region. There appears to be evidence that the BTV clusters that circulate in the United States and China are related to distinct vector species and that these BTV strains have co-evolved with their respective insect vector species in the regions (Bonneau et al., 1999
). The absence of any type of pattern of geographical distribution similar to that found with EEV could reflect on the ability of South African BTV strains to be transmitted by any population of C. imicola (senso stricto) or C. bolitinos.
| REFERENCES |
|---|
|
|
|---|
Barnard, B. J. (1997). Antibodies against some viruses of domestic animals in southern African wild animals. Onderstepoort J Vet Res 64, 95110.[Medline]
Bonneau, K. R., Zhang, N., Zhu, J., Zhang, F., Li, Z., Zhang, K., Xiao, L., Xiang, W. & MacLachlan, N. J. (1999). Sequence comparison of the L2 and S10 genes of bluetongue viruses from the United States and the People's Republic of China. Virus Res 61, 153160.[CrossRef][Medline]
Bremer, C. W. (1976). A gel electrophoretic study of the protein and nucleic acid components of African horsesickness virus. Onderstepoort J Vet Res 43, 193199.[Medline]
Calisher, C. H. & Mertens, P. P. C. (1998). Taxonomy of African horsesickness viruses. Arch Virol 14, 311.
Coetzer, J. A. & Erasmus, B. J. (1994). Equine encephalosis. In Infectious Disease of Livestock with Special Reference to Southern Africa, vol. 1, pp. 476479. Edited by J. A Coetzer, C. R. Thomson & R. C. Tustin. Oxford: Oxford University Press.
Dawe, S. & Duncan, R. (2002). The S4 genome segment of baboon reovirus is bicistronic and encodes a novel fusion-associated small transmembrane protein. J Virol 76, 21312140.
Howell, P. G., Groenewald, M., Visage, C. W., Bosman, A.-M., Coetzer, J. A. & Guthrie, A. J. (2002). The classification of seven serotypes of equine encephalosis virus and the prevalence of homologous antibody in horses in South Africa. Onderstepoort J Vet Res 69, 7993.[Medline]
Huismans, H. (1979). Protein synthesis in bluetongue virus-infected cells. Virology 92, 385396.[CrossRef][Medline]
Huismans, H. & Erasmus, B. J. (1981). Identification of serotype-specific and group-specific antigens of bluetongue virus. Onderstepoort J Vet Res 48, 5158.[Medline]
Hyatt, A. D., Zhao, Y. & Roy, P. (1993). Release of bluetongue virus-like particles from insect cells is mediated by BTV nonstructural protein NS3/NS3A. Virology 193, 592603.[CrossRef][Medline]
Jensen, M. J. & Wilson, W. C. (1995). A model for the membrane topology of the NS3 protein as predicted from the segment 10 of epizootic haemorrhagic virus serotype 1. Arch Virol 140, 799805.[CrossRef][Medline]
Jensen, M. J., Cheney, I. W., Thompson, L. H., Mecham, J. O., Wilson, W. C., Yamakawa, M., Roy, P. & Gorman, B. M. (1994). The smallest gene of the orbivirus, epizootic hemorrhagic disease, is expressed in virus-infected cells as two proteins and the expression differs from that of the cognate gene of bluetongue virus. Virus Res 32, 353364.[CrossRef][Medline]
Lord, C. C., Venter, G. J., Mellor, P. S., Paweska, J. T. & Woolhouse, M. E. (2002). Transmission patterns of African horsesickness and equine encephalosis in South African donkeys. Epidemiol Infect 128, 265275.[CrossRef][Medline]
Martin, L.-A., Meyer, A. J., O'Hara, R. S., Fu, H., Mellor, P. S., Knowles, N. J. & Mertens, P. P. C. (1998). Phylogenetic analysis of African horse sickness virus segment 10: sequence variation, virulence characteristics and cell exit. Arch Virol 14, 281293.
Mertens, P. P. C., Brown, F. & Sangar, D. V. (1984). Assignment of the genome segments of bluetongue virus type 1 to the proteins which they encode. Virology 135, 207217.[CrossRef][Medline]
Moss, S. R., Jones, L. D. & Nutall, P. A. (1992). Comparison of the nonstructural protein, NS3, of tick-borne and insect-borne orbiviruses. Virology 187, 841844.[CrossRef][Medline]
O'Hara, R. S., Meyer, A. J., Burroughs, J. N., Pullen, L., Martin, L. A. & Mertens, P. P. (1998). Development of a mouse model system, coding assignments and identification of the genome segments controlling virulence of African horse sickness virus serotypes 3 and 8. Arch Virol 14, 259279.
Paweska, J. T., Gerdes, G. H., Woods, P. S. & Williams, R. (1999). Equine encephalosis in southern Africa: Current situation. In Equine Infectious Diseases, vol. III, pp. 303305. Edited by U. Wernery, J. F. Wade, J. A. Mumford & O.-R. Kaaden. Newmarket: R & W.
Pierce, C. M., Balasuriya, U. B. & MacLachlan, N. J. (1998). Phylogenetic analysis of the S10 gene of field and laboratory strains of bluetongue virus from the United States. Virus Res 55, 1527.[CrossRef][Medline]
Riegler, L., Venter, G. J., O'Hara, R., Mellor, P. S. & Mertens, P. P. (2000). Variation in NS3 of African horsesickness can influence transmission by culicoides vector species. Seventh International Symposium on Double-stranded Viruses (Palm Beach, Aruba, December, 2000).
Roy, P., Mertens, P. P. & Casal, I. (1994). African horse sickness virus structure. Comp Immunol Microbiol Infect Dis 17, 243273.[CrossRef][Medline]
Sailleau, C., Moulay, S. & Zientara, S. (1997). Nucleotide sequence comparison of the segments S10 of the nine African horsesickness virus serotypes. Arch Virol 142, 965978.[CrossRef][Medline]
Sebastiani, F., Meiswinkel, R., Gomulski, L. M., Guglielmino, C. R., Mellor, P. S., Malacrida, A. R. & Gasperi, G. (2001). Molecular differentiation of the Old World Culicoides imicola species complex (Diptera, Ceratopogonidae), inferred using random amplified polymorphic DNA markers. Mol Ecol 10, 17731786.[CrossRef][Medline]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 48764882.
van Niekerk, M., van Staden, V., van Dijk, A. A. & Huismans, H. (2001). Variation of African horsesickness virus nonstructural protein NS3 in southern Africa. J Gen Virol 82, 149158.
van Staden, V. & Huismans, H. (1991). A comparison of the genes which encode non-structural protein NS3 of different orbiviruses. J Gen Virol 72, 10731079.
Venter, G. J., Paweska, J. T., van Dijk, A. A., Mellor, P. S. & Tabachnick, W. J. (1998). Vector competence of Culicoides bolitinos and C. imicola for South African bluetongue virus serotypes 1, 3 and 4. Med Vet Entomol 12, 378385.[CrossRef][Medline]
Venter, G. J., Groenewald, D. M., Paweska, J. T., Venter, E. H. & Howell, P. G. (1999a). Vector competence of selected South African Culicoides species for the Bryanston serotype of equine encephalosis virus. Med Vet Entomol 13, 393400.[CrossRef][Medline]
Venter, G. J., Paweska, J. T., Williams, R. & Nevill, E. M. (1999b). Prevalence of antibodies against African horsesickness and equine encephalosis in donkeys in southern Africa. In Equine Infectious Diseases, vol. III, pp. 299302. Edited by U. Wernery, J. F. Wade, J. A. Mumford & O.-R. Kaaden. Newmarket: R & W.
Wade-Evans, A. M. (1990). Complete sequence of genome segment 10, encoding the NS3 protein, of bluetongue virus, serotype 1 from South Africa. Nucleic Acids Res 18, 4920.
Whistler, T., Swanepoel, R. & Erasmus, B. J. (1989). Characterization of Palyam serogroup orbiviruses isolated in South Africa and serologic evidence for their widespread distribution in the country. Epidemiol Infect 102, 317324.[Medline]
Yamakawa, M., Kubo, M. & Furuuchi, S. (1999). Molecular analysis of the genome of Chuzan virus, a member of the Palyam serogroup viruses, and its phylogenetic relationships to other orbiviruses. J Gen Virol 80, 937941.[Abstract]
Zientara, S., Sailleau, C., Plateau, E., Moulay, S., Mertens, P. P. & Cruciere, C. (1998). Molecular epidemiology of African horse sickness virus based on analyses and comparisons of genome segments 7 and 10. Arch Virol 14, 221234.
Received 5 August 2002;
accepted 28 November 2002.
This article has been cited by other articles:
![]() |
M. Quan, M. van Vuuren, P. G. Howell, D. Groenewald, and A. J. Guthrie Molecular epidemiology of the African horse sickness virus S10 gene J. Gen. Virol., May 1, 2008; 89(5): 1159 - 1168. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |