|
|
||||||||

1 Institute of Virology and Immunology, University of Würzburg, Versbacher Str. 7, 97078 Würzburg, Germany
2 Molecular Virology Laboratory, Department of Medical Microbiology, Leiden University Medical Center, Leiden, The Netherlands
3 Institute for Medical Virology, Johann Wolfgang Goethe University, Frankfurt (Main), Germany
Correspondence
John Ziebuhr
j.ziebuhr{at}mail.uni-wuerzburg.de
| ABSTRACT |
|---|
|
|
|---|
Present address: Research Department, Cantonal Hospital, St Gallen, Switzerland. ![]()
Published ahead of print on 19 June 2003 as DOI 10.1099/vir.0.19424-0.
The nucleotide sequence of SARS-CoV, isolate Frankfurt 1, has been deposited in GenBank, accession no. AY291315.
| INTRODUCTION |
|---|
|
|
|---|
|
| METHODS |
|---|
|
|
|---|
Sequencing of the SARS-CoV (Frankfurt 1) RNA genome.
To determine the SARS-CoV genomic sequence, a set of overlapping RT-PCR products with an average size of 2 kb encompassing the entire genome was generated as described by Thiel et al. (1997)
. To generate RT-PCR products containing the exact 3'-terminal sequence of SARS-CoV genomic RNA, reverse transcription was primed using oligonucleotide OLV1/57 (5'-GCCGGCGCCAGCGAGGAGGCTGGGACCATGCCGGCCTTTTTTTTTTTTTTTTTT-3') and PCR was done using oligonucleotides PCR-L (5'-23GGAAAAGCCAACCAACCTCGATCTC47-3') and OLV1/58 (5'-ACGTTCTAGAGCCCAGCCGGCGCCAGCGAGGAGGCT-3'). To generate RT-PCR products containing the exact 5'-terminal sequence the FirstChoice RLM-RACE Kit (Ambion) was used according to the manufacturer's instructions with the following modifications. A synthetic RNA corresponding to human coronavirus 229E (HCoV-229E) nt 1600 was used as RNA adapter and reverse transcription was primed using oligonucleotide S65 (5'-439CTTTTTCCAGCTCTACTAGACCAC416-3'). Outer PCR was done using oligonucleotides 240up (5'-CCTTACTCGAGGTTCCGTCTCGTG-3') and S132 (5'-341ACGTCTCTAACCTGAAGGACAGGC318-3'); inner PCR was done using oligonucleotides Oli5 (5'-GCGAGGCCGCTAGCAATGG-3') and S133 (5'-235CTAGGTATGCTGATGATCGACTGC212-3'). All RT-PCR products served as template for sequencing analysis using a total number of 149 sequencing primers and the BigDye Terminator v3.1 Cycle Sequencing Kit. Sequencing products were detected using an ABI PRISM 3100 Genetic Analyser (Applied Biosystems) and computer-assisted analysis of sequencing data was facilitated by the Lasergene bio-computing software (DNASTAR).
Analysis of SARS-CoV mRNAs.
Poly(A)-containing RNA from SARS-CoV- and HCoV-infected cells was separated on a 2·2 M formaldehyde/1 % agarose gel, blotted on nylon membrane and hybridized with 32P-multiprime-labelled DNA probes corresponding to the 3'-terminal 794 nt of the SARS-CoV genome and HCoV nt 2629727273, respectively. RNAs were analysed by autoradiography. To determine the leader-to-body fusion sites of SARS-CoV subgenomic mRNAs, reverse transcription of poly(A)-containing RNA from SARS-CoV-infected cells was primed using oligonucleotides RT-S (5'-22247ATAGGCTGCAGCTGACGTGCCCCA22224-3'), RT-3 (5'-25805GTTTTGGTGTTGAAATGCCGTCACC25781-3'), RT-E (5'-26304TTAACACGCGAGTAGACGTAAACCG26280-3'), RT-M (5'-26964ATCAGTGCCTACACGCTGCGACGC26941-3'), RT 6-8 (5'-28043ACACCTAGCTATAAGCGCACCACC28020-3') and RT-N (5'-28798TGTCTAGCAGCAATAGCGCGAGGGC28774-3'). PCR amplification was done using the SARS-CoV leader-specific oligonucleotide PCR-L in combination with body-specific oligonucleotides PCR-S (5'-22108ACTACATCTATAGGTTGATAGCCCT22084-3'), PCR-3 (5'-25734TAGTCATAGTTATGTGTGTGCCAGC25710-3'), PCR-E (5'-26243AGTACGCACACAATCGAAGCGCAG26220-3'), PCR-M (5'-26781CACAATTGTCCCCCGGAGAGGCAC26758-3'), PCR-6-8 (5'-27937CCTAGAGCACAAAGCCAAGCAGTGC27913-3') and PCR-N (5'-28608AGGAAGTTGTAGCACGGTGGCAGC28585-3'). Sequence analysis of PCR products was done using primers SEQ-S (5'-21738AAGGTATGACAGGGTTGCCAAACG21715-3'), SEQ-3 (5'-25515AAATTGCAAATGAACTGGAAGCCC25492-3'), SEQ-E (5'-26243AGTACGCACACAATCGAAGCGCAG26220-3'), SEQ-M (5'-26640AATCGCAATCCCGCCAGTCACCC26618-3'), SEQ-6 (5'-27244AGGTTCTTCATCATCTAACTCCGA27221-3'), SEQ-7 (5'-27439AGTGCAAATTTATTGTCAGCAAGA27416-3'), SEQ-8 (5'-27937CCTAGAGCACAAAGCCAAGCAGTGC27913-3') and SEQ-N (5'-28398TCGGGTAGCTCTTCGGTAGTAGCC28375-3').
In vitro transcription and translation.
In vitro transcription reactions were done using the RiboMAX Large Scale RNA Production SystemT7 (Promega) and m7G(5')ppp(5')G cap structure analogue as described by Thiel et al. (2001)
. In vitro translation reactions were done in rabbit reticulocyte lysate (Promega) using in vitro-transcribed RNA (Ziebuhr & Siddell, 1999
). Alternatively, DNA templates containing a T7 promoter were transcribed and translated using the TNT T7-Coupled Reticulocyte Lysate System (Promega). To analyse the SARS-CoV frameshifting element, a DNA fragment corresponding to SARS-CoV nt 1295513961 was amplified by RT-PCR using oligonucleotides S25 (5'-17511CAATTTCAGCAGGACAACGGCGAC17488-3'; RT reaction), JZ464 (5'-AATAATACGACTCACTATAGGGAACCATGGCTGGAAATGCTACAGAAGTACCTGC-3', PCR sense primer) and JZ465 (5'-AAAGAATTCTTAACGCATAGCATCGCAGAATTGTAC-3'; PCR antisense primer). To generate a DNA fragment with mutated slippery sequence (13392UGUAGCC13398), two PCRs were done using oligonucleotides S59 (5'-12916ATGGTGCTGGGCAGTTTAGCTGCT12939-3'; PCR 1, sense primer), JZ467 (5'-AAAAGGTCTCCGGCTAGAAACGTTGATGCATCCGCAGAC-3'; PCR 1, antisense primer), JZ466 (5'-AAAAGGTCTCTAGCCGGGTTTGCGGTGTAAGTGCAGCCC-3'; PCR 2, sense primer) and S91 (5'-14039TACGAAATCACCGAAATCGTACCA14016-3'; PCR 2, antisense primer). PCR products 1 and 2 were cleaved with BsaI restriction endonuclease and ligated using T4 DNA ligase. The ligation product was used as template to amplify a DNA fragment corresponding to SARS-CoV nt 1295513961 (with mutated slippery sequence) using oligonucleotides JZ464 and JZ465.
For in vitro transcriptiontranslation of the 3CLpro substrate representing nsp7nsp10 of SARS-CoV (Ser-3837Gln-4369), the corresponding coding sequence of SARS-CoV was amplified using primers JZ433 (5'-AATAATACGACTCACTATAGGGCGAACCATGTCTAAAATGTCTGACGTAAAGTGCA-3') and JZ434 (5'-AAAGAATTCTTACTGCATCAAGGGTTCGCGGAGTTG-3'). The upstream primer contained a T7 RNA polymerase promoter. For in vitro transcriptiontranslation of the pp1a/pp1ab sequence Lys-737Ser-1858, containing the PL2pro domain and the presumed nsp2|3 cleavage site, the corresponding coding sequence was amplified by RT-PCR using primers AP91 (5'-TAATACGACTCACTATAGGGACGGGAACACCATGGCAAAAGAAGTAACCTTTCTTGAAGGT-3') and S77 (5'-5839ACGACACAGGCTTGATGGTTGTAG5816-3'). To introduce a PL2pro active-site mutation (Cys-1651 to Ala) in this sequence, two PCRs were done using (1) primers AP91 and AP94 (5'-ATAGCTCTTCATGCATTGTTATCAGCCCATTTAATTGA-3') and (2) AP 95 (5'-ATAGCTCTTCAGCATATTTGTCTAGTGTTTTATTAGCA-3') and S77. Following digestion of the PCR products obtained with SapI and ligation with T4 DNA ligase, the pp1a/pp1ab coding sequence Lys-737Ser-1858 was re-amplified using the ligation product as a template and primers AP91 and S77. The sequences of PCR products used as templates for in vitro transcription were confirmed by nucleotide sequencing.
Protein expression, purification, and activities.
Plasmid construction, expression in Escherichia coli and purification of the maltose-binding protein (MBP) fusion proteins MBPHCoV 3CLpro and MBPTGEV (porcine transmissible gastroenteritis virus) 3CLpro, and the corresponding active-site mutants, MBPHCoV 3CLpro_C3109V and MBPTGEV 3CLpro_C3022A, have been described previously (Ziebuhr et al., 1995
, 1997
; Hegyi et al., 2002
). The same approach was taken to express the SARS-CoV pp1a/pp1ab amino acids 32413545 (i.e. the SARS-CoV 3CLpro domain lacking the two C-terminal residues, Phe-3545 and Gln-3546) and the corresponding active-site Cys-3385-to-Ala mutant. The coronavirus proteinases were released from MBP by factor Xa cleavage and used, according to previously published protocols (Ziebuhr & Siddell, 1999
), in trans-cleavage assays with in vitro-translated substrate or 0·5 mM of synthetic 15-mer peptides whose sequences were derived from the N-terminal TGEV and mouse hepatitis virus (MHV) 3CLpro autoprocessing sites (Seybert et al., 1997
; Hegyi & Ziebuhr, 2002
). The SARS-CoV helicase (SARS-CoV HEL, pp1ab residues Ala-5302Gln-5902) and a control protein, SARS-CoV HEL_KA, in which the conserved Lys of the Walker A box (SARS-CoV pp1ab K5589) was replaced by Ala, were expressed and purified in a similar way. Briefly, the helicase-coding region was amplified by RT-PCR using primers JZ425 (5'-GCTGTAGGTGCTTGTGTATTGTGC-3') and JZ426 (5'-AAAACTGCAGTTATTGTAATGTAGCCACATTGCGACGTGG-3'). The PCR product was digested with PstI and inserted in XmnI- and PstI-digested pMal-c2 DNA (New England Biolabs). The mutation was introduced using a PCR-in vivo recombination method (Yao et al., 1992
). Expression and purification of MBPHEL and MBPHEL_KA were done essentially as described for the HCoV-229E helicase (Heusipp et al., 1997
). The partially double-stranded DNA substrate used in the unwinding assay was produced by annealing oligonucleotides D2 [5'-GGTGCAGCCGCAGCGGTGCTCG-d(pT)30-3'] and [
-32P]ATP-labelled D3 [5'-d(pT)30-CGAGCACCGCTGCGGCTGCACC-3'] as described by Seybert et al. (2000a)
. The unwinding reaction was done for 30 min at 25 °C in buffer A (HEPES/KOH, pH 7·4, 10 % glycerol, 5 mM magnesium acetate, 2 mM dithiothreitol and 0·1 mg BSA ml-1) using 10 nM of substrate and various concentrations of MBPHEL (8, 80 and 800 nM) and MBPHEL_KA (800 nM), respectively. The reaction products were analysed on polyacrylamide/TBE gels, which were exposed to X-ray film. ATPase reactions were done in buffer A for 5 min at 25 °C using the following concentrations: MBPHEL and MBPHEL_KA each at 0·8 µM, 10 µM [
-32P]ATP, 1 µM poly(U)250 (when included). The samples were analysed by polyethyleneiminecellulose thin-layer chromatography with 0·25 M potassium phosphate, pH 4·0, as the liquid phase. The reaction products were quantified by phosphorimaging of the dried chromatographic plates (ImageQuant software, Molecular Dynamics).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
Subgenomic mRNA synthesis
Coronaviruses (and arteriviruses) use a unique strategy to synthesize a set of subgenomic RNAs with common 5' and 3' sequences (Fig. 1
) (Lai & Holmes, 2001
; Siddell, 1995
; Pasternak et al., 2001
; Sawicki & Sawicki, 1998
). Each mRNA contains a short 5'-terminal leader sequence derived from the 5' end of the genome. The fusion of the noncontiguous sequences is currently believed to be achieved by a discontinuous step during minus-strand synthesis and involves transcription regulatory sequences (TRSs). In addition to the TRS at the 3' end of the leader sequence (leader TRS), TRSs are located upstream of the genes in the 3'-proximal part of the genome (body TRSs) (Lai & Holmes, 2001
; Siddell, 1995
; Sawicki & Sawicki, 1998
). To confirm that SARS-CoV also uses this discontinuous transcription strategy and to elucidate the molecular details of the resulting subgenomic RNAs, we analysed intracellular RNA synthesis by Northern blotting and determined the SARS-CoV mRNA sequences at the sites where the common 5' leader is fused to the various 3' body sequences, thus generating the subgenomic RNAs identified in SARS-CoV-infected cells. A Northern blot analysis using poly(A)-containing RNA isolated from SARS-CoV-infected cells and a probe specific for the 3'-proximal 794 nt revealed the synthesis of as many as nine RNAs, with RNA 1 representing the viral genome of 29·7 kb. The sizes of the subgenomic mRNAs were assessed using the previously characterized HCoV-229E RNAs (Thiel et al., 2001
) as markers. To provide conclusive evidence for the presence of common 5' leader sequences in each of the SARS-CoV mRNAs and to determine the leader-to-body fusion sites precisely, the 5'-proximal regions of mRNAs 2 to 9 were amplified by RT-PCR and sequenced. The amplification strategy used in these experiments is illustrated for subgenomic mRNA 3 in Fig. 1(d)
. In some cases we obtained, in addition to the expected RT-PCR product for a given mRNA, larger PCR products that corresponded to the expected RT-PCR products for the next largest subgenomic mRNAs. Sequence analysis of these products confirmed their identity unambiguously. The data obtained by RT-PCR amplification, sequence analysis and Northern blotting consistently suggest that SARS-CoV produces eight subgenomic mRNAs. Furthermore, the study revealed that a minimal consensus sequence, 5'-ACGAAC-3', is sufficient to direct the synthesis of SARS-CoV subgenomic mRNAs, most probably by base-pairing of its negative-stranded counterpart to the leader TRS during minus-strand synthesis. The number of identical nucleotides in leader TRS and body TRS regions varies between 6 and 11 (Fig. 1c
), but there is no clear correlation between the extent of sequence complementarity and abundance of a given mRNA (Fig. 1b and 1c
), indicating that additional factors (such as sequence elements, RNA structures, proteins) are involved in regulating the relative abundance of viral mRNAs. It is tempting to speculate that the transcription mechanism used by coronaviruses, arteriviruses and (in part) toroviruses (van Vliet et al., 2002
) has evolved to allow the production of a large set of structural and nonstructural (some of them probably virulence-associated) proteins (de Haan et al., 2002
), whose abundance can be regulated at the transcriptional level. Regulation of coronavirus gene expression can be even further extended by the presence of additional, downstream ORFs in the 5' unique regions of some of the subgenomic mRNAs. These are generally expressed by leaky scanning of ribosomes or internal ribosomal entry (Lai & Holmes, 2001
; Siddell, 1995
; Thiel et al., 1994
). As shown in Fig. 1
, SARS-CoV also produces four subgenomic RNAs (mRNA 3, 7, 8, 9) with downstream ORFs in their unique regions. The functions of the corresponding SARS-CoV gene products remain to be characterized. The observed 45 nt deletion in the putative ORF7b (see above) appears to suggest that at least one of these gene products is dispensable in cell culture. However, it cannot be excluded that the 15 aa deletion from the ORF7b gene product gives rise to an active (or partially active) protein.
Translation
The structures of SARS-CoV mRNAs (Fig. 1
) lead us to suggest that five of the nine SARS-CoV RNAs are functionally bicistronic. For most of them, the mechanisms used to express the downstream ORFs remain to be determined. On the basis of the available data for other coronaviruses (Brierley et al., 1989
; Eleouet et al., 1995
; Herold et al., 1993
; Kocherhans et al., 2001
), it seemed likely that ORF1b expression from the genomic RNA would involve -1 ribosomal frameshifting, a process that essentially depends on two elements, known as the slippery sequence, i.e. the site where the ribosomes shift into the -1 reading frame, and a complex RNA pseudoknot structure (Brierley et al., 1989
, 1995
). Analysis of the SARS-CoV sequence flanking the ORF1a termination codon revealed a putative SARS-CoV frameshifting element comprised of a putative slippery sequence (13392UUUAAAC13398) and, further downstream, stretches of complementary sequences that can be modelled to form a typical pseudoknot structure (Fig. 2
a) (Brierley et al., 1995
). To confirm that these elements mediate frameshifting in SARS-CoV and to define the frameshift site precisely, we synthesized RNAs containing the SARS-CoV frameshift region and produced a mutant version of the presumed slippery sequence (13392UUUAAAC13398
13392UGUAGCC13398). As shown in Fig. 2(b)
, efficient ribosomal frameshifting depended on an essentially unmodified 13392UUUAAAC13398 sequence, supporting the prediction that this sequence constitutes the actual slippage site.
|
125 (C-1651A) and
115 kDa (wild-type sequence) are consistent with cleavage at the predicted site, 818Gly|Ala819 (Snijder et al., 2003
|
|
|
-barrel fold but employ a catalytic CysHis dyad instead of the classical SerHisAsp triad. Furthermore, they possess a third, C-terminal domain composed of five
-helices. Our previous work has shown that the 3CLpro substrate specificities are conserved among the three established groups of coronaviruses (Hegyi & Ziebuhr, 2002
|
|
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anand, K., Ziebuhr, J., Wadhwani, P., Mesters, J. R. & Hilgenfeld, R. (2003). Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs. Science 300, 17631767.
Baker, S. C., Shieh, C. K., Soe, L. H., Chang, M. F., Vannier, D. M. & Lai, M. M. (1989). Identification of a domain required for autoproteolytic cleavage of murine coronavirus gene A polyprotein. J Virol 63, 36933699.
Bonilla, P. J., Hughes, S. A. & Weiss, S. R. (1997). Characterization of a second cleavage site and demonstration of activity in trans by the papain-like proteinase of the murine coronavirus mouse hepatitis virus strain A59. J Virol 71, 900909.[Abstract]
Bost, A. G., Carnahan, R. H., Lu, X. T. & Denison, M. R. (2000). Four proteins processed from the replicase gene polyprotein of mouse hepatitis virus colocalize in the cell periphery and adjacent to sites of virion assembly. J Virol 74, 33793387.
Brierley, I. (1995). Ribosomal frameshifting viral RNAs. J Gen Virol 76, 18851892.
Brierley, I., Digard, P. & Inglis, S. C. (1989). Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot. Cell 57, 537547.[CrossRef][Medline]
de Haan, C. A., Masters, P. S., Shen, X., Weiss, S. & Rottier, P. J. (2002). The group-specific murine coronavirus genes are not essential, but their deletion, by reverse genetics, is attenuating in the natural host. Virology 296, 177189.[CrossRef][Medline]
Drosten, C., Gunther, S., Preiser, W. & 23 other authors (2003). Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med 348, 19671976.
Eleouet, J. F., Rasschaert, D., Lambert, P., Levy, L., Vende, P. & Laude, H. (1995). Complete sequence (20 kilobases) of the polyprotein-encoding gene 1 of transmissible gastroenteritis virus. Virology 206, 817822.[CrossRef][Medline]
Fouchier, R. A., Kuiken, T., Schutten, M. & 7 other authors (2003). Aetiology: Koch's postulates fulfilled for SARS virus. Nature 423, 240.[CrossRef][Medline]
Gorbalenya, A. E. (2001). Big nidovirus genome. When count and order of domains matter. Adv Exp Med Biol 494, 117.
Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P. & Blinov, V. M. (1989a). Coronavirus genome: prediction of putative functional domains in the non-structural polyprotein by comparative amino acid sequence analysis. Nucleic Acids Res 17, 48474861.
Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P. & Blinov, V. M. (1989b). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res 17, 47134730.
Gorbalenya, A. E., Koonin, E. V. & Lai, M. M. (1991). Putative papain-related thiol proteases of positive-strand RNA viruses. Identification of rubi- and aphthovirus proteases and delineation of a novel conserved domain associated with proteases of rubi-, alpha- and coronaviruses. FEBS Lett 288, 201205.[CrossRef][Medline]
Hegyi, A. & Ziebuhr, J. (2002). Conservation of substrate specificities among coronavirus main proteases. J Gen Virol 83, 595599.
Hegyi, A., Friebe, A., Gorbalenya, A. E. & Ziebuhr, J. (2002). Mutational analysis of the active centre of coronavirus 3C-like proteases. J Gen Virol 83, 581593.
Herold, J., Raabe, T., Schelle-Prinz, B. & Siddell, S. G. (1993). Nucleotide sequence of the human coronavirus 229E RNA polymerase locus. Virology 195, 680691.[CrossRef][Medline]
Herold, J., Gorbalenya, A. E., Thiel, V., Schelle, B. & Siddell, S. G. (1998). Proteolytic processing at the amino terminus of human coronavirus 229E gene 1-encoded polyproteins: identification of a papain-like proteinase and its substrate. J Virol 72, 910918.
Heusipp, G., Harms, U., Siddell, S. G. & Ziebuhr, J. (1997). Identification of an ATPase activity associated with a 71-kilodalton polypeptide encoded in gene 1 of the human coronavirus 229E. J Virol 71, 56315634.[Abstract]
Kanjanahaluethai, A. & Baker, S. C. (2000). Identification of mouse hepatitis virus papain-like proteinase 2 activity. J Virol 74, 79117921.
Kocherhans, R., Bridgen, A., Ackermann, M. & Tobler, K. (2001). Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 23, 137144.[CrossRef][Medline]
Ksiazek, T. G., Erdman, D., Goldsmith, C. S. & 23 other authors (2003). A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med 348, 19531966.
Lai, M. M. C. & Holmes, K. V. (2001). Coronaviridae: the viruses and their replication. In Fields Virology, 4th edn, pp. 11631185. Edited by D. M. Knipe & P. M. Howley. Philadelphia: Lippincott Williams & Wilkins.
Lim, K. P., Ng, L. F. & Liu, D. X. (2000). Identification of a novel cleavage activity of the first papain-like proteinase domain encoded by open reading frame 1a of the coronavirus avian infectious bronchitis virus and characterization of the cleavage products. J Virol 74, 16741685.
Liu, D. X., Tibbles, K. W., Cavanagh, D., Brown, T. D. & Brierley, I. (1995). Involvement of viral and cellular factors in processing of polyprotein encoded by ORF1a of the coronavirus IBV. Adv Exp Med Biol 380, 413421.[Medline]
Marra, M. A., Jones, S. J., Astell, C. R. & 56 other authors (2003). The genome sequence of the SARS-associated coronavirus. Science 300, 13991404.
Pasternak, A. O., van den Born, E., Spaan, W. J. & Snijder, E. J. (2001). Sequence requirements for RNA strand transfer during nidovirus discontinuous subgenomic RNA synthesis. EMBO J 20, 72207228.[CrossRef][Medline]
Peiris, J. S., Chu, C. M., Cheng, V. C. & 14 other authors (2003a). Clinical progression and viral load in a community outbreak of coronavirus-associated SARS pneumonia: a prospective study. Lancet 361, 17671772.[CrossRef][Medline]
Peiris, J. S., Lai, S. T., Poon, L. L. & 13 other authors (2003b). Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 361, 13191325.[CrossRef][Medline]
Rota, P. A., Oberste, M. S., Monroe, S. S. & 32 other authors (2003). Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 300, 13941399.
Ruan, Y. J., Wei, C. L., Ee, A. L. & 17 other authors (2003). Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. Lancet 361, 17791785.[CrossRef][Medline]
Sawicki, S. G. & Sawicki, D. L. (1998). A new model for coronavirus transcription. Adv Exp Med Biol 440, 215219.[Medline]
Schneider, T. D. & Stephens, R. M. (1990). Sequence logos: a new way to display consensus sequences. Nucleic Acids Res 18, 60976100.
Seybert, A., Ziebuhr, J. & Siddell, S. G. (1997). Expression and characterization of a recombinant murine coronavirus 3C-like proteinase. J Gen Virol 78, 7175.[Abstract]
Seybert, A., Hegyi, A., Siddell, S. G. & Ziebuhr, J. (2000a). The human coronavirus 229E superfamily 1 helicase has RNA and DNA duplex-unwinding activities with 5'-to-3' polarity. RNA 6, 10561068.[Abstract]
Seybert, A., van Dinten, L. C., Snijder, E. J. & Ziebuhr, J. (2000b). Biochemical characterization of the equine arteritis virus helicase suggests a close functional relationship between arterivirus and coronavirus helicases. J Virol 74, 95869593.
Siddell, S. G. (1995). The Coronaviridae. New York: Plenum Press.
Snijder, E. J., Bredenbeek, P. J., Dobbe, J. C. & 7 other authors (2003). Unique and conserved features of genome and proteome of SARS coronavirus, an early split-off from the coronavirus group 2 lineage. J Mol Biol (in press).
Thiel, V. & Siddell, S. G. (1994). Internal ribosome entry in the coding region of murine hepatitis virus mRNA 5. J Gen Virol 75, 30413046.
Thiel, V., Rashtchian, A., Herold, J., Schuster, D. M., Guan, N. & Siddell, S. G. (1997). Effective amplification of 20-kb DNA by reverse transcription PCR. Anal Biochem 252, 6270.[CrossRef][Medline]
Thiel, V., Herold, J., Schelle, B. & Siddell, S. G. (2001). Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus. J Gen Virol 82, 12731281.
van Dinten, L. C., van Tol, H., Gorbalenya, A. E. & Snijder, E. J. (2000). The predicted metal-binding region of the arterivirus helicase protein is involved in subgenomic mRNA synthesis, genome replication, and virion biogenesis. J Virol 74, 52135223.
van Vliet, A. L., Smits, S. L., Rottier, P. J. & de Groot, R. J. (2002). Discontinuous and non-discontinuous subgenomic RNA transcription in a nidovirus. EMBO J 21, 65716580.[CrossRef][Medline]
Walker, J. E., Saraste, M., Runswick, M. J. & Gay, N. J. (1982). Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945951.[Medline]
Yao, Z., Jones, D. H. & Grose, C. (1992). Site-directed mutagenesis of herpesvirus glycoprotein phosphorylation sites by recombination polymerase chain reaction. PCR Methods Appl 1, 205207.[Medline]
Ziebuhr, J. & Siddell, S. G. (1999). Processing of the human coronavirus 229E replicase polyproteins by the virus-encoded 3C-like proteinase: identification of proteolytic products and cleavage sites common to pp1a and pp1ab. J Virol 73, 177185.
Ziebuhr, J., Herold, J. & Siddell, S. G. (1995). Characterization of a human coronavirus (strain 229E) 3C-like proteinase activity. J Virol 69, 43314338.[Abstract]
Ziebuhr, J., Heusipp, G. & Siddell, S. G. (1997). Biosynthesis, purification, and characterization of the human coronavirus 229E 3C-like proteinase. J Virol 71, 39923997.[Abstract]
Ziebuhr, J., Snijder, E. J. & Gorbalenya, A. E. (2000). Virus-encoded proteinases and proteolytic processing in the Nidovirales. J Gen Virol 81, 853879.
Ziebuhr, J., Thiel, V. & Gorbalenya, A. E. (2001). The autocatalytic release of a putative RNA virus transcription factor from its polyprotein precursor involves two paralogous papain-like proteases that cleave the same peptide bond. J Biol Chem 276, 3322033232.
Received 13 June 2003;
accepted 19 June 2003.
This article has been cited by other articles:
![]() |
P. Serrano, M. A. Johnson, A. Chatterjee, B. W. Neuman, J. S. Joseph, M. J. Buchmeier, P. Kuhn, and K. Wuthrich Nuclear Magnetic Resonance Structure of the Nucleic Acid-Binding Domain of Severe Acute Respiratory Syndrome Coronavirus Nonstructural Protein 3 J. Virol., December 15, 2009; 83(24): 12998 - 13008. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Cornillez-Ty, L. Liao, J. R. Yates III, P. Kuhn, and M. J. Buchmeier Severe Acute Respiratory Syndrome Coronavirus Nonstructural Protein 2 Interacts with a Host Protein Complex Involved in Mitochondrial Biogenesis and Intracellular Signaling J. Virol., October 1, 2009; 83(19): 10314 - 10318. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ma, Y. Feng, D. Liu, and G. F. Gao Avian influenza virus, Streptococcus suis serotype 2, severe acute respiratory syndrome-coronavirus and beyond: molecular epidemiology, ecology and the situation in China Phil Trans R Soc B, September 27, 2009; 364(1530): 2725 - 2737. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Khanolkar, S. M. Hartwig, B. A. Haag, D. K. Meyerholz, L. L. Epping, J. S. Haring, S. M. Varga, and J. T. Harty Protective and Pathologic Roles of the Immune Response to Mouse Hepatitis Virus Type 1: Implications for Severe Acute Respiratory Syndrome J. Virol., September 15, 2009; 83(18): 9258 - 9272. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. J. Miknis, E. F. Donaldson, T. C. Umland, R. A. Rimmer, R. S. Baric, and L. W. Schultz Severe Acute Respiratory Syndrome Coronavirus nsp9 Dimerization Is Essential for Efficient Viral Growth J. Virol., April 1, 2009; 83(7): 3007 - 3018. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chatterjee, M. A. Johnson, P. Serrano, B. Pedrini, J. S. Joseph, B. W. Neuman, K. Saikatendu, M. J. Buchmeier, P. Kuhn, and K. Wuthrich Nuclear Magnetic Resonance Structure Shows that the Severe Acute Respiratory Syndrome Coronavirus-Unique Domain Contains a Macrodomain Fold J. Virol., February 15, 2009; 83(4): 1823 - 1836. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu, L. Cong, C. Chen, L. Wei, Q. Zhao, X. Xu, Y. Ma, M. Bartlam, and Z. Rao Crystal Structures of Two Coronavirus ADP-Ribose-1''-Monophosphatases and Their Complexes with ADP-Ribose: a Systematic Structural Analysis of the Viral ADRP Domain J. Virol., January 15, 2009; 83(2): 1083 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oostra, M. C. Hagemeijer, M. van Gent, C. P. J. Bekker, E. G. te Lintelo, P. J. M. Rottier, and C. A. M. de Haan Topology and Membrane Anchoring of the Coronavirus Replication Complex: Not All Hydrophobic Domains of nsp3 and nsp6 Are Membrane Spanning J. Virol., December 15, 2008; 82(24): 12392 - 12405. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Schaecher, M. S. Diamond, and A. Pekosz The Transmembrane Domain of the Severe Acute Respiratory Syndrome Coronavirus ORF7b Protein Is Necessary and Sufficient for Its Retention in the Golgi Complex J. Virol., October 1, 2008; 82(19): 9477 - 9491. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Decroly, I. Imbert, B. Coutard, M. Bouvet, B. Selisko, K. Alvarez, A. E. Gorbalenya, E. J. Snijder, and B. Canard Coronavirus Nonstructural Protein 16 Is a Cap-0 Binding Enzyme Possessing (Nucleoside-2'O)-Methyltransferase Activity J. Virol., August 15, 2008; 82(16): 8071 - 8084. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Neuman, J. S. Joseph, K. S. Saikatendu, P. Serrano, A. Chatterjee, M. A. Johnson, L. Liao, J. P. Klaus, J. R. Yates III, K. Wuthrich, et al. Proteomics Analysis Unravels the Functional Repertoire of Coronavirus Nonstructural Protein 3 J. Virol., June 1, 2008; 82(11): 5279 - 5294. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Narayanan, C. Huang, K. Lokugamage, W. Kamitani, T. Ikegami, C.-T. K. Tseng, and S. Makino Severe Acute Respiratory Syndrome Coronavirus nsp1 Suppresses Host Gene Expression, Including That of Type I Interferon, in Infected Cells J. Virol., May 1, 2008; 82(9): 4471 - 4479. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sperschneider and A. Datta KnotSeeker: Heuristic pseudoknot detection in long RNA sequences RNA, April 1, 2008; 14(4): 630 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, J. Zhang, T. Hu, K. Chen, H. Jiang, and X. Shen Residues on the Dimer Interface of SARS Coronavirus 3C-like Protease: Dimer Stability Characterization and Enzyme Catalytic Activity Analysis J. Biochem., April 1, 2008; 143(4): 525 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, T. Hu, J. Zhang, J. Chen, K. Chen, J. Ding, H. Jiang, and X. Shen Mutation of Gly-11 on the Dimer Interface Results in the Complete Crystallographic Dimer Dissociation of Severe Acute Respiratory Syndrome Coronavirus 3C-like Protease: CRYSTAL STRUCTURE WITH MOLECULAR DYNAMICS SIMULATIONS J. Biol. Chem., January 4, 2008; 283(1): 554 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oostra, C. A. M. de Haan, and P. J. M. Rottier The 29-Nucleotide Deletion Present in Human but Not in Animal Severe Acute Respiratory Syndrome Coronaviruses Disrupts the Functional Expression of Open Reading Frame 8 J. Virol., December 15, 2007; 81(24): 13876 - 13888. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oostra, E. G. te Lintelo, M. Deijs, M. H. Verheije, P. J. M. Rottier, and C. A. M. de Haan Localization and Membrane Topology of Coronavirus Nonstructural Protein 4: Involvement of the Early Secretory Pathway in Replication J. Virol., November 15, 2007; 81(22): 12323 - 12336. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Wathelet, M. Orr, M. B. Frieman, and R. S. Baric Severe Acute Respiratory Syndrome Coronavirus Evades Antiviral Signaling: Role of nsp1 and Rational Design of an Attenuated Strain J. Virol., November 1, 2007; 81(21): 11620 - 11633. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Schaecher, E. Touchette, J. Schriewer, R. M. Buller, and A. Pekosz Severe Acute Respiratory Syndrome Coronavirus Gene 7 Products Contribute to Virus-Induced Apoptosis J. Virol., October 15, 2007; 81(20): 11054 - 11068. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, Y. Wang, K. Ratia, A. D. Mesecar, K. D. Wilkinson, and S. C. Baker Proteolytic Processing and Deubiquitinating Activity of Papain-Like Proteases of Human Coronavirus NL63 J. Virol., June 1, 2007; 81(11): 6007 - 6018. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huang, C. J. Peters, and S. Makino Severe Acute Respiratory Syndrome Coronavirus Accessory Protein 6 Is a Virion-Associated Protein and Is Released from 6 Protein-Expressing Cells J. Virol., May 15, 2007; 81(10): 5423 - 5426. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ziebuhr, B. Schelle, N. Karl, E. Minskaia, S. Bayer, S. G. Siddell, A. E. Gorbalenya, and V. Thiel Human Coronavirus 229E Papain-Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replication J. Virol., April 15, 2007; 81(8): 3922 - 3932. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Vijaykrishna, G. J. D. Smith, J. X. Zhang, J. S. M. Peiris, H. Chen, and Y. Guan Evolutionary Insights into the Ecology of Coronaviruses J. Virol., April 15, 2007; 81(8): 4012 - 4020. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. DeDiego, E. Alvarez, F. Almazan, M. T. Rejas, E. Lamirande, A. Roberts, W.-J. Shieh, S. R. Zaki, K. Subbarao, and L. Enjuanes A Severe Acute Respiratory Syndrome Coronavirus That Lacks the E Gene Is Attenuated In Vitro and In Vivo J. Virol., February 15, 2007; 81(4): 1701 - 1713. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nagata, N. Iwata, H. Hasegawa, S. Fukushi, M. Yokoyama, A. Harashima, Y. Sato, M. Saijo, S. Morikawa, and T. Sata Participation of both Host and Virus Factors in Induction of Severe Acute Respiratory Syndrome (SARS) in F344 Rats Infected with SARS Coronavirus J. Virol., February 15, 2007; 81(4): 1848 - 1857. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cervantes-Barragan, R. Zust, F. Weber, M. Spiegel, K. S. Lang, S. Akira, V. Thiel, and B. Ludewig Control of coronavirus infection through plasmacytoid dendritic-cell-derived type I interferon Blood, February 1, 2007; 109(3): 1131 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Schaecher, J. M. Mackenzie, and A. Pekosz The ORF7b Protein of Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Is Expressed in Virus-Infected Cells and Incorporated into SARS-CoV Particles J. Virol., January 15, 2007; 81(2): 718 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Schutze, R. Ulferts, B. Schelle, S. Bayer, H. Granzow, B. Hoffmann, T. C. Mettenleiter, and J. Ziebuhr Characterization of White Bream Virus Reveals a Novel Genetic Cluster of Nidoviruses J. Virol., December 1, 2006; 80(23): 11598 - 11609. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kang, M. Feng, M. E. Schroeder, D. P. Giedroc, and J. L. Leibowitz Putative cis-Acting Stem-Loops in the 5' Untranslated Region of the Severe Acute Respiratory Syndrome Coronavirus Can Substitute for Their Mouse Hepatitis Virus Counterparts J. Virol., November 1, 2006; 80(21): 10600 - 10614. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Almazan, M. L. DeDiego, C. Galan, D. Escors, E. Alvarez, J. Ortego, I. Sola, S. Zuniga, S. Alonso, J. L. Moreno, et al. Construction of a Severe Acute Respiratory Syndrome Coronavirus Infectious cDNA Clone and a Replicon To Study Coronavirus RNA Synthesis J. Virol., November 1, 2006; 80(21): 10900 - 10906. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-P. Egloff, H. Malet, A. Putics, M. Heinonen, H. Dutartre, A. Frangeul, A. Gruez, V. Campanacci, C. Cambillau, J. Ziebuhr, et al. Structural and Functional Basis for ADP-Ribose and Poly(ADP-Ribose) Binding by Viral Macro Domains. J. Virol., September 1, 2006; 80(17): 8493 - 8502. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kamitani, K. Narayanan, C. Huang, K. Lokugamage, T. Ikegami, N. Ito, H. Kubo, and S. Makino Severe acute respiratory syndrome coronavirus nsp1 protein suppresses host gene expression by promoting host mRNA degradation PNAS, August 22, 2006; 103(34): 12885 - 12890. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huang, N. Ito, C.-T. K. Tseng, and S. Makino Severe acute respiratory syndrome coronavirus 7a accessory protein is a viral structural protein. J. Virol., August 1, 2006; 80(15): 7287 - 7294. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Joseph, K. S. Saikatendu, V. Subramanian, B. W. Neuman, A. Brooun, M. Griffith, K. Moy, M. K. Yadav, J. Velasquez, M. J. Buchmeier, et al. Crystal structure of nonstructural protein 10 from the severe acute respiratory syndrome coronavirus reveals a novel fold with two zinc-binding motifs. J. Virol., August 1, 2006; 80(16): 7894 - 7901. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Snijder, Y. van der Meer, J. Zevenhoven-Dobbe, J. J. M. Onderwater, J. van der Meulen, H. K. Koerten, and A. M. Mommaas Ultrastructure and Origin of Membrane Vesicles Associated with the Severe Acute Respiratory Syndrome Coronavirus Replication Complex. J. Virol., June 1, 2006; 80(12): 5927 - 5940. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ratia, K. S. Saikatendu, B. D. Santarsiero, N. Barretto, S. C. Baker, R. C. Stevens, and A. D. Mesecar Severe acute respiratory syndrome coronavirus papain-like protease: Structure of a viral deubiquitinating enzyme PNAS, April 11, 2006; 103(15): 5717 - 5722. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Minskaia, T. Hertzig, A. E. Gorbalenya, V. Campanacci, C. Cambillau, B. Canard, and J. Ziebuhr Discovery of an RNA virus 3'->5' exoribonuclease that is critically involved in coronavirus RNA synthesis PNAS, March 28, 2006; 103(13): 5108 - 5113. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Putics, A. E. Gorbalenya, and J. Ziebuhr Identification of protease and ADP-ribose 1''-monophosphatase activities associated with transmissible gastroenteritis virus non-structural protein 3. J. Gen. Virol., March 1, 2006; 87(Pt 3): 651 - 656. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huang, K. Narayanan, N. Ito, C. J. Peters, and S. Makino Severe Acute Respiratory Syndrome Coronavirus 3a Protein Is Released in Membranous Structures from 3a Protein-Expressing Cells and Infected Cells J. Virol., January 1, 2006; 80(1): 210 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hodgson, P. Britton, and D. Cavanagh Neither the RNA nor the Proteins of Open Reading Frames 3a and 3b of the Coronavirus Infectious Bronchitis Virus Are Essential for Replication J. Virol., January 1, 2006; 80(1): 296 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Barretto, D. Jukneliene, K. Ratia, Z. Chen, A. D. Mesecar, and S. C. Baker The Papain-Like Protease of Severe Acute Respiratory Syndrome Coronavirus Has Deubiquitinating Activity J. Virol., December 15, 2005; 79(24): 15189 - 15198. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Lindner, N. Fotouhi-Ardakani, V. Lytvyn, P. Lachance, T. Sulea, and R. Menard The Papain-Like Protease from the Severe Acute Respiratory Syndrome Coronavirus Is a Deubiquitinating Enzyme J. Virol., December 15, 2005; 79(24): 15199 - 15208. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Sims, R. S. Baric, B. Yount, S. E. Burkett, P. L. Collins, and R. J. Pickles Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs J. Virol., December 15, 2005; 79(24): 15511 - 15524. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Weiss and S. Navas-Martin Coronavirus Pathogenesis and the Emerging Pathogen Severe Acute Respiratory Syndrome Coronavirus Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 635 - 664. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Johnson, M. Feng, P. Liu, J. J. Millership, B. Yount, R. S. Baric, and J. L. Leibowitz Effect of Mutations in the Mouse Hepatitis Virus 3'(+)42 Protein Binding Element on RNA Replication J. Virol., December 1, 2005; 79(23): 14570 - 14585. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Yount, R. S. Roberts, A. C. Sims, D. Deming, M. B. Frieman, J. Sparks, M. R. Denison, N. Davis, and R. S. Baric Severe Acute Respiratory Syndrome Coronavirus Group-Specific Open Reading Frames Encode Nonessential Functions for Replication in Cell Cultures and Mice J. Virol., December 1, 2005; 79(23): 14909 - 14922. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Graham, A. C. Sims, S. M. Brockway, R. S. Baric, and M. R. Denison The nsp2 Replicase Proteins of Murine Hepatitis Virus and Severe Acute Respiratory Syndrome Coronavirus Are Dispensable for Viral Replication J. Virol., November 1, 2005; 79(21): 13399 - 13411. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Putics, W. Filipowicz, J. Hall, A. E. Gorbalenya, and J. Ziebuhr ADP-Ribose-1"-Monophosphatase: a Conserved Coronavirus Enzyme That Is Dispensable for Viral Replication in Tissue Culture J. Virol., October 15, 2005; 79(20): 12721 - 12731. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Peti, M. A. Johnson, T. Herrmann, B. W. Neuman, M. J. Buchmeier, M. Nelson, J. Joseph, R. Page, R. C. Stevens, P. Kuhn, et al. Structural Genomics of the Severe Acute Respiratory Syndrome Coronavirus: Nuclear Magnetic Resonance Structure of the Protein nsP7 J. Virol., October 15, 2005; 79(20): 12905 - 12913. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kan, M. Wang, H. Jing, H. Xu, X. Jiang, M. Yan, W. Liang, H. Zheng, K. Wan, Q. Liu, et al. Molecular Evolution Analysis and Geographic Investigation of Severe Acute Respiratory Syndrome Coronavirus-Like Virus in Palm Civets at an Animal Market and on Farms J. Virol., September 15, 2005; 79(18): 11892 - 11900. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dye and S. G. Siddell Genomic RNA sequence of Feline coronavirus strain FIPV WSU-79/1146 J. Gen. Virol., August 1, 2005; 86(8): 2249 - 2253. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Neuman, D. A. Stein, A. D. Kroeker, M. J. Churchill, A. M. Kim, P. Kuhn, P. Dawson, H. M. Moulton, R. K. Bestwick, P. L. Iversen, et al. Inhibition, Escape, and Attenuated Growth of Severe Acute Respiratory Syndrome Coronavirus Treated with Antisense Morpholino Oligomers J. Virol., August 1, 2005; 79(15): 9665 - 9676. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Tan, P.-Y. Tham, D. Z. L. Chan, C.-F. Chou, S. Shen, B. C. Fielding, T. H. P. Tan, S. G. Lim, and W. Hong The Severe Acute Respiratory Syndrome Coronavirus 3a Protein Up-Regulates Expression of Fibrinogen in Lung Epithelial Cells J. Virol., August 1, 2005; 79(15): 10083 - 10087. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Su, C.-T. Chang, C.-H. Chu, C.-H. Tsai, and K.-Y. Chang An atypical RNA pseudoknot stimulator and an upstream attenuation signal for -1 ribosomal frameshifting of SARS coronavirus Nucleic Acids Res., July 29, 2005; 33(13): 4265 - 4275. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Casais, M. Davies, D. Cavanagh, and P. Britton Gene 5 of the Avian Coronavirus Infectious Bronchitis Virus Is Not Essential for Replication J. Virol., July 1, 2005; 79(13): 8065 - 8078. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. Hsu, H.-C. Chang, C.-Y. Chou, P.-J. Tsai, P.-I. Lin, and G.-G. Chang Critical Assessment of Important Regions in the Subunit Association and Catalytic Action of the Severe Acute Respiratory Syndrome Coronavirus Main Protease J. Biol. Chem., June 17, 2005; 280(24): 22741 - 22748. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schelle, N. Karl, B. Ludewig, S. G. Siddell, and V. Thiel Selective Replication of Coronavirus Genomes That Express Nucleocapsid Protein J. Virol., June 1, 2005; 79(11): 6620 - 6630. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, C. Gui, X. Luo, Q. Yang, S. Gunther, E. Scandella, C. Drosten, D. Bai, X. He, B. Ludewig, et al. Cinanserin Is an Inhibitor of the 3C-Like Proteinase of Severe Acute Respiratory Syndrome Coronavirus and Strongly Reduces Virus Replication In Vitro J. Virol., June 1, 2005; 79(11): 7095 - 7103. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. R. Yang Mining SARS-CoV protease cleavage data using non-orthogonal decision trees: a novel method for decisive template selection Bioinformatics, June 1, 2005; 21(11): 2644 - 2650. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hussain, J. Pan, Y. Chen, Y. Yang, J. Xu, Y. Peng, Y. Wu, Z. Li, Y. Zhu, P. Tien, et al. Identification of Novel Subgenomic RNAs and Noncanonical Transcription Initiation Signals of Severe Acute Respiratory Syndrome Coronavirus J. Virol., May 1, 2005; 79(9): 5288 - 5295. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Endoh, T. Mizutani, R. Kirisawa, Y. Maki, H. Saito, Y. Kon, S. Morikawa, and M. Hayashi Species-independent detection of RNA virus by representational difference analysis using non-ribosomal hexanucleotides for reverse transcription Nucleic Acids Res., April 7, 2005; 33(6): e65 - e65. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sulea, H. A. Lindner, E. O. Purisima, and R. Menard Deubiquitination, a New Function of the Severe Acute Respiratory Syndrome Coronavirus Papain-Like Protease? J. Virol., April 1, 2005; 79(7): 4550 - 4551. [Full Text] [PDF] |
||||
![]() |
E. Manktelow, K. Shigemoto, and I. Brierley Characterization of the frameshift signal of Edr, a mammalian example of programmed -1 ribosomal frameshifting Nucleic Acids Res., March 14, 2005; 33(5): 1553 - 1563. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ito, E. C. Mossel, K. Narayanan, V. L. Popov, C. Huang, T. Inoue, C. J. Peters, and S. Makino Severe Acute Respiratory Syndrome Coronavirus 3a Protein Is a Viral Structural Protein J. Virol., March 1, 2005; 79(5): 3182 - 3186. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Seybert, C. C. Posthuma, L. C. van Dinten, E. J. Snijder, A. E. Gorbalenya, and J. Ziebuhr A Complex Zinc Finger Controls the Enzymatic Activities of Nidovirus Helicases J. Virol., January 15, 2005; 79(2): 696 - 704. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, L. Chen, J. Tan, J. Chen, L. Du, T. Sun, J. Shen, K. Chen, H. Jiang, and X. Shen Severe Acute Respiratory Syndrome Coronavirus 3C-like Proteinase N Terminus Is Indispensable for Proteolytic Activity but Not for Enzyme Dimerization: BIOCHEMICAL AND THERMODYNAMIC INVESTIGATION IN CONJUNCTION WITH MOLECULAR DYNAMICS SIMULATIONS J. Biol. Chem., January 7, 2005; 280(1): 164 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Harcourt, D. Jukneliene, A. Kanjanahaluethai, J. Bechill, K. M. Severson, C. M. Smith, P. A. Rota, and S. C. Baker Identification of Severe Acute Respiratory Syndrome Coronavirus Replicase Products and Characterization of Papain-Like Protease Activity J. Virol., December 15, 2004; 78(24): 13600 - 13612. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Tan, B. C. Fielding, P.-Y. Goh, S. Shen, T. H. P. Tan, S. G. Lim, and W. Hong Overexpression of 7a, a Protein Specifically Encoded by the Severe Acute Respiratory Syndrome Coronavirus, Induces Apoptosis via a Caspase-Dependent Pathway J. Virol., December 15, 2004; 78(24): 14043 - 14047. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Brockway, X. T. Lu, T. R. Peters, T. S. Dermody, and M. R. Denison Intracellular Localization and Protein Interactions of the Gene 1 Protein p28 during Mouse Hepatitis Virus Replication J. Virol., November 1, 2004; 78(21): 11551 - 11562. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Hogan, G. Gao, T. Rowe, P. Bell, D. Flieder, J. Paragas, G. P. Kobinger, N. A. Wivel, R. G. Crystal, J. Boyer, et al. Resolution of Primary Severe Acute Respiratory Syndrome-Associated Coronavirus Infection Requires Stat1 J. Virol., October 15, 2004; 78(20): 11416 - 11421. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Prentice, J. McAuliffe, X. Lu, K. Subbarao, and M. R. Denison Identification and Characterization of Severe Acute Respiratory Syndrome Coronavirus Replicase Proteins J. Virol., September 15, 2004; 78(18): 9977 - 9986. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Glass, K. Subbarao, B. Murphy, and P. M. Murphy Mechanisms of Host Defense following Severe Acute Respiratory Syndrome-Coronavirus (SARS-CoV) Pulmonary Infection of Mice J. Immunol., September 15, 2004; 173(6): 4030 - 4039. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Ivanov, T. Hertzig, M. Rozanov, S. Bayer, V. Thiel, A. E. Gorbalenya, and J. Ziebuhr Major genetic marker of nidoviruses encodes a replicative endoribonuclease PNAS, August 24, 2004; 101(34): 12694 - 12699. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. St-Jean, H. Jacomy, M. Desforges, A. Vabret, F. Freymuth, and P. J. Talbot Human Respiratory Coronavirus OC43: Genetic Stability and Neuroinvasion J. Virol., August 15, 2004; 78(16): 8824 - 8834. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Gorbalenya, E. J. Snijder, and W. J. M. Spaan Severe Acute Respiratory Syndrome Coronavirus Phylogeny: toward Consensus J. Virol., August 1, 2004; 78(15): 7863 - 7866. [Full Text] [PDF] |
||||
![]() |
B. C. Fielding, Y.-J. Tan, S. Shuo, T. H. P. Tan, E.-E. Ooi, S. G. Lim, W. Hong, and P.-Y. Goh Characterization of a Unique Group-Specific Protein (U122) of the Severe Acute Respiratory Syndrome Coronavirus J. Virol., July 15, 2004; 78(14): 7311 - 7318. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Ivanov and J. Ziebuhr Human Coronavirus 229E Nonstructural Protein 13: Characterization of Duplex-Unwinding, Nucleoside Triphosphatase, and RNA 5'-Triphosphatase Activities J. Virol., July 15, 2004; 78(14): 7833 - 7838. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gillim-Ross, J. Taylor, D. R. Scholl, J. Ridenour, P. S. Masters, and D. E. Wentworth Discovery of Novel Human and Animal Cells Infected by the Severe Acute Respiratory Syndrome Coronavirus by Replication-Specific Multiplex Reverse Transcription-PCR J. Clin. Microbiol., July 1, 2004; 42(7): 3196 - 3206. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Tan, E. Teng, S. Shen, T. H. P. Tan, P.-Y. Goh, B. C. Fielding, E.-E. Ooi, H.-C. Tan, S. G. Lim, and W. Hong A Novel Severe Acute Respiratory Syndrome Coronavirus Protein, U274, Is Transported to the Cell Surface and Undergoes Endocytosis J. Virol., July 1, 2004; 78(13): 6723 - 6734. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, G. Wang, J. Li, Y. Nie, X. Shi, G. Lian, W. Wang, X. Yin, Y. Zhao, X. Qu, et al. Identification of an Antigenic Determinant on the S2 Domain of the Severe Acute Respiratory Syndrome Coronavirus Spike Glycoprotein Capable of Inducing Neutralizing Antibodies J. Virol., July 1, 2004; 78(13): 6938 - 6945. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shi, Z. Wei, and J. Song Dissection Study on the Severe Acute Respiratory Syndrome 3C-like Protease Reveals the Critical Role of the Extra Domain in Dimerization of the Enzyme: DEFINING THE EXTRA DOMAIN AS A NEW TARGET FOR DESIGN OF HIGHLY SPECIFIC PROTEASE INHIBITORS J. Biol. Chem., June 4, 2004; 279(23): 24765 - 24773. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hertzig, E. Scandella, B. Schelle, J. Ziebuhr, S. G. Siddell, B. Ludewig, and V. Thiel Rapid identification of coronavirus replicase inhibitors using a selectable replicon RNA J. Gen. Virol., June 1, 2004; 85(6): 1717 - 1725. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Ivanov, V. Thiel, J. C. Dobbe, Y. van der Meer, E. J. Snijder, and J. Ziebuhr Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase J. Virol., June 1, 2004; 78(11): 5619 - 5632. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Denison, B. Yount, S. M. Brockway, R. L. Graham, A. C. Sims, X. Lu, and R. S. Baric Cleavage between Replicase Proteins p28 and p65 of Mouse Hepatitis Virus Is Not Required for Virus Replication J. Virol., June 1, 2004; 78(11): 5957 - 5965. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. L. Sihoe, R. H. L. Wong, A. T. H. Lee, L. S. Lau, N. Y. Y. Leung, K. I. Law, and A. P. C. Yim Severe Acute Respiratory Syndrome Complicated by Spontaneous Pneumothorax Chest, June 1, 2004; 125(6): 2345 - 2351. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Choy, S.-G. Lin, P. K.-S. Chan, J. S.-L. Tam, Y.M. D. Lo, I. M.-T. Chu, S.-N. Tsai, M.-Q. Zhong, K.-P. Fung, M. M.-Y. Waye, et al. Synthetic Peptide Studies on the Severe Acute Respiratory Syndrome (SARS) Coronavirus Spike Glycoprotein: Perspective for SARS Vaccine Development Clin. Chem., June 1, 2004; 50(6): 1036 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-P. Egloff, F. Ferron, V. Campanacci, S. Longhi, C. Rancurel, H. Dutartre, E. J. Snijder, A. E. Gorbalenya, C. Cambillau, and B. Canard The severe acute respiratory syndrome-coronavirus replicative protein nsp9 is a single-stranded RNA-binding subunit unique in the RNA virus world PNAS, March 16, 2004; 101(11): 3792 - 3796. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Bressler and F. S. Nolte Preclinical Evaluation of Two Real-Time, Reverse Transcription-PCR Assays for Detection of the Severe Acute Respiratory Syndrome Coronavirus J. Clin. Microbiol., March 1, 2004; 42(3): 987 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. VAN DEN BORN, A. P. GULTYAEV, and E. J. SNIJDER Secondary structure and function of the 5'-proximal region of the equine arteritis virus RNA genome RNA, March 1, 2004; 10(3): 424 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Tan, P.-Y. Goh, B. C. Fielding, S. Shen, C.-F. Chou, J.-L. Fu, H. N. Leong, Y. S. Leo, E. E. Ooi, A. E. Ling, et al. Profiles of Antibody Responses against Severe Acute Respiratory Syndrome Coronavirus Recombinant Proteins and Their Potential Use as Diagnostic Markers Clin. Vaccine Immunol., March 1, 2004; 11(2): 362 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, Y. Liu, S. Weiss, E. Arnold, S. G. Sarafianos, and J. Ding Molecular model of SARS coronavirus polymerase: implications for biochemical functions and drug design Nucleic Acids Res., December 15, 2003; 31(24): 7117 - 7130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Tanner, R. M. Watt, Y.-B. Chai, L.-Y. Lu, M. C. Lin, J. S. M. Peiris, L. L. M. Poon, H.-F. Kung, and J.-D. Huang The Severe Acute Respiratory Syndrome (SARS) Coronavirus NTPase/Helicase Belongs to a Distinct Class of 5' to 3' Viral Helicases J. Biol. Chem., October 10, 2003; 278(41): 39578 - 39582. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |