J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 85 (2004), 305-322; DOI 10.1099/vir.0.19568-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laidlaw, S. M.
Right arrow Articles by Skinner, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laidlaw, S. M.
Right arrow Articles by Skinner, M. A.
Agricola
Right arrow Articles by Laidlaw, S. M.
Right arrow Articles by Skinner, M. A.
© 2004 Society for General Microbiology

Comparison of the genome sequence of FP9, an attenuated, tissue culture-adapted European strain of Fowlpox virus, with those of virulent American and European viruses

Stephen M. Laidlaw and Michael A. Skinner

Institute for Animal Health, Division of Molecular Biology, Compton, Newbury, Berks RG20 7NN, UK

Correspondence
Michael A. Skinner
michael.skinner{at}bbsrc.ac.uk


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
The 266 kbp genome sequence of plaque-purified, tissue culture-adapted, attenuated European Fowlpox virus FP9 has been determined and compared with the 288 kbp sequence of a pathogenic US strain (FPVUS). FP9 carries 244 of the 260 reported FPVUS ORFs (both viruses also have an unreported orthologue of conserved poxvirus gene A14.5L). Relative to FPVUS, FP9 differed by 118 mutations (26 deletions, 15 insertions and 77 base substitutions), affecting FP9 equivalents of 71 FPVUS ORFs. To help to identify mutations involved in adaptation and attenuation, the virulent parent of FP9, HP1, was sequenced at positions where FP9 differed from FPVUS. At 68 positions, FP9 and HP1 sequences were identical, reflecting differences between American and European lineages. Mutations at the remaining 50 positions in FP9 relative to FPVUS and HP1, involving 46 ORFs, therefore accounted for adaptation and attenuation. ORFs deleted during passage included those encoding members of multigene families: 12 ankyrin repeat proteins, three C-type lectin-like proteins, two C4L/C10L-like proteins, one G-protein coupled receptor protein, one V-type Ig domain protein, two N1R/p28 proteins and one EFc family protein. Tandem ORFs encoding Variola virus B22R orthologues were fused by a 5·8 kbp deletion. Single-copy genes disrupted or deleted during passage included those encoding a homologue of murine T10, a conserved DNA/pantothenate metabolism flavoprotein, photolyase, the A-type inclusion protein and an orthologue of vaccinia A47L. Gene assignments have been updated for DNase II/DLAD, binding proteins for IL-18 and interferon-{gamma}, phospholipid hydroperoxide glutathione peroxidase (PHGPX/GPX-4) and for a highly conserved homologue of ELOVL4.

The GenBank/EMBL accession number of the sequence reported in this paper is AJ581527.


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Live, attenuated viruses constitute the majority of virus vaccines used in clinical or veterinary medicine. Apart from the use of naturally occurring, antigenically related viruses (such as Vaccinia virus, used for smallpox vaccination), there are two main approaches to their derivation: the isolation of naturally attenuated viruses from homologous or heterologous hosts and extensive, serial tissue culture passage of virulent isolates until they become stably attenuated (as for Sabin's poliovirus vaccines).

Determinants of attenuation have been mapped for some of the smaller, mainly RNA, viruses. For viruses with larger DNA genomes (i.e. poxviruses and herpesviruses) this is not the case. In fact, there are few examples where the sequence of an attenuated vaccine can be compared to that of its virulent target. With the exception of the recent sequence comparison of the Oka vaccine of Varicella-zoster virus with its virulent parental virus (Gomi et al., 2002Down), even those examples do not represent true parent–progeny relationships but normally involve independent isolates of different virulence. Thus, amongst the herpesviruses, virulent chicken strains (serotype 1) of Marek's disease virus (MDV) have been sequenced (Lee et al., 2000Down; Tulman et al., 2000Down), as has a non-oncogenic serotype 2 strain (Izumiya et al., 2001Down) and the related Herpesvirus of turkeys (Afonso et al., 2001Down), both used as MDV vaccines. In all such situations involving naturally attenuated, large DNA viruses, the degree of sequence divergence between the virulent and vaccine viruses has been high (20–30 % for the avian herpesviruses). The number of differences, and their dispersion, makes it difficult to identify those that contribute to attenuation of the vaccine.

Some potential attenuating determinants for Vaccinia virus have, nevertheless, been identified, such as the truncation in Vaccinia virus B28R/C22L, the orthologue of Variola virus G2R encoding a tumour necrosis factor (TNF) receptor-like protein (Massung et al., 1994Down), and the presence in some Vaccinia virus strains (but not Variola virus) of B15R (strain Western Reserve) encoding an interleukin-1{beta}-binding protein (Aguado et al., 1992Down; Alcami & Smith, 1992Down; Massung et al., 1994Down). However, understandably, there has been little experimental work on the comparative virulence of Variola virus (the causative agent of smallpox) and Vaccinia virus.

There have been attempts to attenuate Vaccinia virus rationally by direct manipulation to reduce its already low virulence (Tartaglia et al., 1992Down). Moreover, the virulence of Vaccinia virus strain Ankara (which remains unsequenced) has been reduced by tissue culture passage, resulting in modified virus Ankara or MVA (Mayr et al., 1978Down), which has been sequenced (Antoine et al., 1998Down). Similarly, amongst the herpesviruses, Pseudorabies virus has been manipulated by deletion to make attenuated vaccines (Kit, 1990Down; Mettenleiter et al., 1994Down) and vaccines based on disabled, single-cycle derivatives of Herpes simplex virus (DISC-HSV) are being evaluated especially for cancer prophylaxis and immunotherapy (Ali et al., 2000Down).

A recent study of Sheeppox virus and Goatpox virus provides the best comparison so far for complete genome sequences of virulent and attenuated poxviruses (Tulman et al., 2002Down). The viruses sequenced were from distinct isolates, rather than being from recorded lineages, but the level of divergence between virulent and attenuated viruses was, nevertheless, surprisingly low. Thus virulent (SA) and low passage-attenuated (NK) isolates of Sheeppox virus were distinguished by just 71 differences (36 of them single nucleotide substitutions, a divergence of 0·024 %). Similarly, virulent (PL) and attenuated (GV) isolates of Goatpox virus were distinguished by just 7 differences (4 of them single nucleotide substitutions).

We undertook to complete the genome sequence determination for FP9, a plaque-purified, high passage-attenuated, European strain of Fowlpox virus (Mockett et al., 1992Down). FP9 has been used as a recombinant vector for the expression of antigens from several avian pathogens (Boursnell et al., 1990aDown, bDown; Bayliss et al., 1991Down) as well as bacteriophage T7 RNA polymerase (Britton et al., 1996Down). We had previously mapped the genome of FP9 (Mockett et al., 1992Down) and had undertaken analysis of several non-essential genes (Laidlaw et al., 1998Down), of several structural antigens (Boulanger et al., 1998Down, 2002Down) and of virus morphogenesis (Boulanger et al., 2000Down). As the FP9 sequencing project neared completion, the sequence of a virulent US strain, ‘FPVUS’, was published (Afonso et al., 2000Down), presenting an opportunity to compare virulent and passage-attenuated viruses. Comparison of the two sequences revealed just 118 differences (77 of them single nucleotide substitutions, a divergence of only 0·03 %) but some of these might represent differences between US and European lineages rather than mutations that occurred during tissue culture passage and concomitant attenuation. Although we could not justify determination of the complete sequence of HP1 (the virulent progenitor of FP9), we did determine the HP1 sequence at every position where FP9 differed from FPVUS. The results provide a fascinating insight into the attenuation of Fowlpox virus that occurred during, or as consequence of, extensive tissue culture passage in chick embryo fibroblasts (CEFs). Thus the combination of adaptation to CEFs and attenuation was the result of relatively few mutations (just 50, of which 26 were single nucleotide substitutions), affecting mainly genes that would probably have been considered unlikely targets for rational attenuation.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
FP9 DNA purification, cloning and sequencing.
FP9 DNA was extracted, sonicated and repaired as described (Binns et al., 1992Down). DNA fragments (1300–2500 bp) were size selected (Skinner & Laidlaw, 1999Down), cloned into SmaI-cut, dephosphorylated pUC18 (Amersham Pharmacia) and transformed into Escherichia coli DH5{alpha} cells. Plasmids, purified using Qiaprep columns (Qiagen), were sequenced with forward and reverse primers by the dideoxy chain termination method (Sanger et al., 1977Down) with sequencing kits (Amersham Pharmacia and PE Biosystems) on Applied Biosystems (ABI) 373A or PRISM 377 automated DNA sequencers (Perkin Elmer). Trace analysis and base extraction was performed using Sequence Analysis v3.3 (ABI). Gaps were closed by primer walking along existing clones and by sequencing of PCR products, generated using the Expand High Fidelity PCR system (Roche) and purified using Qiaquick columns (Qiagen).

PREGAP4 and GAP4 (Bonfield et al., 1995Down) were used for sequence entry, assembly and editing (Skinner & Laidlaw, 1999Down). Coding sequences were identified and analysed by BLAST using ARTEMIS (Rutherford et al., 2000Down).

Amplification and sequencing of HP1 loci.
HP1 virus (at nine chick embryo passages) was amplified three times in CEFs prior to DNA extraction, as described previously (Binns et al., 1992Down). PCR was carried out, using primers designed to amplify FP9 mutation sites, and then products were purified and sequenced, as described above. For analysis of HP1 loci where deletions had been observed in FP9, primers were used that flanked the deletion as well as primers, based on the FPVUS sequence, that were internal to the FP9 deletions. Where flanking primer PCR resulted in two bands, each band was extracted from an agarose gel, purified and sequenced.


   RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Genome organization
The FP9 genome sequence (determined on both strands at a mean sixfold redundancy) is 266 145 bp long, 22 kbp shorter than that of FPVUS (Afonso et al., 2000Down). FP9 has inverted terminal repeats (ITRs) of 10 158 bp, in accordance with earlier estimates (Campbell et al., 1989Down), longer than those (9520 bp) reported for FPVUS (Afonso et al., 2000Down). Compared to the FPVUS sequence, the FP9 sequence has an extra 94 bp at each terminus (Campbell et al., 1989Down), including the sequence ATTTATATAGTAAAAAAAATGTATAA (nucleotides 21–46), which closely resembles the telomere resolution sequence (underlined) of mammalian poxviruses (Merchlinsky & Moss, 1989Down). Within the ITRs, a repeat region of 3753 bp (nucleotides 230–3982), consisting of 32 and 56 bp repeats, has been sequenced. The repeats were first described by Campbell et al. (1989)Down who, by partial restriction enzyme analysis, estimated the repeat region to be 3·87 kbp. Their reported distribution of HindIII and SstI restriction sites was used to assist in semi-manual assembly across the repeat region. The equivalent repeat region in FPVUS was only 1675 bp (thus 2078 bp shorter), ending at nucleotide 1812, though individual clones were reported to have repeat regions of up to 5·8 kbp (Afonso et al., 2000Down). The next 18 bp of sequence in FPVUS appear to represent 6 bp from the end of a repeat followed by a partial, degenerate repeat that is not present in FP9. Instead, the sequence immediately following the end of the repeats in FP9 (from nucleotide 3983) is identical to sequence from nucleotide 3346 in FPVUS. It appears, therefore, that a 1534 bp deletion (deletion 2), in FP9 relative to FPVUS, removed ORF 001 from FP9 as well as 18 bp from the degenerate internal end of the repeat region (see supplementary data at JGV Online: http://vir.sgmjournals.org). Approaching, as it does in FP9, to within 22 bp of the start of ORF 002, it is possible that deletion 2 has detrimental affects on promoter activity, as compared to the uncharacterized ‘wild-type’ promoter of fpv002.

REV proviral sequences
FP9 contains a copy of the partial reticuloendotheliosis virus (REV) retroviral long terminal repeat (LTR; nucleotides 221738–221985), identical in sequence and context to the single REV LTRs found in Fowlpox virus M (from Australia) and FPVUS (Hertig et al., 1997Down; Afonso et al., 2000Down). PCR of this region with flanking primers produced a fragment of the same size and sequence from FP9 and HP-1. It therefore appears that the event that gave rise to the presence of this vestigial REV sequence predates the divergence of the Australian, American and European fowlpox viruses, as well as the divergence of Fowlpox virus and Pigeonpox virus (Moore et al., 2000Down; Kim & Tripathy, 2001Down; Garcia et al., 2003Down; Tadese & Reed, 2003Down). The REV fragment is the smaller (248 bp) fragment described by Singh et al. (2003)Down. We were unable to detect REV proviral sequences, other than the partial LTR, in FP9 or HP-1. Singh et al. reported that only one field outbreak strain of Fowlpox virus had been isolated with the small LTR fragment but HP-1 and FPVUS are both virulent viruses and both have the identical small LTR fragment. We cannot rule out the possibility, however, that additional REV proviral sequences might have been lost during the preliminary short passage histories of HP-1 and FPVUS.

Update on fowlpox virus genomic assignments
Though 3 years have passed since the publication of the FPVUS sequence, during which time a large amount of sequence data has been acquired, a BLAST search of the current databases revealed the need to update relatively few of the assignments originally made by Afonso et al. (2000)Down. Throughout the paper, we maintain the FPVUS numbering for ORFs, distinguishing variant FP9 ORFs by the prefix ‘fp9.’ instead of ‘fpv (see Table 1Down). To distinguish genes or ORFs from their encoded protein products, italicized lower-case is used for genes and ORFs (e.g. fp9.030 or fpv030) and plain text (with capitalized first letter) for the products they encode (e.g. Fp9.030 or Fpv030).


View this table:
[in this window]
[in a new window]
 
Table 1. FP9 open reading frames

To differentiate ORFs from the two viruses, the FP9 ORFs carry the prefix ‘fp9.’. Where ORFs are not accommodated by the numbering system described above, they are represented by a suffix. It has become common to use the suffix ‘.5’ for such genes but this lacks the flexibility to cope with multiple, intergenic ORFs so a sequential system has been used. Thus fp9.179.1 represents the first small ORF between fp9.179 and fp9.180. Abbreviations: ‘Del’ – deleted; ‘Ext’ – extended (N- or C-terminal); ‘Trunc’ – truncated (N- or C-terminal); ‘Int Ins' – internal insertion; ‘Int Del’ – internal deletion; ‘Kozak’ – change to context of Kozak initiator codon sequence; ‘f/s' – frame-shift.

 
Fpv048, reported to show 44 % amino acid identity with GNS1/SUR4, now shows a strikingly high similarity (69 % amino acid identity) with human ELOVL4, the gene involved in Stargardt-like macular dystrophy (STGD3, OMIM 600110) and implicated in elongation of long-chain fatty acids (Zhang et al., 2001Down).

Another important update is the identification by Puehler et al. (2003)Down that fpv016 (previously unassigned) encodes a binding protein for interferon-{gamma}. As such, it represents a new type of IFN-{gamma}-binding protein, with an immunoglobulin fold instead of a fibronectin fold. This is directly analogous to the discovery that the IFN-{alpha}/{beta}-binding protein encoded by Vaccinia virus strain Western Reserve B18R is a member of the immunoglobulin superfamily, rather than of the cellular class II cytokine receptor family with their fibronectin folds (Symons et al., 1995Down). Both illustrate that not all viral immunomodulators can be identified by sequence similarity with host proteins of known function.

Three proteins, encoded by Molluscum contagiosum virus (MCV) genes MC051L, MC053L and MC054L, were found (Xiang & Moss, 1999bDown) to show similarity to what was subsequently identified (Novick et al., 1999Down) as human interleukin-18 (IL-18)-binding protein, though only that encoded by MC054L appears to have IL-18-binding activity (Xiang & Moss, 1999aDown, 2001aDown). Afonso et al. (2000)Down assigned Fpv073 as an IL18-binding protein, on the basis of low similarity (26 % amino acid identity). We believe Fpv214 is a more likely candidate. As reported by Afonso et al. (2000)Down, it shows higher similarity (29 % amino acid identity) to the Vaccinia virus strain MVA 13·7 kDa IL-18-binding protein (Smith et al., 2000Down). Moreover, the region of similarity spans the motif (tyrosine-97 and phenylalanine-104 of the human IL-18-binding protein), identified as the active site of the IL-18-binding proteins (Xiang & Moss, 2001aDown, bDown) and conserved in MC054L and the 13·7 kDa protein. In contrast, we were unable to align Fpv073 with this region. Fpv073 is most similar to small parts of a tyrosine-protein kinase (P53356; 33 % identity over 63 amino acids) and a transposase (Q9SH80; 35 % identity over 51 amino acids). The former includes a glycine-rich phosphate-binding motif (GxGxxG) involved in nucleotide binding.

Afonso et al. (2000)Down assigned Fpv064 as a glutathione peroxidase (GPX), with similarity to the product of Molluscum contagiosum virus MC066L. However, they also showed that fpv064 and MC066L were not collinear in their respective genomes. We believe this is because the acquisition of fpv064 was independent from that of MC066L and that a different cellular gene was acquired. We believe this to be the case because Fpv064 is most closely related not to glutathione peroxidase (GPX-1, EC 1.11.1.9), to which it shows 29 % identity (and to which MC066L shows 84 % identity), but to phospholipid hydroperoxide glutathione peroxidase (PHGPX, GPX-4; EC 1.11.1.12), to which it shows 44 % amino acid identity (and to which MC066L shows 35 % identity). PHGPX and GPX share only 36 % amino acid identity (Brigelius-Flohe et al., 1994Down). It is interesting to note that overexpression of PHGPX has been reported to block both IL-1 induction of NF-{kappa}B in a human endothelial cell line (Brigelius-Flohe et al., 1997Down) and the induction of apoptosis by the release of cytochrome C, following peroxidation of cardiolipin (Nomura et al., 2000Down), so the role of Fpv064 might not be just that of a lipid antioxidant.

We also noted the presence, in FP9 and FPVUS (between ORFs 179 and 180), of an orthologue (ORF 179.1, which was not reported by Afonso et al., 2000Down) of A14.5L of Vaccinia virus. This small, hydrophobic, intracellular mature virus (IMV) membrane protein is well conserved but non-essential and is implicated in virulence (Betakova et al., 2000Down).

Overall comparison of genome sequences of attenuated FP9 and virulent FPVUS
Comparison of the genome of FP9 (266 145 bp) with that of FPVUS (288 539 bp) revealed just 118 differences. The products of 71 genes were affected (by deletion, insertion, substitution, termination or frame-shift), some by up to four independent mutations. Throughout the paper, differences are described, arbitrarily, as mutations having occurred in FP9 relative to FPVUS, although we recognize that individual mutations might have occurred in lineages leading to either virus since their divergence. The 118 differences thus include 26 deletions (of 1 to 9334 bp) and 15 insertions (of 1 to 108 bp) in FP9 relative to FPVUS. The larger terminal repeat regions in FP9 are not included in these calculations [as Afonso et al. (2000)Down reported FPVUS genomic clones with repeat regions up to 5·8 kbp] nor are the 94 bp terminal extensions (which probably represent the different limits of genomic sequencing). There was a surprisingly low number of single base-pair substitutions, just 77, giving a divergence of less than 0·03 %. Of these 77, 10 were in non-coding regions, 4 caused nonsense mutations, 18 were silent and 45 caused amino acid substitutions (giving a non-synonomous to synonomous ratio, NS : S, of 2·5).

Of the 260 ORFs (of greater than 59 aa) reported for FPVUS, 244 could be observed in FP9 (though ORFs 54, 66, 70, 71, 115, 158, 190, 219 and 222 were severely disrupted) and 189 were identical (Table 1Up). Nineteen ORFs were shorter in FP9 (17 by more than 5 aa) as a result of frame-shift or nonsense mutations and 6 of these ORFs also suffered mis-sense mutations (i.e. aa substitutions). Thirty ORFs in FP9 were affected only by mis-sense mutations (some by multiple such mutations). Five ORFs were longer in FP9 than in FPVUS, as a consequence of deletion (and consequential frame-shift) or insertion mutations. FP9 has an additional ORF, in each ITR, starting 155 bp in from the terminus and translating right up to the end of the determined sequence (i.e. without a stop codon).

The only evidence that homologous recombination was involved in the generation of deletions was that deletion 9 (of 5831 bp between fp9.097 and fp9.098) occurred between 47 bp direct repeats. Deletion 21 (of 27 bp between fp9.215 and fp9.216), occurring between 7 bp direct repeats, might also have involved homologous recombination. Five large deletions, visible by DOTTER analysis (Fig. 1Down), affected multiple genes (Table 2Down).



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 1. DOTTER (Sonnhammer & Durbin, 1994Down) analysis of the complete genomes of FP9 (horizontal axis) and FPVUS (vertical axis). Major deletions can be seen as breaks in the diagonal line. Lines perpendicular to the main diagonal in the top-right and bottom-left corners indicate the ITRs. The blocks in each corner represent the repeat regions within each ITR. Their rectangular nature indicates that the repeat region is longer in the FP9 sequence than in the FPVUS sequence. The short diagonal lines, parallel to the main diagonal and near the centre of the plot, represent the members of the Variola virus strain Bangladesh B22R family (six in FPVUS, five in FP9). Numbers refer to deletions (Table 2Up).

 

View this table:
[in this window]
[in a new window]
 
Table 2. Summary of deletions observed in FP9 relative to FPVUS

Deletions are indicated as the preceding base positions in FP9. Abbreviations: ‘Del’, deleted; ‘term’, terminal; ‘f/s’, frame-shift. Underscore indicates deleted amino acids.

 
Eight of the 15 insertions in FP9 relative to FPVUS (insertions 1, 2, 4, 7, 8, 9, 12 and 14) occurred in intergenic regions. Insertion 1, immediately upstream of the AUG codon of fp9.013 (Table 3Down), affected the crucial -3 position of the Kozak consensus, potentially upregulating translation of the ORF (Kozak, 2002Down). A frame-shift caused by insertion 3 (1 bp) extended Fp9.032 by 143 aa. Based on comparison of Fp9.032 and Fpv032 with similar host proteins, we and others (MacLea et al., 2003Down) believe this to be a clear example where the mutagenic event was not an insertion in FP9 but a deletion in FPVUS (or in one of its precursors following divergence from the European lineage). Similarly, an apparent 1 bp deletion (deletion 3) in FP9 resulted in a 15 aa N-terminal extension to Fp9.011. The extension aligns better with the N-terminus of cellular {alpha}-SNAP (soluble NSF-attachment protein) than does the N-terminus of Fpv011 (Fig. 2Down), indicating that an insertion might have occurred in fpv011, disrupting the encoded N-terminus. Frame-shifts caused by three more insertions (insertions 6, 13 and 15) led to truncation of ORFs in FP9 relative to FPVUS (products of ORFs 104, 207 and 229 being shortened by 70, 16 and 39 aa, respectively).


View this table:
[in this window]
[in a new window]
 
Table 3. Summary of insertions observed in FP9 relative to FPVUS

Insertions are indicated as the preceding base positions in FP9. Abbreviations: ‘term’ – terminal; ‘f/s' – frame-shift.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Pairwise alignments of the N-termini of {alpha}-SNAP-like proteins encoded by FPVUS (Fpv011) and FP9 (Fp9.011) with bovine {alpha}-SNAP (BoSnp). Identical residues are indicated in the consensus lines; ‘.’ indicates discordant residues, ‘+’ indicates similar residues and ‘–’ indicates missing residues.

 
We reasoned that some of the differences observed between virulent FPVUS and attenuated FP9 might represent differences that had arisen between US and European lineages during evolution from a presumed common ancestor, rather than mutations that occurred during tissue culture passage, and concomitant attenuation, to generate FP9. The virulent progenitor of FP9, HP1, had been propagated in embryonated eggs, and then passaged on CEFs (Mayr, 1960Down), progressively improving its ability to replicate on CEFs (the recovered titre increasing from 104·5 to more than 107 ml-1) but losing virulence for chickens. Passage 438 virus (HP1-438), avirulent even for day-old chicks following intravenous inoculation (Mayr & Malicki, 1966Down), was plaque-purified three times at the former Houghton Poultry Research Station (now the Institute for Animal Health) to produce attenuated strain FP9 (HP1-441 Munich FP9). The sequence of HP1 was determined at the equivalent of every position where FP9 differed from the US strain. This allowed us to distinguish differences between US and European lineages from mutations that accumulated during tissue culture passage.

Overall comparison of virulent American and European FPVs
The sequence of HP1 was determined at all the loci where differences between FPVUS and FP9 were observed (Tables 1, 2 and 3UpUpUp, Fig. 3Down and supplementary data at JGV Online (http://vir.sgmjournals.org). At 68 of those 118 loci (58 %), the HP1 sequence differed from that of FPVUS and was identical to that of FP9. Therefore more than half of the differences observed between FPVUS and FP9 represent differences between virulent viruses (FPVUS and HP1) in the two geographical lineages (Tables 1, 2 and 3UpUpUp, Fig. 3Down and supplementary data). These geographical lineage-specific differences accounted for 66 % of the single base substitutions (51 out of 77) and of the insertions (10 out of 15) but only a minority of the deletions (7 out of 26; 27 %).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Summary of mutations between FPVUS, FP9 and HP1. FPVUS, HP1, their hypothetical ancestral progenitor and FP9 are arranged along a horizontal scale that represents increased virulence from right to left. Thin solid arrows indicate known or presumed passage histories. Dashed arrows represent pairwise sequence comparisons, alongside which are summarized the relevant mutations observed between the partners in each pair. Percentages for comparisons of HP1 with FPVUS and FP9 represent percentage for each class of mutation relative to mutations of that class observed between FP9 and FPVUS.

 
Of the differences causing amino acid substitutions in FP9 relative to FPVUS, 28 out of 45 (62 %) were also found in HP1 and so were geographical lineage-specific. Of the silent, single base mutations, 14 out of 18 (78 %) were geographical lineage-specific. The NS : S ratio for geographical lineage-specific differences was therefore 2 (28/14). Of the 10 single base-pair mutations in intergenic regions of FP9, nine were geographical lineage-specific.

Overall comparison of FP9 with FPVUS had indicated that 71 ORFs were mutated in some way. Of those, 25 ORFs had mutations that differentiated the geographical lineages only.

Overall comparison of virulent and attenuated European FPV
At 50 of the 118 loci sequenced in HP1, the HP1 sequence was different from that of FP9 and was identical to that of FPVUS (although in three cases we observed a mixture of FPVUS-like and FP9-like sequences). These differences between HP1 and FP9 represent passage-specific mutations (Tables 1, 2 and 3UpUpUp, Fig. 3Up and supplementary data at JGV Online) which could contribute to tissue culture adaptation and attenuation.

Of the 26 deletions seen to distinguish FP9 from FPVUS, 19 (73 %) also distinguished FP9 from HP1 and thus were passage-specific (with both wild-type and deleted alleles found in HP1 at the sites of deletions 11 and 22). In contrast, only 5 of the 15 insertions (33 %) were passage-specific.

Of the amino acid substitutions found in FP9, relative to FPVUS, 17 out of 45 (38 %) were not found in HP1 and so were passage-specific (whilst cycle sequencing of a PCR product from HP1 revealed the presence of both FPVUS and FP9 alleles at a position equivalent to FP9 nucleotide 159127). Of the silent, single base mutations, 4 out of 18 (22 %) were passage-specific so the NS : S ratio for passage-specific substitutions was 4·25 (17/4). Although all four nonsense mutations had occurred during tissue culture passage, only one out of the ten single base-pair mutations found in intergenic regions of FP9 had been generated during that process.

Overall, this analysis indicated that tissue culture adaptation (and concomitant attenuation) resulted from passage-specific mutations to no more than 46 ORFs (18 % of the 260 ORFs found in FPVUS). This result is based on the assumption that all the geographical lineage-specific differences have been accounted for by comparison of HP1 and FPVUS at all the FPVUS–FP9 divergent loci. For single base substitutions, we feel this is a reasonable assumption. We are aware that it is difficult, from our results, to exclude the possibility that HP1 carries sequences additional to those found in FPVUS but those same sequences would have had to have been deleted faithfully during passage and attenuation of FP9 to create identical loci in FP9 and FPVUS. Although we believe any such event would have been unlikely, it is possible that such additional sequences might have rendered HP1 more virulent than FPVUS. Unfortunately, comparisons of virulence have not been performed. FPVUS DNA is not available to us to enable screening for additional sequences in HP1 and it is difficult to justify sequencing the complete genome of HP1. However, even if additional sequences were present in HP1, even if they were faithfully removed in the passage to FP9 and even if they contributed to additional virulence, we can assume the passage/attenuation changes we observed would account for attenuation of a European virus with virulence characteristics essentially equivalent to those of FPVUS.

Comparison of the severity of lineage-specific and passage-specific mutations
The geographical lineage-specific mutations, which distinguished FPVUS from both European viruses (HP1 and FP9), were generally less disruptive and, therefore, likely to be less dramatic in their phenotypic effect than the passage-specific mutations, which distinguished attenuated FP9 from both virulent viruses (FPVUS and HP1). Thus, the geographical lineage-specific deletions (which constituted only 27 % of the deletions) probably had relatively minor consequences: two were intergenic, one resulted in the N-terminal extension of {alpha}-SNAP-like protein Fp9.011, two resulted in new ORFs at the genomic termini and two had minor effects on the A-type inclusion (ATI) protein-like genes. In contrast, the passage-specific deletions had severe consequences, including complete deletion of 13 genes (Table 2Up). The geographical lineage-specific insertions, which constituted 67 % of the insertions, were also less disruptive (only one out of ten caused a truncating frame-shift) than the passage-specific insertions (where two out of five caused truncating frame-shifts; Table 3Up). All four nonsense (terminating) mutations were passage-specific. Amongst the single base mutations, the NS : S ratio, which was 2·5 when FPVUS was compared to FP9, broke down to 2 for geographical lineage-specific mutations but was 4·25 for passage-specific mutations (Fig. 3Up). This indicates that there has been selection for these coding changes during tissue-culture passage.

Targets of the passage-specific mutations
Of the 46 ORFs affected by passage-specific mutations (18 % of the total genome complement), 12 encoded members of the ankyrin repeat family. As this family consists of 31 members in FPVUS, it appears disproportionately affected (39 %) by passage-specific mutations. However, distribution of the ankyrin repeat genes is non-random (six of them were removed by a single deletion). Of the eight C-type lectin-like family genes in FPVUS, three were disrupted by passage-specific mutations in FP9, although two were duplicate copies in the inverted terminal repeats. Other gene family members affected by passage-specific mutations were: the two duplicate members (out of three) of the Vaccinia virus C4L/C10L-like family (Afonso et al., 2000Down), one out of three members of the G-protein coupled receptor family, one out of five V-type Ig domain genes and one of the three Fowlpox virus EFc family genes (Afonso et al., 2000Down). Two tandem members of the Variola virus strain Bangladesh B22R (B22R) family (with six copies in FPVUS) were affected by the 5·8 kbp deletion between the 47 bp direct repeats but this resulted in formation of a novel chimaeric B22R-like ORF. The three mutations in FP9 that disrupted one of the two ORFs (Binns et al., 1990Down) with mutT (nudix hydrolase) motifs were all passage-specific. Two of the ten members of the Rabbit fibroma virus N1R/Ectromelia virus p28 (N1R/p28) gene family (Afonso et al., 2000Down), implicated in virulence in other poxviruses, were deleted by passage-specific mutations.

Not all of the mutations, however, were to members of gene families. Those single copy genes disrupted or deleted by passage-specific mutations included: ORFs 066, 070 (mouse T10-like), 071 (resembling a conserved DNA/pantothenate metabolism flavoprotein), 104, 158 (photolyase), 160, 190 (A-type inclusion protein), 220 and 221 (Vaccinia virus A47L-like and fpv 229-like). The disruption of ORF 070 is interesting as the murine T10 gene product is specifically expressed at high levels in epithelial cells of the respiratory tract early in embryogenesis (Halford et al., 1993Down). Afonso et al. (2000)Down speculated that the viral homologue might be involved in the tropism of Fowlpox virus to such tissues in the chicken.

Comparison with attenuation in Sheeppox virus and Goatpox virus
Our observation that gene families, especially members of the ankyrin repeat protein family, were disproportionately affected by passage-specific mutations is in accord with the observations of Tulman et al. (2002)Down for a Sheeppox virus vaccine strain, attenuated by 30 cell culture passages. Seventeen (out of 156) sheeppox virus proteins are affected but the only disrupted genes encode two out of the five members of the ankyrin repeat protein family. In the Goatpox virus vaccine (attenuated by 20 cell culture passages), only six proteins were affected but these included all three members of the kelch-like protein family, one encoded by the only gene disrupted in the vaccine virus (no kelch-like proteins are encoded by Fowlpox virus).

Conclusions
Our data reinforce the initial indication, obtained from analysis of sheeppox virus and goatpox virus vaccines (Tulman et al., 2002Down), that attenuation of poxviruses by tissue culture passage could be driven by the loss of members of multigene families, especially of those encoding ankyrin repeat proteins. This was somewhat surprising as it might have been predicted that loss of immunomodulators, which are generally non-essential in tissue culture, would be the mechanism of attenuation. A similar situation has, however, been observed in the related African swine fever virus (Neilan et al., 2002Down). This observation provides a rationale for strategies to attenuate poxviruses by targeting members of the gene families for disruption. However, it says nothing yet about the mechanisms involved. Ankyrin repeat proteins have been implicated in host-range in poxviruses (Perkus et al., 1990Down) and in immunomodulation in African swine fever virus (Powell et al., 1996Down; Miskin et al., 1998Down). There is, however, a vast range of host proteins containing ankyrin repeats, which are frequently involved in protein–protein interactions (Mosavi et al., 2002Down). Thus, if the deleted ankyrin repeat proteins are involved in attenuation, elucidation of the mechanism(s) of attenuation will require identification of the relevant cellular (or viral) ligands. The possible role of more subtle mutations to essential poxvirus proteins should not be ignored, as such mutations have been found in the attenuated Sheeppox virus and Goatpox virus (Tulman et al., 2002Down) and now Fowlpox virus. It would clearly be helpful to see if independently passaged and attenuated strains of Fowlpox virus acquire mutations in any of the genes found to be mutated in FP9.

ACKNOWLEDGEMENTS
The authors wish to acknowledge the support of the BBSRC and of the EC (BIO4-CT96-0473).

NOTE ADDED IN PROOF
Brunetti et al. (2003)Down recently reported the presence in FPVUS of ORF FPV194.5, which encodes a 38 aa conserved orthologue of MVC MC137L and Myxoma virus M119L, as well as the newly identified Yaba monkey tumour virus YMTV1205.L and Vaccinia virus A30.5L. An identical ORF (fp9.194.5) is also present in FP9 [coordinates 216 943–217 059 (c)].


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Afonso, C. L., Tulman, E. R., Lu, Z., Zsak, L., Kutish, G. F. & Rock, D. L. (2000). The genome of fowlpox virus. J Virol 74, 3815–3831.[Abstract/Free Full Text]

Afonso, C. L., Tulman, E. R., Lu, Z., Zsak, L., Rock, D. L. & Kutish, G. F. (2001). The genome of turkey herpesvirus. J Virol 75, 971–978.[Abstract/Free Full Text]

Aguado, B., Selmes, I. P. & Smith, G. L. (1992). Nucleotide sequence of 21·8 kbp of variola major virus strain Harvey and comparison with vaccinia virus. J Gen Virol 73, 2887–2902.[Abstract/Free Full Text]

Alcami, A. & Smith, G. L. (1992). A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection. Cell 71, 153–167.[CrossRef][Medline]

Ali, S. A., McLean, C. S., Boursnell, M. E. & 10 other authors (2000). Preclinical evaluation of "whole" cell vaccines for prophylaxis and therapy using a disabled infectious single cycle-herpes simplex virus vector to transduce cytokine genes. Cancer Res 60, 1663–1670.[Abstract/Free Full Text]

Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365–396.[CrossRef][Medline]

Bayliss, C. D., Peters, R. W., Cook, J. K., Reece, R. L., Howes, K., Binns, M. M. & Boursnell, M. E. (1991). A recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease virus induces protection against mortality caused by the virus. Arch Virol 120, 193–205.[CrossRef][Medline]

Betakova, T., Wolffe, E. J. & Moss, B. (2000). The vaccinia virus A14·5L gene encodes a hydrophobic 53-amino-acid virion membrane protein that enhances virulence in mice and is conserved among vertebrate poxviruses. J Virol 74, 4085–4092.[Abstract/Free Full Text]

Binns, M. M., Britton, B. S., Mason, C. & Boursnell, M. E. G. (1990). Analysis of the fowlpox virus genome region corresponding to the vaccinia virus D6 to A1 region: location of, and variation in, non-essential genes in poxviruses. J Gen Virol 71, 2873–2881.[Abstract/Free Full Text]

Binns, M. M., Boursnell, M. E. & Skinner, M. A. (1992). Gene translocations in poxviruses: the fowlpox virus thymidine kinase gene is flanked by 15 bp direct repeats and occupies the locus which in vaccinia virus is occupied by the ribonucleotide reductase large subunit gene. Virus Res 24, 161–172.[CrossRef][Medline]

Bonfield, J. K., Smith, K. & Staden, R. (1995). A new DNA sequence assembly program. Nucleic Acids Res 23, 4992–4999.[Abstract/Free Full Text]

Boulanger, D., Green, P., Smith, T., Czerny, C. P. & Skinner, M. A. (1998). The 131-amino-acid repeat region of the essential 39-kilodalton core protein of fowlpox virus FP9, equivalent to vaccinia virus A4L protein, is nonessential and highly immunogenic. J Virol 72, 170–179.[Abstract/Free Full Text]

Boulanger, D., Smith, T. & Skinner, M. A. (2000). Morphogenesis and release of fowlpox virus. J Gen Virol 81, 675–687.[Abstract/Free Full Text]

Boulanger, D., Green, P., Jones, B., Henriquet, G., Hunt, L. G., Laidlaw, S. M., Monaghan, P. & Skinner, M. A. (2002). Identification and characterization of three immunodominant structural proteins of fowlpox virus. J Virol 76, 9844–9855.[Abstract/Free Full Text]

Boursnell, M. E., Green, P. F., Samson, A. C., Campbell, J. I., Deuter, A., Peters, R. W., Millar, N. S., Emmerson, P. T. & Binns, M. M. (1990a). A recombinant fowlpox virus expressing the hemagglutinin-neuraminidase gene of Newcastle disease virus (NDV) protects chickens against challenge by NDV. Virology 178, 297–300.[CrossRef][Medline]

Boursnell, M. E., Green, P. F., Campbell, J. I. & 7 other authors (1990b). Insertion of the fusion gene from Newcastle disease virus into a non-essential region in the terminal repeats of fowlpox virus and demonstration of protective immunity induced by the recombinant. J Gen Virol 71, 621–628.[Abstract/Free Full Text]

Brigelius-Flohe, R., Aumann, K. D., Blocker, H. & 9 other authors (1994). Phospholipid-hydroperoxide glutathione peroxidase. Genomic DNA, cDNA, and deduced amino acid sequence. J Biol Chem 269, 7342–7348.[Abstract/Free Full Text]

Brigelius-Flohe, R., Friedrichs, B., Maurer, S., Schultz, M. & Streicher, R. (1997). Interleukin-1-induced nuclear factor kappa B activation is inhibited by overexpression of phospholipid hydroperoxide glutathione peroxidase in a human endothelial cell line. Biochem J 328, 199–203.

Britton, P., Green, P., Kottier, S., Mawditt, K. L., Penzes, Z., Cavanagh, D. & Skinner, M. A. (1996). Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. J Gen Virol 77, 963–967.[Abstract/Free Full Text]

Brunetti, C. R., Amano, H., Ueda, Y., Qin, J., Miyamura, T., Suzuki, T., Li, X., Barrett, J. W. & McFadden, G. (2003). Complete genomic sequence and comparative analysis of the tumorigenic poxvirus Yaba monkey tumor virus. J Virol 77, 13335–13347.[Abstract/Free Full Text]

Campbell, J. I. A., Binns, M. M., Tomley, F. M. & Boursnell, M. E. G. (1989). Tandem repeated sequences within the terminal region of the fowlpox virus genome. J Gen Virol 70, 145–154.[Abstract/Free Full Text]

Garcia, M., Narang, N., Reed, W. M. & Fadly, A. M. (2003). Molecular characterization of reticuloendotheliosis virus insertions in the genome of field and vaccine strains of fowl poxvirus. Avian Dis 47, 343–354.[CrossRef][Medline]

Gomi, Y., Sunamachi, H., Mori, Y., Nagaike, K., Takahashi, M. & Yamanishi, K. (2002). Comparison of the complete DNA sequences of the Oka varicella vaccine and its parental virus. J Virol 76, 11447–11459.[Abstract/Free Full Text]

Halford, S., Wilson, D. I., Daw, S. C. & other authors (1993). Isolation of a gene expressed during early embryogenesis from the region of 22q11 commonly deleted in DiGeorge syndrome. Hum Mol Genet 2, 1577–1582.[Abstract/Free Full Text]

Hertig, C., Coupar, B. E., Gould, A. R. & Boyle, D. B. (1997). Field and vaccine strains of fowlpox virus carry integrated sequences from the avian retrovirus, reticuloendotheliosis virus. Virology 235, 367–376.[CrossRef][Medline]

Izumiya, Y., Jang, H. K., Ono, M. & Mikami, T. (2001). A complete genomic DNA sequence of Marek's disease virus type 2, strain HPRS24. Curr Top Microbiol Immunol 255, 191–221.[Medline]

Kim, T. J. & Tripathy, D. N. (2001). Reticuloendotheliosis virus integration in the fowl poxvirus genome: not a recent event. Avian Dis 45, 663–669.[CrossRef][Medline]

Kit, S. (1990). Genetically engineered vaccines for control of Aujeszky's disease (pseudorabies). Vaccine 8, 420–424.[CrossRef][Medline]

Kozak, M. (2002). Pushing the limits of the scanning mechanism for initiation of translation. Gene 299, 1–34.[CrossRef][Medline]

Laidlaw, S. M., Anwar, M. A., Thomas, W., Green, P., Shaw, K. & Skinner, M. A. (1998). Fowlpox virus encodes nonessential homologs of cellular alpha-SNAP, PC- 1, and an orphan human homolog of a secreted nematode protein. J Virol 72, 6742–6751.[Abstract/Free Full Text]

Lee, L. F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H. J. & Witter, R. L. (2000). The complete unique long sequence and the overall genomic organization of the GA strain of Marek's disease virus. Proc Natl Acad Sci U S A 97, 6091–6096.[Abstract/Free Full Text]

MacLea, K. S., Krieser, R. J. & Eastman, A. (2003). A family history of deoxyribonuclease II: surprises from Trichinella spiralis and Burkholderia pseudomallei. Gene 305, 1–12.[CrossRef][Medline]

Massung, R. F., Liu, L. I., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201, 215–240.[CrossRef][Medline]

Mayr, A. (1960). Verhalten von Hühner-, Tauben- und Kanarienpockenviren im Küken nach intravenöser Impfung. Zentbl Bakteriol Parasitenkd Infektkrankh Hyg. 179, 149–159 (in German).

Mayr, A. & Malicki, K. (1966). Attenuierung von virulentem Hühnerpockenvirus in Zellkulturen und Eigenschaften des attenuierten Virus. Zentbl Vetmed Reihe B 13, 1–13 (in German).

Mayr, A., Stickl, H., Muller, H. K., Danner, K. & Singer, H. (1978). [The smallpox vaccination strain MVA: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defence mechanism (author's transl.)]. Zentbl Bakteriol B 167, 375–390.

Merchlinsky, M. & Moss, B. (1989). Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA. J Virol 63, 4354–4361.[Abstract/Free Full Text]

Mettenleiter, T. C., Klupp, B. G., Weiland, F. & Visser, N. (1994). Characterization of a quadruple glycoprotein-deleted pseudorabies virus mutant for use as a biologically safe live virus vaccine. J Gen Virol 75, 1723–1733.[Abstract/Free Full Text]

Miskin, J. E., Abrams, C. C., Goatley, L. C. & Dixon, L. K. (1998). A viral mechanism for inhibition of the cellular phosphatase calcineurin. Science 281, 562–565.[Abstract/Free Full Text]

Mockett, B., Binns, M. M., Boursnell, M. E. G. & Skinner, M. A. (1992). Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization. J Gen Virol 73, 2661–2668.[Abstract/Free Full Text]

Moore, K. M., Davis, J. R., Sato, T. & Yasuda, A. (2000). Reticuloendotheliosis virus (REV) long terminal repeats incorporated in the genomes of commercial fowl poxvirus vaccines and pigeon poxviruses without indication of the presence of infectious REV. Avian Dis 44, 827–841.[CrossRef][Medline]

Mosavi, L. K., Minor, D. L., Jr & Peng, Z. Y. (2002). Consensus-derived structural determinants of the ankyrin repeat motif. Proc Natl Acad Sci U S A 99, 16029–16034.[Abstract/Free Full Text]

Neilan, J. G., Zsak, L., Lu, Z., Kutish, G. F., Afonso, C. L. & Rock, D. L. (2002). Novel swine virulence determinant in the left variable region of the African swine fever virus genome. J Virol 76, 3095–3104.[Abstract/Free Full Text]

Nomura, K., Imai, H., Koumura, T., Kobayashi, T. & Nakagawa, Y. (2000). Mitochondrial phospholipid hydroperoxide glutathione peroxidase inhibits the release of cytochrome c from mitochondria by suppressing the peroxidation of cardiolipin in hypoglycaemia-induced apoptosis. Biochem J 351, 183–193.[CrossRef][Medline]

Novick, D., Kim, S. H., Fantuzzi, G., Reznikov, L. L., Dinarello, C. A. & Rubinstein, M. (1999). Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity 10, 127–136.[CrossRef][Medline]

Perkus, M. E., Goebel, S. J., Davis, S. W., Johnson, G. P., Limbach, K., Norton, E. K. & Paoletti, E. (1990). Vaccinia virus host range genes. Virology 179, 276–286.[CrossRef][Medline]

Powell, P. P., Dixon, L. K. & Parkhouse, R. M. (1996). An IkappaB homolog encoded by African swine fever virus provides a novel mechanism for downregulation of proinflammatory cytokine responses in host macrophages. J Virol 70, 8527–8533.[Abstract]

Puehler, F., Schwarz, H., Waidner, B., Kalinowski, J., Kaspers, B., Bereswill, S. & Staeheli, P. (2003). An interferon-gamma-binding protein of novel structure encoded by the fowlpox virus. J Biol Chem 278, 6905–6911.[Abstract/Free Full Text]

Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M. A. & Barrell, B. (2000). Artemis: sequence visualization and annotation. Bioinformatics 16, 944–945.[Abstract/Free Full Text]

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 74, 5463–5467.[Abstract/Free Full Text]

Singh, P., Schnitzlein, W. M. & Tripathy, D. N. (2003). Reticuloendotheliosis virus sequences within the genomes of field strains of fowlpox virus display variability. J Virol 77, 5855–5862.[Abstract/Free Full Text]

Skinner, M. A. & Laidlaw, S. M. (1999). Investigation of DNA virus genome structure. In DNA Viruses – A Practical Approach, pp. 15–46. Edited by A. J. Cann. Oxford: Oxford University Press.

Smith, V. P., Bryant, N. A. & Alcami, A. (2000). Ectromelia, vaccinia and cowpox viruses encode secreted interleukin-18- binding proteins. J Gen Virol 81, 1223–1230.[Abstract/Free Full Text]

Sonnhammer, E. L. & Durbin, R. (1994). A workbench for large-scale sequence homology analysis. Comput Appl Biosci 10, 301–307.[Abstract/Free Full Text]

Symons, J. A., Alcami, A. & Smith, G. L. (1995). Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity. Cell 81, 551–560.[CrossRef][Medline]

Tadese, T. & Reed, W. M. (2003). Detection of specific reticuloendotheliosis virus sequence and protein from REV-integrated fowlpox virus strains. J Virol Methods 110, 99–104.[CrossRef][Medline]

Tartaglia, J., Perkus, M. E., Taylor, J. & 9 other authors (1992). NYVAC: a highly attenuated strain of vaccinia virus. Virology 188, 217–232.[CrossRef][Medline]

Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Rock, D. L. & Kutish, G. F. (2000). The genome of a very virulent Marek's disease virus. J Virol 74, 7980–7988.[Abstract/Free Full Text]

Tulman, E. R., Afonso, C. L., Lu, Z. & 7 other authors (2002). The genomes of sheeppox and goatpox viruses. J Virol 76, 6054–6061.[Abstract/Free Full Text]

Xiang, Y. & Moss, B. (1999a). IL-18 binding and inhibition of interferon gamma induction by human poxvirus-encoded proteins. Proc Natl Acad Sci U S A 96, 11537–11542.[Abstract/Free Full Text]

Xiang, Y. & Moss, B. (1999b). Identification of human and mouse homologs of the MC51L-53L-54L family of secreted glycoproteins encoded by the Molluscum contagiosum poxvirus. Virology 257, 297–302.[CrossRef][Medline]

Xiang, Y. & Moss, B. (2001a). Correspondence of the functional epitopes of poxvirus and human interleukin-18-binding proteins. J Virol 75, 9947–9954.[Abstract/Free Full Text]

Xiang, Y. & Moss, B. (2001b). Determination of the functional epitopes of human interleukin-18-binding protein by site-directed mutagenesis. J Biol Chem 276, 17380–17386.[Abstract/Free Full Text]

Zhang, K., Kniazeva, M., Han, M. & 17 other authors (2001). A 5-bp deletion in ELOVL4 is associated with two related forms of autosomal dominant macular dystrophy. Nat Genet 27, 89–93.[Medline]

Received 12 August 2003; accepted 20 October 2003.


This article has been cited by other articles:


Home page
J. Virol.Home page
M. Morales, M. A. Ramirez, M. J. Cano, M. Parraga, J. Castilla, L. I. Perez-Ordoyo, J. M. Torres, and J. Barcena
Genome Comparison of a Nonpathogenic Myxoma Virus Field Strain with Its Ancestor, the Virulent Lausanne Strain
J. Virol., March 1, 2009; 83(5): 2397 - 2403.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
E. Guzman, G. Taylor, B. Charleston, M. A. Skinner, and S. A. Ellis
An MHC-restricted CD8+ T-cell response is induced in cattle by foot-and-mouth disease virus (FMDV) infection and also following vaccination with inactivated FMDV
J. Gen. Virol., March 1, 2008; 89(3): 667 - 675.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Parrish and B. Moss
Characterization of a Second Vaccinia Virus mRNA-Decapping Enzyme Conserved in Poxviruses
J. Virol., December 1, 2007; 81(23): 12973 - 12978.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. A. Jarmin, R. Manvell, R. E. Gough, S. M. Laidlaw, and M. A. Skinner
Retention of 1.2 kbp of 'novel' genomic sequence in two European field isolates and some vaccine strains of Fowlpox virus extends open reading frame fpv241
J. Gen. Virol., December 1, 2006; 87(12): 3545 - 3549.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Jarmin, R. Manvell, R. E. Gough, S. M. Laidlaw, and M. A. Skinner
Avipoxvirus phylogenetics: identification of a PCR length polymorphism that discriminates between the two major clades.
J. Gen. Virol., August 1, 2006; 87(Pt 8): 2191 - 2201.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. G. Cottingham, A. van Maurik, M. Zago, A. T. Newton, R. J. Anderson, M. K. Howard, J. Schneider, and M. A. Skinner
Different Levels of Immunogenicity of Two Strains of Fowlpox Virus as Recombinant Vaccine Vectors Eliciting T-Cell Responses in Heterologous Prime-Boost Vaccination Strategies.
Clin. Vaccine Immunol., July 1, 2006; 13(7): 747 - 757.
[Abstract] [Full Text] [PDF]


Home page
J Wildl DisHome page
T. Thiel, N. K. Whiteman, A. Tirape, M. I. Baquero, V. Cedeno, T. Walsh, G. J. Uzcategui, and P. G. Parker
CHARACTERIZATION OF CANARYPOX-LIKE VIRUSES INFECTING ENDEMIC BIRDS IN THE GALAPAGOS ISLANDS
J. Wildl. Dis., April 1, 2005; 41(2): 342 - 353.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. P. Webster, S. Dunachie, J. M. Vuola, T. Berthoud, S. Keating, S. M. Laidlaw, S. J. McConkey, I. Poulton, L. Andrews, R. F. Andersen, et al.
Enhanced T cell-mediated protection against malaria in human challenges by using the recombinant poxviruses FP9 and modified vaccinia virus Ankara
PNAS, March 29, 2005; 102(13): 4836 - 4841.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Vuola, S. Keating, D. P. Webster, T. Berthoud, S. Dunachie, S. C. Gilbert, and A. V. S. Hill
Differential Immunogenicity of Various Heterologous Prime-Boost Vaccine Regimens Using DNA and Viral Vectors in Healthy Volunteers
J. Immunol., January 1, 2005; 174(1): 449 - 455.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laidlaw, S. M.
Right arrow Articles by Skinner, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laidlaw, S. M.
Right arrow Articles by Skinner, M. A.
Agricola
Right arrow Articles by Laidlaw, S. M.
Right arrow Articles by Skinner, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS