|
|
||||||||
Short Communication |
Pathogens and Immunity, CNRS, Université Montpellier II, Case 080, 34095 Montpellier Cedex 5, France
Correspondence
Joannes Sri Widada
widada{at}univ-montp2.fr
| ABSTRACT |
|---|
|
|
|---|
GenBank Accession number: AY247793
| MAIN TEXT |
|---|
|
|
|---|
In this paper we describe the characteristics of the XSV genome and we hypothesize that XSV constitutes a new species of satellite virus.
The genome of XSV consists of a linear single-stranded RNA (ssRNA) of about 0·80·9 kb (Qian et al., 2003
). In order to determine its nucleotide sequence, the XSV genome was reverse-transcribed and double-stranded (ds)DNA was synthesized. Virus particles were purified from tissue extracts of WTD-infected animals by centrifugation through sucrose gradients, then through CsCl gradients, and finally concentrated by centrifugation as previously described (Romestand & Bonami, 2003
). This technique also allowed the separation of XSV from its associated virus, MrNV. Viral RNA was extracted by a combination of phenol/chloroform treatment followed by precipitation with ethanol. Various approaches were used to reverse-transcribe the viral RNA. In the first method, cDNA was synthesized by reverse transcription using a hexanucleotide mix (Roche) and dsDNA was synthesized using the cDNA Synthesis System (Roche). Double-stranded DNA with a single 3'-dA overhang was obtained by Taq DNA polymerase (Promega) treatment at 72 °C for 10 min. DNA was cloned into the pCR2.1-TOPO plasmid using a TOPO TA cloning kit and transfected into Escherichia coli TOP10 (Invitrogen). Plasmids were purified using a High Pure Plasmid Isolation kit (Roche) and were analysed by restriction enzymes and sequencing (MilleGen). In order to clone the 3'-end of the genome, reverse transcription was performed with an oligo(dT) anchor primer [GACCACGCGTATCGATGTCGACT(16)V], using a 5'/3' RACE kit (Roche), on the assumption that a poly(A) tail would be present. DsDNA was synthesized by PCR, using a PCR anchor primer (GACCACGCGTATCGATGTCGAC) and a primer deduced from sequenced parts of the XSV genome. Cloning and sequencing were carried out as above. In order to walk towards the 5'-end of the virus genome, reverse transcription was performed using a primer deduced from sequenced parts of the genome. cDNA was then dA-tailed by terminal transferase and dATP. DsDNA was obtained by PCR, using an oligo(dT) anchor primer and a primer deduced from sequenced parts. Cloning and sequencing were carried out as described above.
The virus genome sequencing results showed that it was composed of 796 nucleotides, and a short poly(A) tail of 1520 nucleotides at the 3'-end (GenBank acc. no. AY247793) (Fig. 1
a). There was good agreement between the sequencing result and the genome length established by electrophoresis on an agarose gel (Qian et al., 2003
). The presence of a short poly(A) tail was established, because the XSV genome could be reverse-transcribed using an oligo(dT) anchor primer. The occurrence of a poly(A) tail was also suggested by a polyadenylation signal, AAUAAA, found 195 nucleotides downstream of the second stop codon and six nucleotides upstream of the poly(A). The presence of a poly(A) tail indicated that the genome was in a sense orientation. This orientation was further confirmed, because the XSV genome could be reverse-transcribed using a primer complementary to the messenger orientation (see below). Finally, most probably the 3'-end is not terminated by a free 3'-OH, since ligation of this end with a 5'-phosphate oligonucleotide failed to take place.
|
The present work clearly indicated that the XSV genome is a monocistronic messenger in the sense orientation, although its translation may give rise to two related polypeptides. This posed the question, which enzymes are required for virus development in host cells? Most of them may come from the host cell, such as those involved in the translational machinery, and some from its associated MrNV. In fact, the genome of MrNV encodes an RNA-dependent RNA polymerase (GenBank acc. no. AY222839) that XSV may use for its own development. Several virus associations have been described in plant systems. They involve a small size virus (satellite virus) and a larger virus (helper virus). One of the most studied co-operations concerns the association of panicum mosaic satellite virus (PMSV) and panicum mosaic virus (PMV) (Qiu & Scholthof, 2000
, 2001
). It has been demonstrated that the smaller partner (satellite virus) needs the larger one for its replication, but that it is the satellite virus that induces severe chlorosis on proso millet plant (Qiu & Scholthof, 2001
). XSV, 15 nm in diameter, is associated with MrNV, 25 nm in diameter, in WTD of M. rosenbergii. Further studies are required to understand their interactions and to establish whether the severity of WTD is determined by the smaller partner.
In order to search for an affiliation of XSV to known virus families, the deduced amino acid sequence was submitted to known database comparisons using the Blast2 interface (Altschul et al., 1997
). The sequences were aligned using an algorithm established by Corpet (1988)
. The sequence comparison did not enable us to establish any significant homology with known virus genomes sequenced so far. These viruses include MrNV, with which XSV is associated in WTD. The absence of sequence affiliation to MrNV was also established because probes specific to MrNV failed to hybridize with the XSV genome (Qian et al., 2003
). Nevertheless, the characteristics of XSV meet the criteria of satellite viruses, i.e. very small size (subvirus agent); lacking the genes encoding enzymes required for replication and therefore replication dependence on its helper virus; genome distinct from that of the helper virus; and a single gene encoding the structural polypeptide (Zhang et al., 1991
). If our hypothesis is confirmed by further work, then MrNV may play the helper virus role and, therefore, XSV would be the first satellite associated with a nodavirus. Except for the chronic bee-paralysis associated satellite virus-like (CBPSV) (Overton et al., 1982
), all satellite viruses are plant viruses (Mayo et al., 2000
). XSV is more closely affiliated to plant satellite viruses than to CBPSV, as the genome of CBPSV is composed of three species of RNA about 1 kb in size. In all the reported plant satellite viruses, the genome is, as for the XSV genome, one linear sense ssRNA with a size range from around 700 to 1200 bases (Mayo et al., 2000
). Sequence comparison of the deduced CP-17 of XSV with known structural protein sequences of satellite viruses indicated that, at the sequence level, CP-17 was not affiliated to any of them (Fig. 2
). Sequence comparison also indicated that, apart from their physico-chemical characteristics, satellite viruses do not exhibit significant sequence homology between their structural proteins. The phylogenetic tree, resulting from sequence comparison, shows that satellite viruses are remotely related (data not shown), as also previously reported (Ban et al., 1995
; Zhang et al., 1991
). Most probably, each satellitehelper virus association is specific to that couple. Nevertheless, satellite viruses are not a diminutive form of their helper. Finally, computer analysis indicated that the N-terminal domain of the capsid protein exhibits a recognised common motif. It contains hydrophilic amino acids and a positively charged arginine. This feature is characteristic of a surface zone in a protein. It may also constitute an interaction domain through a saline bridge allowing, for example, the formation of the viral capsid. In addition, there are doublets, RR or RK, that are sites for proteases. Therefore, the structural protein may be synthesized as a precursor that is then cleaved to a mature and functional protein. Shared structural features of the N-terminal domain may suggest a common function.
|
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arcier, J. M., Herman, F., Lightner, D. V., Redman, R. M., Mari, J. & Bonami, J. R. (1999). A viral disease associated with mortalities in hatchery-reared postlarvae of the giant freshwater prawn Macrobrachium rosenbergii. Dis Aquat Org 38, 177181.
Ban, N., Larson, S. B. & McPherson, A. (1995). Structural comparison of the plant satellite viruses. Virology 214, 571583.[CrossRef][Medline]
Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16, 1088110890.
Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15, 81258148.
Mayo, M. A., Fritsch, C., Leibowitz, M. J., Palukaitis, P., Scholthof, K.-B. G., Simons, A. E. & Taliansky, M. (2000). Satellite viruses. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses, pp. 10261032. Edited by M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Malonoff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego: Academic Press.
Overton, H. A., Buck, K. W., Nailey, L. & Ball, B. V. (1982). Relationship between the RNA components of chronic bee-paralysis virus and those of chronic bee-paralysis virus associate. J Gen Virol 63, 171179.
Qian, D., Shi, Z., Zhang, S., Cao, Z., Liu, W., Li, L., Xie, Y., Cambournac, I. & Bonami, J. R. (2003). Extra small virus-like particles (XSV) and nodavirus associated with whitish muscle disease in the giant fresh water prawn Macrobrachium rosenbergii. J Fish Dis 26, 521527.[CrossRef][Medline]
Qiu, W. & Scholthof, K. B. G. (2000). In vitro- and in vivo-generated defective RNAs of satellite panicum mosaic virus define cis-acting RNA elements required for replication and movement. J Virol 74, 22472254.
Qiu, W. & Scholthof, K. B. G. (2001). Genetic identification of multiple biological roles associated with the capsid protein of satellite panicum moisaic virus. Mol Plant Microbe Interact 14, 2130.[Medline]
Romestand, B. & Bonami, J. R. (2003). A sandwich enzyme linked immunosorbed assay (S. ELISA) for detection of MrNV in the giant freshwater prawn Macrobrachium rosenbergii. J Fish Dis 26, 7175.[CrossRef][Medline]
Tung, C. W., Wang, C. S. & Chen, S. N. (1999). Histological and electron microscopy study on Macrobrachium muscle virus (MMV) infection in the giant freshwater prawn, Macrobrachium rosenbergii (de Man), cultured in Taiwan. J Fish Dis 22, 15.
Zhang, L., Zitter, T. A. & Palukaitis, P. (1991). Helper virus-dependent replication, nucleotide sequence and genome organization of the satellite virus of maize white line mosaic virus. Virology 180, 467473.[CrossRef][Medline]
Received 4 November 2003;
accepted 20 November 2003.
This article has been cited by other articles:
![]() |
R. T. Omarov, D. Qi, and K.-B. G. Scholthof The Capsid Protein of Satellite Panicum Mosaic Virus Contributes to Systemic Invasion and Interacts with Its Helper Virus J. Virol., August 1, 2005; 79(15): 9756 - 9764. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |