|
|
||||||||
University of Edinburgh, Centre for Infectious Diseases, R(D)SVS, Summerhall, Edinburgh EH9 1QH, UK
Correspondence
Simon J. Talbot
stalbot{at}ed.ac.uk
| ABSTRACT |
|---|
|
|
|---|
76) has been identified. This transcript has the addition of a poly(A) tail at nt 3264 of orf73 resulting in an in-frame stop codon (TAA) effectively truncating LANA by 76 aa (
8 kDa). Examination of the coding region revealed the presence of a non-canonical polyadenylation signal (AGTAAA) 17 nt upstream of the poly(A) tail. The protein expressed from this transcript is representative of the faster migration of the LANA doublet bands observed by SDS-PAGE and Western blot. Mutation of the poly(A) signal from AGTAAA to TGTACA produced a protein that co-migrated with the larger LANA isoform. A C-terminal LANA-
76 EGFP fusion protein localized to the nucleus but did not co-localize with endogenous LANA in BCP-1 cells, or heterochromatin in HEK293 cells. Using an electrophoretic mobility shift assay (EMSA), the authors were able to show that LANA-
76 does not bind to the KSHV terminal repeat motif known to interact with LANA. These data provide evidence for the presence of an isoform of LANA that may perform alternative functions in KSHV-infected cells. | INTRODUCTION |
|---|
|
|
|---|
LANA, identified as a 226234 kDa doublet by SDS-PAGE (Gao et al., 1996a
, 1999
), is a versatile protein with multiple functions. It tethers viral episomes to host chromatin during mitosis, allowing delivery of viral progeny to all daughter cells (Ballestas et al., 1999
). LANA binds to two short motifs within the terminal repeat of the KSHV genome through a region in its C-terminal domain (Ballestas & Kaye, 2001
; Garber et al., 2001
, 2002
). Interaction with host cell mitotic chromosomes is mediated through a 32 aa domain at the N terminus (Piolot et al., 2001
). It is thought that LANA acts as a bridge between chromosomal and viral episomal DNA.
Similar to the oncogenes of other DNA tumour viruses, LANA binds to and interferes with the functions of the tumour suppressors p53 and retinoblastoma protein (Friborg et al., 1999
; Radkov et al., 2000
), and transforms primary rat embryo cells with Hras (Radkov et al., 2000
). Recently, it was reported that LANA also exploits the Wnt-
-catenin pathway to activate genes that can promote cell growth (Fujimuro et al., 2003
).
Through a domain in its C terminus, LANA activates and/or represses certain cellular and viral promoters, probably through interaction with cellular transcription factors such as CREB, CBP and Sp1 (An et al., 2002
; Krithivas et al., 2000
; Lim et al., 2000
; Radkov et al., 2000
). A family of nuclear factors typified by RING3 has also been shown to interact with the C terminus of LANA resulting in the phosphorylation of serine and threonine residues between aa 951 and 1107 of LANA (Mattsson et al., 2002
; Platt et al., 1999
). The functional significance of this phosphorylation is not yet understood.
This report describes the identification of an isoform of LANA truncated by 76 aa at the C terminus. We have investigated the DNA binding and subcellular localization of this protein in PEL cells.
| METHODS |
|---|
|
|
|---|
Plasmids.
The C-terminal coding region of LANA (nt 28053488) and LANA-
76 (nucleotides 28053258) were PCR amplified with the primers GATCAGATCTCCCATAATCTTGCACGGGTC and GCATTCTAGATTATGTCATTTCCTGTGGAGAGTC (LANA) or GATCAGATCTCCCATAATCTTGCACGGGTC and GCATTCTAGATTAGGACACGGGGCCTGCCT (LANA-
76). These PCR products were cloned into the BglII/XbaI restriction sites of the plasmid pEGFP-C1 (Clontech). All inserts were fully sequenced and found to contain no mutations.
The poly(A) site identified in the LANA coding sequence was mutated from AGTAAA to TGTACA using a Quick-change mutagenesis kit (Stratagene) and oligonucleotides CTTCCAGTTTGGAGGTGTACAGGCAGGCCCCGTGTC and GACACGGGGCCTGCCTGTACACCTCCAAACTGGAAG. The mutated sequence introduced a BsrGI restriction site into the LANA sequence.
Transfection of cells.
HEK293 (5x104 cells per well) or BCP-1 cells (1x105 cells per well) were seeded in 24-well trays and incubated overnight. The cells were then transfected with 0·5 µg of DNA and 1·5 µl Transfast transfection reagent per well according to the manufacturer's instructions (Promega).
Immunofluorescence analysis of transfected cells.
Transfected cells were fixed with 4 % (w/v) paraformaldehyde for 20 min at room temperature and air-dried onto microscope slides. BCP-1 cells were stained with the LANA-specific monoclonal antibody LN53 (ABI) and goat anti-rat antibody conjugated with TRITC (Sigma). LN53 recognizes the epitope EQEQE present in the central repeat region of LANA (Kellam et al., 1999
). Fluorescence images were obtained with a confocal microscope.
Northern blots.
Poly(A)+ RNA was isolated (Micro-FastTrack mRNA isolation system; Invitrogen) from 1x107 BCP-1, BC-3 or BJAB cells. The mRNA (equivalent to 5x106 cells per lane) was separated on formaldehyde/agarose gels as described (Sambrook & Russell, 2001
) and transferred onto Genescreen-plus membrane by capillary blotting according to the manufacturer's instructions (NEN). The filters were baked at 80 °C for 2 h and then hybridized to radioactive probes. Filters were prehybridized for 20 min and hybridized for 60 min at 60 °C in QuickHyb solution (Stratagene). Blots were washed twice for 15 min at 22 °C in 2x SSC, 0·1 % (w/v) SDS and once for 30 min at 60 °C in 0·1x SSC, 0·1 % SDS, before exposure to X-ray film (X-OMAT-AR; Kodak) at 80 °C with an intensifying screen.
RNA protection assay (RPA).
Poly(A)+ RNA was isolated (Micro-FastTrack mRNA isolation system) from BCP-1 and HEK293 cells and hybridized to an oligonucleotide complementary to the 3' terminus of LANA-
76 mRNA with a 20 nt 5' T sequence (T20AGGACACGGGGCCTGCCTTT). The oligonucleotide was labelled at the 3' end using terminal transferase (NEB) and [
-32P]dideoxy-ATP (Amersham), according to the manufacturer's instructions (NEB). The use of dideoxy-ATP ensured that only one residue was added to the end of each oligonucleotide probe. The RNA-protection assay was performed using the Multi-NPA kit from Ambion.
Electrophoretic mobility shift assay (EMSA).
LANA-EGFP, LANA-
76-EGFP fusion proteins and EGFP were prepared using the TNT in vitro transcriptiontranslation system (Promega). The correct expression of the proteins was confirmed by Western blot analysis using an anti-GFP antibody (Clontech). The complementary oligonucleotides TR-1 (GATCTCCCGCCCGGGCATGGGGCC) and TR-2 (GATCGGCCCCATGCCCGGGCGGGA) were annealed and the ends filled using Klenow polymerase and dGTP, dATP, dTTP and [
-32P]CTP. Approximately 0·510 µl of the protein preparation was mixed with 50 000 c.p.m. 32P-labelled double-stranded TR probe in 1x reaction buffer [20 mM Tris pH 7·5, 10 % (v/v) glycerol, 50 mM KCl, 0·1 mM dithiothreitol, 10 mM MgCl2, 1 mM EDTA, 20 µg poly(dIdC) ml1] as described previously (Ballestas & Kaye, 2001
). Reactions were resolved by electrophoresis through 5 % (w/v) non-denaturing polyacrylamide gels in 1x TBE. The gels were fixed (acetic acid/methanol) and dried before exposure to X-ray film (X-OMAT-AR) at 80 °C with an intensifying screen.
| RESULTS |
|---|
|
|
|---|
8 kDa). Examination of the coding region revealed the presence of a non-canonical polyadenylation signal (AGTAAA) 17 nt upstream of the poly(A) tail. Expression of this truncated form of LANA would result in a protein approximately 8 kDa smaller than full-length LANA. LANA is known to migrate as a high molecular mass doublet (226234 kDa) (Gao et al., 1996a
|
-32P]dideoxy ATP, ensuring that only one nucleotide was added to the end of the probe. The data in Fig. 2(b)
|
225 kDa). The RD4-encoded protein is therefore designated LANA-
76 (deletion of the terminal 76 aa of LANA). Mutation of the poly(A) signal resulted in the expression of a single protein co-migrating with the larger LANA isoform (
235 kDa) observed in BCP-1 cells.
|
76
76 were cloned into the plasmid pEGFP-C1 and transfected into BCP-1 or HEK293 cells. As shown in Fig. 4
76-EGFP fusion protein localized to the nucleus in both BCP-1 and HEK293 cells, it did not co-localize with endogenous LANA or nuclear heterochromatin (Fig. 4b, e
|
76 does not bind to the KSHV terminal repeats
76 also interacted with this TR sequence. The data in Fig. 5
76 or EGFP bound specifically to the TR probe. The specificity of the LANA-TR interaction was confirmed by competing-out the specific shifted band with excess unlabelled TR probe (Fig. 5c
|
| DISCUSSION |
|---|
|
|
|---|
76). This transcript has the addition of a poly(A) tail at nt 3264 of orf73 resulting in an in-frame stop codon (TAA) effectively truncating LANA by 76 aa (
8 kDa). Expression of LANA-
76 in HEK293 cells produced a protein co-migrating with the lower of the LANA isoforms when analysed by SDS-PAGE and Western blot. Examination of the coding region of LANA-
76 revealed the presence of a non-canonical polyadenylation signal (AGTAAA) 17 nt upstream of the poly(A) tail. Mutating this sequence from AGTAAA to TGTACA abrogated the function of the poly(A) signal, resulting in the expression of a protein co-migrating with the larger of the LANA isoforms. This poly(A) signal sequence has been shown to occur at a frequency of between 5 and 8 % for human genes (Caron et al., 2001
The C terminus of LANA has been shown to interact with a number of cellular proteins (p53, Rb, RING3) (Friborg et al., 1999
; Platt et al., 1999
; Radkov et al., 2000
) as well as being involved in the transcriptional regulation of cellular and viral genes mediated through transcription factors such as CREB, CBP and Sp1 (An et al., 2002
; Krithivas et al., 2000
; Lim et al., 2000
; Radkov et al., 2000
). The C terminus of LANA also mediates dimerization (Schwam et al., 2000
) and is responsible for binding to two short sequence motifs within the terminal repeats (TR) of the KSHV genome (Garber et al., 2002
). Although localized in the nucleus, the LANA-
76 protein does not co-localize with LANA in KSHV-infected cells, suggesting that it has lost the domain responsible for dimerization and/or the domain required for TR binding. Using an EMSA, LANA-
76 failed to bind to the KSHV TR motif (Ballestas & Kaye, 2001
). Viejo-Borbolla et al. (2003)
have identified a short domain in the C terminus of LANA (aa 11291143) that plays a role in heterochromatin binding, probably by modulating the heterochromatin-binding domain identified at the N terminus (aa 522) (Piolot et al., 2001
). These data are consistent with the nuclear localization of LANA-
76 (lacks aa 10861162), which also fails to associate with either heterochromatin or full-length LANA.
Although it does not bind to the KSHV TR or associate with full-length LANA, LANA-
76 still possesses the domains responsible for interacting with p53, Rb and RING3. The interaction of RING3 has been shown to result in the phosphorylation of serine and threonine residues in the C terminus of LANA (Platt et al., 1999
). There are three predicted serine and one predicted threonine phosphorylation sites in the terminal 76 aa of LANA (Fig. 1a
), but these fall outside the domain phosphorylated through interaction with RING3 (aa 9511107) (Platt et al., 1999
). The role of LANA-
76 and whether it interacts with these proteins in KSHV-infected cells still remains to be determined.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ballestas, M. E. & Kaye, K. M. (2001). Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J Virol 75, 32503258.
Ballestas, M. E., Chatis, P. A. & Kaye, K. M. (1999). Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284, 641644.
Boshoff, C. & Weiss, R. A. (1998). Kaposi's sarcoma-associated herpesvirus. Adv Cancer Res 75, 5786.[Medline]
Boshoff, C., Gao, S. J., Healy, L. E. & 10 other authors (1998). Establishing a KSHV+ cell line (BCP-1) from peripheral blood and characterizing its growth in Nod/SCID mice. Blood 91, 16711679.
Caron, H., van Schaik, B., van der Mee, M. & 10 other authors (2001). The human transcriptome map: clustering of highly expressed genes in chromosomal domains. Science 291, 12891292.
Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M. (1995a). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 332, 11861191.
Cesarman, E., Moore, P. S., Rao, P. H., Inghirami, G., Knowles, D. M. & Chang, Y. (1995b). In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 86, 27082714.
Cesarman, E., Nador, R. G., Aozasa, K., Delsol, G., Said, J. W. & Knowles, D. M. (1996). Kaposi's sarcoma-associated herpesvirus in non-AIDS related lymphomas occurring in body cavities. Am J Pathol 149, 5357.[Abstract]
Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266, 18651869.
Dittmer, D. P. (2003). Transcription profile of Kaposi's sarcoma-associated herpesvirus in primary Kaposi's sarcoma lesions as determined by real-time PCR arrays. Cancer Res 63, 20102015.
Friborg, J., Jr, Kong, W., Hottiger, M. O. & Nabel, G. J. (1999). p53 inhibition by the LANA protein of KSHV protects against cell death. Nature 402, 889894.[Medline]
Fujimuro, M., Wu, F. Y., ApRhys, C., Kajumbula, H., Young, D. B., Hayward, G. S. & Hayward, S. D. (2003). A novel viral mechanism for dysregulation of beta-catenin in Kaposi's sarcoma-associated herpesvirus latency. Nat Med 9, 300306.[CrossRef][Medline]
Gao, S. J., Kingsley, L., Hoover, D. R. & 8 other authors (1996a). Seroconversion to antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi's sarcoma. N Engl J Med 335, 233241.
Gao, S. J., Kingsley, L., Li, M. & 10 other authors (1996b). KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat Med 2, 925928.[CrossRef][Medline]
Gao, S. J., Zhang, Y. J., Deng, J. H., Rabkin, C. S., Flore, O. & Jenson, H. B. (1999). Molecular polymorphism of Kaposi's sarcoma-associated herpesvirus (Human herpesvirus 8) latent nuclear antigen: evidence for a large repertoire of viral genotypes and dual infection with different viral genotypes. J Infect Dis 180, 14661476.[CrossRef][Medline]
Garber, A. C., Shu, M. A., Hu, J. & Renne, R. (2001). DNA binding and modulation of gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J Virol 75, 78827892.
Garber, A. C., Hu, J. & Renne, R. (2002). Latency-associated nuclear antigen (LANA) cooperatively binds to two sites within the terminal repeat, and both sites contribute to the ability of LANA to suppress transcription and to facilitate DNA replication. J Biol Chem 277, 2740127411.
Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36, 5974.
Husain, S. M., Usherwood, E. J., Dyson, H., Coleclough, C., Coppola, M. A., Woodland, D. L., Blackman, M. A., Stewart, J. P. & Sample, J. T. (1999). Murine gammaherpesvirus M2 gene is latency-associated and its protein a target for CD8(+) T lymphocytes. Proc Natl Acad Sci U S A 96, 75087513.
Kedes, D. H., Operskalski, E., Busch, M., Kohn, R., Flood, J. & Ganem, D. (1996). The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat Med 2, 918924.[CrossRef][Medline]
Kedes, D. H., Lagunoff, M., Renne, R. & Ganem, D. (1997). Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposi's sarcoma-associated herpesvirus. J Clin Invest 100, 26062610.[Medline]
Kellam, P., Boshoff, C., Whitby, D., Matthews, S., Weiss, R. A. & Talbot, S. J. (1997). Identification of a major latent nuclear antigen, LNA-1, in the human herpesvirus 8 genome. J Hum Virol 1, 1929.[Medline]
Kellam, P., Bourboulia, D., Dupin, N., Shotton, C., Fisher, C., Talbot, S., Boshoff, C. & Weiss, R. A. (1999). Characterization of monoclonal antibodies raised against the latent nuclear antigen of human herpesvirus 8. J Virol 73, 51495155.
Krithivas, A., Young, D. B., Liao, G., Greene, D. & Hayward, S. D. (2000). Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepressor complex and negatively regulates EpsteinBarr virus gene expression in dually infected PEL cells. J Virol 74, 96379645.
Lennette, E. T., Blackbourn, D. J. & Levy, J. A. (1996). Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients. Lancet 348, 858861.[CrossRef][Medline]
Lim, C., Sohn, H., Gwack, Y. & Choe, J. (2000). Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8) binds ATF4/CREB2 and inhibits its transcriptional activation activity. J Gen Virol 81, 26452652.
Mattsson, K., Kiss, C., Platt, G. M., Simpson, G. R., Kashuba, E., Klein, G., Schulz, T. F. & Szekely, L. (2002). Latent nuclear antigen of Kaposi's sarcoma herpesvirus/human herpesvirus-8 induces and relocates RING3 to nuclear heterochromatin regions. J Gen Virol 83, 179188.
Piolot, T., Tramier, M., Coppey, M., Nicolas, J. C. & Marechal, V. (2001). Close but distinct regions of human herpesvirus 8 latency-associated nuclear antigen 1 are responsible for nuclear targeting and binding to human mitotic chromosomes. J Virol 75, 39483959.
Platt, G. M., Simpson, G. R., Mittnacht, S. & Schulz, T. F. (1999). Latent nuclear antigen of Kaposi's sarcoma-associated herpesvirus interacts with RING3, a homolog of the Drosophila female sterile homeotic (fsh) gene. J Virol 73, 97899795.
Radkov, S. A., Kellam, P. & Boshoff, C. (2000). The latent nuclear antigen of Kaposi sarcoma-associated herpesvirus targets the retinoblastoma-E2F pathway and with the oncogene Hras transforms primary rat cells. Nat Med 6, 11211127.[CrossRef][Medline]
Rainbow, L., Platt, G. M., Simpson, G. R., Sarid, R., Gao, S. J., Stoiber, H., Herrington, C. S., Moore, P. S. & Schulz, T. F. (1997). The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. J Virol 71, 59155921.[Abstract]
Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D. & Ganem, D. (1996). Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med 2, 342346.[CrossRef][Medline]
Russo, J. J., Bohenzky, R. A., Chien, M. C. & 8 other authors (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc Natl Acad Sci U S A 93, 1486214867.
Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schwam, D. R., Luciano, R. L., Mahajan, S. S., Wong, L. & Wilson, A. C. (2000). Carboxy terminus of human herpesvirus 8 latency-associated nuclear antigen mediates dimerization, transcriptional repression, and targeting to nuclear bodies. J Virol 74, 85328540.
Soulier, J., Grollet, L., Oksenhendler, E. & 8 other authors (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86, 12761280.
Talbot, S. J., Weiss, R. A., Kellam, P. & Boshoff, C. (1999). Transcriptional analysis of human herpesvirus-8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line. Virology 257, 8494.[CrossRef][Medline]
Viejo-Borbolla, A., Kati, E., Sheldon, J. A., Nathan, K., Mattsson, K., Szekely, L. & Schulz, T. F. (2003). A domain in the C-terminal region of latency-associated nuclear antigen 1 of Kaposi's sarcoma-associated herpesvirus affects transcriptional activation and binding to nuclear heterochromatin. J Virol 77, 70937100.
Wakeling, M. N., Roy, D. J., Nash, A. A. & Stewart, J. P. (2001). Characterization of the murine gammaherpesvirus 68 ORF74 product: a novel oncogenic G protein-coupled receptor. J Gen Virol 82, 11871197.
Received 12 November 2003;
accepted 18 February 2004.
This article has been cited by other articles:
![]() |
B. Kelley-Clarke, M. E. Ballestas, V. Srinivasan, A. J. Barbera, T. Komatsu, T.-A. Harris, M. Kazanjian, and K. M. Kaye Determination of Kaposi's Sarcoma-Associated Herpesvirus C-Terminal Latency-Associated Nuclear Antigen Residues Mediating Chromosome Association and DNA Binding J. Virol., April 15, 2007; 81(8): 4348 - 4356. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Adang, C. H. Parsons, and D. H. Kedes Asynchronous Progression through the Lytic Cascade and Variations in Intracellular Viral Loads Revealed by High-Throughput Single-Cell Analysis of Kaposi's Sarcoma-Associated Herpesvirus Infection. J. Virol., October 1, 2006; 80(20): 10073 - 10082. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. You, V. Srinivasan, G. V. Denis, W. J. Harrington Jr., M. E. Ballestas, K. M. Kaye, and P. M. Howley Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Bromodomain Protein Brd4 on Host Mitotic Chromosomes. J. Virol., September 1, 2006; 80(18): 8909 - 8919. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |