J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 85 (2004), 2155-2166; DOI 10.1099/vir.0.79784-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malik, P.
Right arrow Articles by Clements, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malik, P.
Right arrow Articles by Clements, J. B.
Agricola
Right arrow Articles by Malik, P.
Right arrow Articles by Clements, J. B.
© 2004 Society for General Microbiology

Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins

Poonam Malik1, David J. Blackbourn1, Ming Fei Cheng2, Gary S. Hayward2 and J. Barklie Clements1

1 Division of Virology, Institute of Biomedical and Life Sciences, University of Glasgow, Church Street, Glasgow G11 5JR, UK
2 Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins School of Medicine, Baltimore, MD, USA

Correspondence
J. Barklie Clements
b.clements{at}vir.gla.ac.uk


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Kaposi's sarcoma (KS)-associated herpesvirus (KSHV) proteins ORF57 (also known as MTA) and ORF50 (also known as RTA) act post-transcriptionally and transcriptionally to regulate viral lytic gene expression and synergistically activate certain early and late KSHV promoters. When ORF57 and ORF50 were co-expressed, they co-operatively stimulated expression from the promoter of the immediate-early ORF50 gene itself. Co-immunoprecipitations with extracts of KSHV-infected cells showed that ORF57 and ORF50 proteins were present in the same complex. Using the pull-down assay with extracts of KSHV-infected cells, ORF50 protein was shown to interact with a glutathione S-transferase–ORF57 fusion protein. A chromatin immunoprecipitation assay showed that ORF50 promoter sequences were preferentially associated with immunoprecipitated chromatin using both anti-ORF50 and anti-ORF57 antibodies consistent with both an in vivo physical association between ORF57 and ORF50 and a potential role for ORF57 at the transcriptional level. This is the first demonstration of an interaction between these two lytic regulatory proteins in a gammaherpesvirus. Expression of ORF50 protein is sufficient to induce lytic replication in latently infected cells and may determine viral host range, spread and KS pathogenesis in vivo. A new insight into the co-ordinated activities of these two key regulatory proteins is provided in which upregulation of the ORF50 promoter with augmentation of ORF50 activity by ORF57 protein, and vice versa, would facilitate the cascade of lytic viral gene expression, thereby breaking latency. A functional and physical interaction between these two gammaherpesvirus regulatory protein counterparts could be a general feature of the herpesviruses.


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Kaposi's sarcoma (KS)-associated herpesvirus (KSHV; also known as human herpesvirus 8), classified as a gammaherpesvirus and in the same subfamily as Epstein–Barr virus (EBV) and herpesvirus saimiri (HVS), is the most recently identified human herpesvirus (Chang et al., 1994Down). KSHV causes KS and perhaps a rare form of primary effusion lymphoma (PEL), especially in individuals infected with human immunodeficiency virus (reviewed by Schulz, 1998Down; Boshoff & Chang, 2001Down; Moore & Chang, 2001Down). Overwhelming molecular epidemiological evidence supports the association of KSHV with KS (reviewed by Sarid et al., 1999Down; Schulz, 1999Down; Boshoff & Weiss, 2001Down; Dourmishev et al., 2003Down). KSHV can establish latent and lytic replication cycles, and examination of KS biopsy material shows virus localized to the tumorous endothelial cells (Boshoff et al., 1995Down), the majority of which are latently infected (Staskus et al., 1997Down).

Currently there is no efficient cell culture system for KSHV; the only viable experimental system uses naturally infected B cell lines, such as BCBL-1 (Renne et al., 1996Down), generated by culture of PELs that contain the genome of KSHV. The majority of PEL cells are latently infected with KSHV, with a low level of spontaneous virus reactivation. Addition of the phorbol ester 12-O-tetradecanoyl phorbol-13-acetate (TPA) to BCBL-1 cells efficiently induces the lytic cycle, producing virions (Renne et al., 1996Down). ORF50 (also known as RTA), a replication and transcription activator, and ORF57 (also known as MTA), immediate-early proteins, the earliest KSHV regulatory genes to be induced and expressed (Lukac et al., 1999Down; Paulose-Murphy et al., 2001Down), are both essential for lytic virus replication (Sun et al., 1999Down; Zhu et al., 1999Down).

ORF57 protein exhibits nucleocytoplasmic shuttling (Bello et al., 1999Down) and, like its EBV MTA (BMLF-1) and HVS ORF57 homologues (Lieberman et al., 1986Down; Nicholas et al., 1988Down; Kenney et al., 1989Down; Whitehouse et al., 1998Down), has a post-transcriptional mode of action (Gupta et al., 2000Down; Kirshner et al., 2000Down). An ORF57 counterpart is present in every herpesvirus sequenced, reflecting the importance of this signature viral protein. ORF50 protein is analogous to gammaherpesvirus transactivators HVS ORF50 and EBV RTA (BRLF-1) (Hardwick et al., 1988Down; Whitehouse et al., 1997Down; Lukac et al., 1999Down). Expression of ORF50 alone is necessary and sufficient for the switch from latent to lytic KSHV replication (Lukac et al., 1998Down; Sun et al., 1998Down; Gradoville et al., 2000Down) in cultured cells (Liang & Ganem, 2003Down) and may determine viral host range and spread in vivo (Bechtel et al., 2003Down). ORF50 protein exhibits sequence-specific DNA binding (Lukac et al., 2001Down; Song et al., 2001Down) and positively regulates its own promoter (Seaman et al., 1999Down; Deng et al., 2000Down) via an octamer element and Oct-1 protein (Sakakibara et al., 2001Down). Overexpression of ORF57 and ORF50 proteins together, driven by a human cytomegalovirus (HCMV) promoter, synergistically enhanced expression from several viral lytic gene promoters; however, at that time no physical association was demonstrated between the two proteins (Kirshner et al., 2000Down).

We have shown that simultaneous expression of ORF57 and ORF50 proteins stimulates reporter gene expression from the immediate-early ORF50 gene promoter itself by a further 13-fold above the level obtained with ORF50 protein alone. We have also shown that ORF57 and ORF50 proteins are present together in the same complex in extracts of KSHV-infected BCBL-1 cells, and a physical interaction was also demonstrated using a pull-down assay with a glutathione S-transferase (GST)–ORF57 fusion protein. A chromatin immunoprecipitation (ChIP) assay showed that ORF50 promoter sequences were preferentially associated with immunoprecipitated chromatin using both anti-ORF50 and anti-ORF57 antibodies (Abs). Thus, the co-ordinated activities of these two KSHV regulatory proteins will promote the cascade of lytic viral gene expression, overcoming the inefficiency of spontaneous lytic virus reactivation.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Plasmids.
Plasmid pGST-ORF57, expressing an N-terminal GST fused with the full-length (FL) ORF57 protein (aa 1–455) driven by a tac promoter, was constructed by cloning ORF57 cDNA into the EcoRI sites of pGEX-5X-3 vector (Pharmacia). ORF57 sequences were excised from pKS4 (a kind gift of L. Bello), which contained ORF57 full-length cDNA cloned into the EcoRI site of pEGFP-C1 (Clontech). Plasmid pGBKT7-ORF57 (FL) containing full-length ORF57 (aa 1–455), driven by a T7 promoter was used for in vitro translation of ORF57 protein. ORF57 cDNA sequences were excised as XhoI and PstI fragments from pKS4 and cloned into the SalI and PstI sites of pGBKT7 (Clontech), resulting in loss of both XhoI and SalI sites from pGBKT7-ORF57 (FL). Plasmids pcDNA4-gORF57 (FL) and pcDNA4-cORF57 (FL) contained full-length genomic and cDNA sequences, respectively, driven by an HCMV promoter encoding ORF57 protein (aa 1–455). ORF57 genomic and cDNA sequences were PCR amplified with primers containing BamHI and XhoI sites (shown in bold) (PM1 F, 5'-GCGGGATCCCATGGTACAAGCAATGATAGACATG; PM2 R, 5'-GCGCGCTCGAGTTAAGAAAGTGGATAAAAGAA) using pKS3 (Bello et al., 1999Down) and pKS4 as templates, respectively, and cloned into pcDNA4/HisMax B (Invitrogen). Deletion mutants of full-length ORF57 (see Fig. 1bDown) were generated by PCR using primers containing BamHI and XhoI sites (ORF57N1 F, 5' TCACCAGGATCCATGGTACAAGCAATG; ORF57N17 F, 5'-AAGGGCGGATCCATGGACTCTGTGTCC; ORF57N181 F, 5'-CTCCCTGGATCCATGATAATTGACGGTGAG; ORF57N329 F, 5'-CCAGATTTGGATCCATGCATCTTTCCTGCG; ORF57N387 F, 5'-ACTATCGGATCCATGCAGAGTCGC; ORF57N215 R, 5'-GTCCGTCTCGAGCTACGGGACGTGGG; ORF57N328 R, 5'-AACGCACTCGAGCTAAAGTAATCTAAATC; ORF57N455 R, 5'-CGGTTTGGCTCGAGTTAAGAAAGTGG) with pKS4 as the template, and amplified fragments were cloned into BamHI/XhoI sites of pcDNA4/HisMax C. They encoded ORF57 aa 17–455, 1–215, 181–328, 329–455 and 387–455. The reporter plasmid containing the ORF50 promoter is referred to as pORF50/500-luc since it contains 500 bp of 5'-untranslated region (UTR) sequence directly upstream from the ORF50 translation initiation codon (Lukac et al., 1998Down; Sun et al., 1998Down; Seaman et al., 1999Down) of KSHV (BCBL-1), driving a firefly luciferase reporter gene in the pGL3-Basic vector (Promega). ORF50 promoter sequences were amplified by PCR with primers containing HindIII/XhoI sites (ORF50-500 F, 5'-GCGCCTCGAGTTGCCTGGCATTTTGCCC; ORF50-500 R, 5'-GCGCAAGCTTTTTTGTGGCTGCCTGGACAG) to create pORF50/500-luc. The identities of all the recombinant constructs were confirmed by DNA sequencing. Plasmid pKS3 (GFP-gORF57) contained ORF57 genomic DNA cloned into pEGFP-C1 (Clontech) and expressed an N-terminal enhanced green fluorescent protein (GFP)–ORF57 fusion (Bello et al., 1999Down). Plasmid pcDNA3-gORF50, encoding FL ORF50 genomic DNA driven by the HCMV promoter, kindly provided by D. Ganem, was as described previously (Lukac et al., 1998Down, 1999Down). Plasmid pSEW-R21 expressing a GST fusion with ORF50 FL (aa 1–691) has been described previously (Wang et al., 2003aDown). Plasmids pRLSV-40, pGL3-Basic, pGL3-Control (all Promega), pISRE-luc (Stratagene), pcDNA3.1 and pcDNA4 (both Invitrogen) were used in transfection assays.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Expression from an ORF50 promoter reporter construct is simulated by ORF57 expression. (a) The effect of ORF57 on the basal transcription activity of the region encompassing 500 bp upstream of the ORF50 translation initiation codon and cloned into a luciferase promoter reporter vector as pORF50/500-luc. Human 293 cells were co-transfected with the pORF50/500-luc reporter plasmid and increasing amounts of GFP-gORF57 DNA. Decreasing amounts of empty vector (without insert) were also included in each sample so that the total amount of vector backbone remained the same. Final luciferase values were based on normalized luciferase activity (see Methods), and fold activation of firefly luciferase activity was calculated relative to the firefly luciferase activity measured when cells were transfected with the pORF50/500-luc reporter plus empty pEGFP-C1 DNA in parallel and assigned an activity of 1. (b) Schematic representation of ORF57 (FL) protein aa 1–455 and the various ORF57 deletion mutants used. (c) The effect of ORF57 protein deletion mutants on the basal transcription activity of ORF50 promoter in the pORF50/500-luc reporter. Human 293 cells were co-transfected with reporter plasmid pORF50/500-luc and 600 ng pcDNA4-ORF57 plasmids expressing ORF57 (FL) or its deletion mutants (as indicated). The level of induction of normalized firefly luciferase activity obtained with ORF57 (FL) was calculated relative to the normalized firefly luciferase activity of cells transfected with the pORF50/500-luc reporter plus empty pcDNA4 vector in parallel and assigned an activity of 100, and relative values for ORF57 deletion mutants were calculated and plotted. Error bars in (a) and (c) show the standard deviations of the data derived from three separate transfection experiments with luciferase assays, each performed in duplicate.

 
Cell culture and antibodies.
BCBL-1 cells (a KSHV-positive, EBV-negative, PEL line) (Renne et al., 1996Down) were grown as described previously (Cunningham et al., 2003Down). Human embryonic kidney 293 epithelial cells grown in DMEM (Gibco-BRL) supplemented with 10 % fetal calf serum, 1 % L-glutamine, 1 % non-essential amino acids and 1 % penicillin/streptomycin at 37 °C and 5 % CO2 were used for DNA transfections. Synthetic peptides representing the KSHV ORF57 segments between aa 40 and 54, 182 and 195 and 441 and 455 were used to raise anti-ORF57 Abs in rabbits (termed 718, GH and 721, respectively). The anti-ORF50 Ab raised against a synthetic peptide corresponding to KSHV ORF50 aa 527–539 has been described previously (Wang et al., 2003aDown).

Chemical induction of the KSHV lytic cycle and preparation of cell extracts.
BCBL-1 cells (0·2x106 cells ml–1) were treated with TPA (20 ng ml–1) (Renne et al., 1996Down) for 72 h or left untreated. Cell extracts prepared as described by Wadd et al. (1999)Down in 800 µl lysis buffer (50 mM Tris/HCl, pH 7·5, 100 mM NaCl, 1 mM EDTA, 0·1 % NP-40, 0·5 mM PMSF) containing protease inhibitor cocktail (Roche) were passed five times through a 26-gauge needle. RNase treatment was with 10 U (ONE; Promega) at 37 °C for 20 min.

Recombinant protein expression, in vitro GST pull-down assays and Western immunoblotting.
GST–ORF50 (FL) fusion protein was prepared as described previously (Wang et al., 2003aDown). GST–ORF57 fusion protein was prepared as described for GST–hnRNP K (Wadd et al., 1999Down) with modifications: Escherichia coli BL21 cells (500 ml) were treated with 1·0 mM IPTG for 16 h at 28 °C and resuspended in 5 ml modified NETN lysis buffer (20 mM Tris/HCl, pH 8·0, 150 mM NaCl, 1 mM EDTA, 0·1 % NP-40, 10 % w/v glycerol, 5 mM {beta}-mercaptoethanol) with 100 µg lysozyme ml–1 and sonicated on ice. Triton X-100 was added to 2 % (v/v), extracts were kept at 4 °C for 30 min and the GST–ORF57 fusion protein was purified on glutathione–Sepharose 4B beads. GST pull-down assays performed as described previously (Wadd et al., 1999Down; Koffa et al., 2001Down) used untreated or TPA-treated BCBL-1 extracts (200 µg protein) or 10 µl each [35S]methionine-labelled ORF57 (FL), ORF57 deletion mutants and luciferase (Promega) proteins, synthesized in vitro using the TNT T7 Quick Coupled transcription/translation system (Promega) according to the manufacturer's instructions. Bound proteins were resolved by SDS-PAGE and visualized either by Western blotting (Wadd et al., 1999Down) using anti-ORF57 (GH) Ab diluted 1 : 2500, with the ECL detection system (Amersham Pharmacia Biotech) or by autoradiography.

In vitro co-immunoprecipitation assays.
For immunoprecipitations with [35S]methionine-labelled ORF57 and luciferase proteins synthesized in vitro, 10 µl [35S]methionine-labelled in vitro-translated protein was incubated with 6 µl rabbit anti-ORF57 (GH) Ab in 200 µl in vitro immunoprecipitation buffer (50 mM Tris/HCl, pH 8·0, 100 mM NaCl, 1 mM EDTA, 2 mM EGTA, 0·1 % NP-40, 1 % BSA, 0·5 mM PMSF) and protease inhibitor cocktail (Roche) for 1 h at 4 °C. Then, 75 µl of a 50 % slurry in immunoprecipitation buffer of protein A–protein G (50 : 50 ratio) Sepharose beads (Amersham Pharmacia) was added to the mixture and incubated for 1 h at 4 °C. The beads were washed four times with cold immunoprecipitation buffer at 15 min intervals, resuspended and boiled in 2x SDS gel loading buffer, and bound proteins were resolved by SDS-PAGE and visualized by autoradiography.

In vivo co-immunoprecipitation assays.
BCBL-1 cell extracts (200 µg protein) were pre-cleared with 5 µl rabbit pre-immune serum and 100 µl of a 50 % slurry of protein A–protein G (50 : 50) Sepharose beads for 1 h at 4 °C. After pre-clearing, 3 µl each of 718, GH and 721 ORF57 Abs, 5 µl anti-ORF50 Ab or pre-immune rabbit serum was added to pre-cleared cell extracts in 300 µl immunoprecipitation buffer (10 mM Tris/HCl, pH 8·0, 100 mM NaCl, 5 % glycerol, 1 mM EDTA, 2 mM EGTA, 0·1 % NP-40, 1 % BSA, 0·5 mM PMSF) with protease inhibitor cocktail (Roche), and immunoprecipitations were performed as described previously (Koffa et al., 2001Down). Immunoprecipitated proteins were resolved by SDS-PAGE and visualized by Western blotting (Wadd et al., 1999Down) using anti-ORF50 Ab diluted 1 : 3000, with the ECL detection system (Amersham Pharmacia Biotech).

ORF50 promoter-driven luciferase assay.
Human 293 cells (6x105), a cell line useful for KSHV propagation from KS biopsy specimens (Foreman et al., 1997Down) and infectious virus production, following induction by overexpression of ORF50 from KSHV-infected cells (Bechtel et al., 2003Down), were transfected using Polyfect (Qiagen) following the manufacturer's protocol. Transfections used 250 ng pORF50/500-luc promoter DNA, 10 ng pRL-SV40 DNA (expressing Renilla luciferase), specified amounts of GFP-gORF57 and pcDNA4-gORF57 (or pcDNA-ORF57 deletion mutants) DNAs with or without pcDNA3-gORF50 DNA. The final amount of DNA in each transfection was kept constant with empty pcDNA3/pcDNA4 or pEGFP-C1 vector DNAs. Control experiments were performed with the heterologous promoter containing the interferon stimulatory response element driving a luciferase gene (pISRE-luc, 250 ng DNA), and recombinant IFN-{alpha} was added at 200 U ml–1 at 5 h post-transfection. Transfected cells were harvested 48 h after transfection and frozen at –70 °C for 2 h. Luciferase activity of transfected cell extracts was measured using the Dual Luciferase Reporter assay kit (Promega). All firefly luciferase data were normalized with respect to Renilla luciferase activity expressed from a separate, constitutively active plasmid that was co-transfected with the firefly luciferase reporter plasmid. This normalization compensated for differences in transfection efficiencies between replicate cultures.

Chromatin immunoprecipitation assay.
BCBL-1 cells were treated with TPA for 48 h to induce the KSHV lytic cycle before harvesting. Chromatin extracts, cross-linking, sonication, immunoprecipitation, agarose bead elution and protein removal were carried out with a ChIP assay kit (Upstate Biotechnology) based on the manufacturer's protocol with slight modifications as described previously (Wang et al., 2004Down). DNA recovered from immunoprecipitates with anti-ORF50 or anti-ORF57 (GH) polyclonal Abs or a no-Ab control was used as a template for PCR amplifications. Primers LGH4354 (5'-GAACTACTCGAGCTGTGCCCTCCAGCTCTCAC-3') and LGH4355 (5'-GGACGTAAGCTTACAGTATTCTCACAACAGAC-3'), specific for a 261 bp region in the KSHV ORF50 promoter from –241 to +20, were used to detect the ORF50 promoter region. Primers LGH5297 (5'-CGTGTTCAACGACCACGGACTTCAGGTGCG-3') and LGH5298 (5'-CTGGGTTTCCTCGCGCGATGCTTTTCTCTG-3'), specific for KSHV ORF64 coding region (aa 1329–1425), were used as a negative control to detect a non-promoter region. The PCR products were analysed by electrophoresis on a 2 % agarose gel. Quantification of the PCR products was conducted with a MultiImage light cabinet (Alpha-Innotech Corp.) and the accompanying FluorChem (version 1.02) software.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Expression of ORF57 protein increases activity from the ORF50 promoter
The contribution of ORF57 protein alone to the transcriptional activity of the sequences upstream of the KSHV ORF50 gene, containing the putative promoter, was assessed in a functional assay. This analysis allowed examination of ORF57 effects on the ORF50 promoter independent of any possible effects on the ORF50 RNA sequences. We had a family of putative ORF50 promoter constructs encompassing various lengths upstream from the ORF50 translation initiation codon (Lukac et al., 1998Down; Sun et al., 1998Down; Seaman et al., 1999Down) up to 3000 bp. These putative ORF50 promoter elements were cloned into a luciferase reporter vector (pGL3-Basic; Promega). One of these (pORF50/250-luc) containing a 250 bp upstream region has been used to assay the effects of inflammatory cytokines on the transcriptional activity of the ORF50 promoter (Milligan et al., 2004Down). In the present study, a construct incorporating 500 bp of the ORF50 upstream sequence driving the firefly luciferase gene (pORF50/500-luc) was used, which had promoter activity. This pORF50/500-luc construct activated luciferase expression 4-fold in 293 cells transfected with pORF50/500-luc DNA compared with control vector lacking KSHV sequences (pGL3-Basic) and was responsive to TPA or sodium butyrate, which are inducers of KSHV lytic replication. The ORF57 expression plasmid (GFP-gORF57) was co-transfected into 293 cells with the ORF50 promoter reporter (pORF50/500-luc). Normalized luciferase activity from the ORF50 promoter increased with increasing amounts of ORF57 (Fig. 1Upa). At approximately 600 ng GFP-gORF57 DNA, luciferase activity from the ORF50 promoter reporter reached a plateau of 7·8-fold activation (Fig. 1aUp). Similar levels of luciferase induction were obtained by co-transfecting the pORF50/500-luc reporter with pcDNA4-ORF57 (FL) DNA (data not shown).

To identify the regions of ORF57 protein involved in stimulation of luciferase activity from the ORF50 promoter, pcDNA4-ORF57 DNA expressing full-length ORF57 or various deletion mutant proteins (Fig. 1bUp) were co-transfected with the pORF50/500-luc reporter construct (Fig. 1cUp). Compared with the level obtained with full-length ORF57 protein, the ORF57 N-terminal (aa 1–215) and middle region (aa 181–328) mutants showed low levels of luciferase activity (Fig. 1cUp). By contrast, a luciferase value of 108 % was obtained with a mutant expressing ORF57 aa 329–455 (Fig. 1cUp). The activation was reduced to 65 % with ORF57 aa 387–455 (Fig. 1cUp). Thus, residues at the ORF57 protein C terminus are important for the activation of luciferase expression.

Simultaneous expression of ORF57 and ORF50 proteins co-operatively stimulates ORF50-mediated promoter activity
During lytic KHSV replication, ORF57 is not expressed in isolation; rather it is produced with other viral regulatory proteins and is always accompanied by the KSHV transactivator protein ORF50. We therefore examined the effect of co-expressing ORF57 and ORF50 proteins on the ORF50 promoter. Human 293 cells were transfected with the pORF50/500-luc reporter plasmid and vectors expressing the following proteins: ORF57 alone (GFP-gORF57; 600 ng) or ORF50 alone (pcDNA3-gORF50; 500 ng) or ORF50 and ORF57 together. The functionality of the 5'-UTR of pORF50/500-luc was verified in co-transfection studies when, in several independent experiments, ORF50 protein expressed alone (pcDNA3-gORF50; 500 ng) activated basal promoter activity of pORF50/500-luc by a maximum of 4-fold (Fig. 2Downa). These data were consistent with levels seen by others for a comparable ORF50 5'-UTR reporter plasmid in KSHV-uninfected cells (Seaman et al., 1999Down; Sakakibara et al., 2001Down; Wang et al., 2003bDown). Expression of ORF57 alone activated luciferase expression by a maximum of 8-fold (Fig. 2aDown; also shown in Fig. 1aUp). Simultaneously, when ORF50 DNA (pcDNA3-gORF50; 500 ng), which resulted in maximum activity from the pORF50/500-luc reporter vector, was co-transfected with increasing amounts of ORF57 DNA (GFP-gORF57; 0–900 ng), normalized luciferase activity rose in a dose-dependent manner (Fig. 2bDown). ORF50 promoter activity was upregulated further to a maximum of 13-fold with the addition of 600 ng ORF57 DNA (Fig. 2bDown), above the 4-fold level obtained with ORF50 DNA alone (as shown in Fig. 2aDown). Similar results were obtained using a pORF50/3000-luc reporter plasmid containing 3000 bp of DNA upstream of the ORF50 translation initiation codon (data not shown). These data demonstrated functional co-operation between ORF57 and ORF50 proteins on gene expression from the ORF50 promoter.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. ORF50 expression activates expression from the ORF50 promoter, and ORF57 when co-expressed with ORF50 co-operatively augments ORF50-mediated expression from this promoter. (a) ORF50 alone activates expression from the ORF50 promoter in the pORF50/500-luc reporter vector. Human 293 cells were co-transfected with the pORF50/500-luc reporter plasmid and plasmids expressing either ORF57 (GFP-gORF57; 600 ng DNA) or ORF50 (pcDNA3-gORF50; 500 ng DNA). In each sample, the total amount of vector backbone DNA was kept constant by adding empty vector (without insert) DNA. Final luciferase values were based on normalized luciferase activity (see Methods), and fold activation of firefly luciferase activity was calculated relative to the firefly luciferase activity measured when cells were transfected with the pORF50/500-luc reporter plus empty vector DNA in parallel and assigned an activity of 1. (b) The effect of ORF57 on the basal transcription activity of ORF50 promoter in pORF50/500-luc reporter in the presence of a constant amount of ORF50. In the same experiment as in (a), human 293 cells were simultaneously co-transfected with the pORF50/500-luc reporter plasmid and pcDNA3-gORF50 (500 ng DNA). The GFP-gORF57 expression vector was also added in increasing amounts of 0–900 ng DNA. Decreasing amounts of empty vector (without insert) were also included in each sample so that the total amount of vector backbone remained the same. Fold activation of firefly luciferase activity was calculated relative to the firefly luciferase activity of cells transfected with the pORF50/500-luc reporter plus pcDNA3-gORF50 DNA in parallel and assigned an activity of 1. (c) The effect of ORF57 and ORF50 alone and together on the transcription activity of an IFN-{alpha}-responsive promoter in plasmid pISRE-luc. Human 293 cells were co-transfected with a mixture of plasmids including the pISRE-luc reporter with either GFP-gORF57 or pcDNA3-gORF50 or both. Recombinant IFN-{alpha} was added at 5 h post-transfection, as appropriate. Fold activation of normalized firefly luciferase activity was calculated relative to the normalized firefly luciferase activity measured when cells were transfected with the pISRE-luc reporter plus empty vector DNA in parallel and assigned an activity of 1. Error bars in (a)–(c) show the standard deviations of the data derived from three separate transfections with luciferase assays each performed in duplicate.

 
Neither ORF57 nor ORF50 alone (Fig. 2cUp, lanes 2 and 3) or in combination (Fig. 2cUp, lane 4) stimulated luciferase expression from heterologous promoters such as the interferon-stimulated response element (ISRE) promoter (pISRE-luc) (Fig. 2cUp, lane 1). However, the promoter was functional in the luciferase assays, since it responded to the addition of recombinant IFN-{alpha} (Fig. 2cUp, lane 5). In addition, ORF57 and ORF50 proteins together did not stimulate luciferase expression from the SV40 promoter (in the pGL3-Control plasmid) or Renilla luciferase activity (from the pRL-SV40 plasmid) used in luciferase assays (data not shown).

Kinetics of ORF57 and ORF50 expression in TPA-treated BCBL-1 cells
Given the functional co-operation between the ORF57 and ORF50 proteins on expression from the pORF50/500-luc reporter plasmid, we tested for simultaneous expression of the ORF57 and ORF50 proteins following TPA treatment of BCBL-1 cells. Western blotting with anti-ORF57 (GH) Ab on BCBL-1 cell extracts revealed that an increase in the amount of ORF57 protein was detected between 2 and 4 h post-TPA treatment (Fig. 3Downa, compare lanes 3 and 4). Up to 17 h after TPA treatment, anti-ORF57 Ab stained one major band of 50–52 kDa, and, between 17 and 24 h after TPA treatment, a faster-migrating protein band (45–48 kDa) was detected (Fig. 3aDown, compare lanes 6 and 7), suggestive of ORF57 protein processing. The ORF57 Ab showed some non-specific staining of a faint protein band present above ORF57 in both untreated and TPA-treated BCBL-1 cell extracts (Fig. 3aDown, lanes 1–8). The amount of this protein band did not increase with TPA treatment.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. ORF57 and ORF50 protein expression following TPA treatment of BCBL-1 cells. Western blots were obtained with anti-ORF57 (GH) Ab (a) or anti-ORF50 Ab (b) using lysates of untreated (lanes 1 and 8) and TPA-treated (lanes 2–7) BCBL-1 cells collected at different times after treatment. Bands corresponding to ORF57 and ORF50 are indicated.

 
Parallel experiments with anti-ORF50 Ab showed that an increase in the level of ORF50 protein was detected at 2 h post-TPA treatment (Fig. 3bUp, lane 3). The anti-ORF50 Ab stained two bands in treated cell extracts (Fig. 3bUp, lanes 2–7): an upper band corresponding in size to ORF50 protein (~110–120 kDa) and a fainter lower band (~100 kDa) also present in untreated cells (Fig. 3BUp, lanes 1 and 8). The molecular mass of the ORF50 protein expressed in mammalian cells from transfected pcDNA3-gORF50 DNA is approximately 110 kDa, similar in size to the native ORF50 protein (~110 kDa) present in BCBL-1 cells and about 36 kDa larger than the predicted size of 73·7 kDa, indicating protein modification (Lukac et al., 1999Down). However, full-length ORF50 protein transcribed and translated in vitro in rabbit reticulocyte lysate from ORF50 cDNA has an apparent molecular mass of approximately 90 kDa, indicative of differences in its post-translational modification (Lukac et al., 1999Down). In BCBL-1 cells, some ORF50 protein was found in untreated cells (Fig. 3bUp, lanes 1 and 8), presumably reflecting spontaneous virus reactivation in the cells (Renne et al., 1996Down). ORF50 expression occurs in approximately 1 % of untreated BCBL-1 cells (Wang et al., 2003bDown).

ORF57 and ORF50 gene products co-immunoprecipitate from TPA-treated BCBL-1 cell extracts
To search for a possible ORF57–ORF50 interaction, anti-ORF50 Ab was used in immunoprecipitations with untreated and TPA-treated BCBL-1 cell extracts, and ORF50 protein was detected by Western blotting. ORF50 protein was readily immunoprecipitated from TPA-treated cell extracts (Fig. 4Downa, lane 2) and some was also detected in untreated cell extracts (Fig. 4aDown, lane 1). Control pre-immune rabbit serum did not bring down ORF50 (Fig. 4aDown, lanes 3 and 4). ORF50 protein was present in input TPA-treated cell extracts and a small quantity was also in untreated extracts (Fig. 4aDown, lanes 5 and 6) due to spontaneous viral reactivation, as discussed above. The presence of ORF57 in immunoprecipitates obtained with anti-ORF50 Ab could not be shown by Western blotting with anti-ORF57 (GH) Ab as the IgG heavy chain of the available anti-ORF50 and ORF57 rabbit Abs is of similar size to ORF57 protein and gave a strong masking signal on Western blots (data not shown). The rabbit heavy chain IgG that masks the ORF57 protein band can be seen in the Western blot obtained with anti-ORF50 Ab (Fig. 4aDown, lanes 1–4).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. ORF57 and ORF50 proteins interact in immunoprecipitates from KSHV-infected TPA-treated BCBL-1 cell extracts. (a) Western blot using anti-ORF50 Ab on immunoprecipitates obtained with anti-ORF50 Ab (lanes 1 and 2) or pre-immune (P.I.) serum (lanes 3 and 4) with untreated (lanes 1 and 3) and TPA-treated (lanes 2 and 4) BCBL-1 cell extracts. The input untreated and TPA-treated cell extracts used are shown (lanes 5 and 6). (b) Western blot using anti-ORF50 Ab on immunoprecipitates obtained with anti-ORF57 Ab (lanes 3–5) or P.I. serum (lanes 6 and 7) from untreated (lanes 3 and 6) and TPA-treated BCBL-1cell extracts (lanes 4, 5 and 7) and with RNase treatment (lane 5). The input untreated and TPA-treated extracts (lanes 1 and 2) used are shown. (c) Immunoprecipitation assays showing 35S-labelled ORF57 protein synthesized in vitro and immunoprecipitated specifically by anti-ORF57 (GH) Ab. 35S-labelled ORF57 protein (input, lane 3) was immunoprecipitated by anti-ORF57 (GH) Ab (lane 1) and not by control P.I. rabbit serum (lane 2). Control 35S-labelled luciferase protein was not immunoprecipitated with anti-ORF57 (GH) Ab (lane 4). The position of 35S-labelled ORF57 is indicated by an arrow.

 
Next, reciprocal immunoprecipitations were performed with anti-ORF57 Ab in KSHV-infected BCBL-1 cell extracts and probed by Western blotting with anti-ORF50 Ab. A 110–120 kDa band that reacted specifically with anti-ORF50 Ab was present in the immunoprecipitates from TPA-treated cell extracts (Fig. 4bUp, lane 4) and not from untreated BCBL-1 cell extracts (Fig. 4bUp, lane 3). The 110–120 kDa band was also absent from immunoprecipitates of TPA-treated and untreated cell extracts obtained using control pre-immune serum (Fig. 4bUp, lanes 6 and 7). As expected ORF50 protein was also detected in input TPA-treated cell extracts and to a lesser extent in untreated cell extracts (Fig. 4bUp, lanes 2 and 1). As some ORF57 homologues, such as ICP27, bind RNA (Mears & Rice, 1996Down), RNase treatment of the KSHV-infected TPA-treated cell extracts was performed before immunoprecipitations with anti-ORF57 Ab. Addition of RNase did not affect the interaction (Fig. 4bUp, compare lanes 5 and 4). Thus, ORF57 and ORF50 proteins are present in the same complex and it is unlikely that the co-immunoprecipitation of ORF50 with ORF57 is due to an interaction of these proteins that depends on RNA. The presence of ORF57 protein immunoprecipitated by anti-ORF57 Ab (GH) could not be shown by Western blotting as again the rabbit heavy chain IgG masked the position of ORF57 protein (data not shown).

To confirm the specificity of the anti-ORF57 Ab, an immunoprecipitation assay was performed using 35S-labelled ORF57 protein synthesized in vitro. Autoradiography showed that 35S-labelled ORF57 protein (Fig. 4cUp, input, lane 3) was immunoprecipitated with anti-ORF57 (GH) Ab (Fig. 4cUp, lane 1) but not with control pre-immune rabbit serum (Fig. 4cUp, lane 2). A control unrelated protein, 35S-labelled luciferase, which is of similar size to ORF57, was not immunoprecipitated with anti-ORF57 (GH) Ab (Fig. 4cUp, lane 4).

ORF57 and ORF50 proteins interact in GST pull-down assays
To verify the physical interaction between ORF57 and ORF50 proteins, glutathione beads carrying either recombinant GST–ORF57 or GST alone, purified from E. coli (strain BL21 cells), were assayed for binding to ORF50 protein present in extracts of KSHV-infected BCBL-1 cells. Coomassie blue staining of the GST–ORF57 fusion protein and GST protein showed a detectable amount of full-length GST–ORF57 fusion protein plus smaller truncation products and a single GST band (Fig. 5Downa, lanes 2 and 3). Bound proteins were separated by SDS-PAGE and analysed by Western blotting with anti-ORF50 Ab. This experiment showed that GST–ORF57 pulled down ORF50 from TPA-treated, but not from untreated, BCBL-1 extracts (Fig. 5bDown, compare lanes 3 and 4). Negative control GST alone showed no interaction with ORF50 protein from the cell extracts (Fig. 5bDown, lanes 1 and 2). The existence of multiple forms of ORF50 protein in BCBL-1 cells (Fig. 5bDown, lanes 5 and 6) has been reported (Wang et al., 2003aDown) and is due in part to extensive post-translational modification (Lukac et al., 1999Down). Full-length ORF57 protein interacted with ORF50 protein in GST pull-down assays. To map the interacting ORF57 domain(s), ORF57 deletion mutants (see Fig. 1bUp) synthesized by in vitro translation and labelled with [35S]methionine were tested for their abilities to interact with GST–ORF50 (FL, 1–691): ORF57 (FL) synthesized in vitro from pcDNA4-ORF57 gave two truncation products. Bound proteins were separated by SDS-PAGE and analysed by autoradiography. A region of ORF57 between aa 17 and 215 was involved in the binding to ORF50 protein (Fig. 5cDown). ORF57 (FL) (aa 1–455) and ORF57 deletion mutants containing aa 17–455 and 1–215 interacted with GST–ORF50 (Fig. 5dDown, lanes 5–7). However, ORF57 aa 181–328, aa 329–455 and aa 387–455 failed to interact with ORF50 protein (Fig. 5dDown lanes 8, 3 and 4). A control unrelated protein, 35S-labelled luciferase, was not pulled down with GST–ORF50 (Fig. 5dDown, lane 2), and GST alone showed no interaction with 35S-labelled ORF57 (FL) protein (Fig. 5cDown, lane 1).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. GST–ORF57 pulls down ORF57 protein present in TPA-treated BCBL-1 cells. (a) Coomassie blue-stained gel showing the GST–ORF57 fusion (lane 2) and GST (lane 3) proteins used in pull-down assays. Sizes (kDa) of protein markers are indicated. (b) Western blot using anti-ORF50 Ab on BCBL-1 cell extracts following the pull-down assays with GST–ORF57 fusion protein (lanes 3 and 4) or GST alone (lanes 1 and 2) from TPA-treated (lanes 2, 4 and 5) or untreated BCBL-1 cell extracts (lanes 1, 3 and 6). The input TPA-treated (lane 5) and untreated cell extracts (lane 6) used are shown. (c) The ORF57 N-terminal region interacts with ORF50. 35S-labelled ORF57 (FL) and labelled proteins from ORF57 deletion mutants were used in the pull-down assay with GST–ORF50 (FL) (lanes 2–8). 35S-labelled proteins are: ORF57 (FL) aa 1–455 (lane 5); ORF57 aa 17–455 (lane 6); ORF57 aa 1–215 (lane 7); ORF57 aa 181–328 (lane 8); ORF57 aa 329–455 (lane 3); ORF57 aa 387–455 (lane 4). An unrelated protein, 35S-labelled luciferase protein, was not pulled down by GST–ORF50 (lane 2) and GST alone did not interact with 35S-labelled ORF57 (FL) (lane 1). The position of 35S-labelled ORF57 (FL) is indicated.

 
Association of ORF57 with the ORF50 promoter by ChIP assay
The apparent physical binding of ORF57 with ORF50 in vitro and by co-immunoprecipitation suggested that the transcriptional events mediated by ORF50 and the post-transcriptional events mediated by ORF57 might be more closely associated processes than previously appreciated. Other studies have demonstrated that ORF50 (and replication-associated protein, RAP) can be found selectively associated with the chromatin of several KSHV early and immediate-early promoters after (but not before) TPA-induction of the lytic cycle in KSHV latently infected PEL cell lines (Wang et al., 2003aDown, bDown; Wu et al., 2003Down). Therefore, we asked whether endogenous ORF57 might also be found in association with the KSHV ORF50 promoter in sonicated nuclear extracts from induced BCBL-1 cells using a ChIP assay. The DNA PCR results using ORF50 promoter region primers shown in Fig. 6Down(a) revealed that ORF50 promoter sequences were indeed preferentially associated with immunoprecipitated chromatin using both anti-ORF50 and anti-ORF57 (GH) antibodies. Quantitatively, the PCR products from the ORF50 immunoprecipitate (Fig. 6aDown, lane 2) gave a value of 11·4-fold and that from the ORF57 immunoprecipitate (Fig. 6aDown, lane 3) gave a value of 7·8-fold compared with the level obtained with the background control sample containing no Ab (Fig. 6aDown, lane 4). By contrast, in the non-promoter region negative control PCR experiment using ORF64 gene-coding region primers, no PCR-amplifiable DNA was recovered from any of the same three immunoprecipitates (Fig. 6bDown). This result confirmed that our ChIP assay was specific and recovered only promoter region DNA sequences specifically bound by the immunoprecipitated proteins.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 6. ChIP assay with BCBL-1 cell extracts prepared 48 h after induction by TPA showing that both ORF50 and ORF57 associate with the KSHV ORF50 promoter. (a) PCR amplification using primers LGH4354 and LGH4355 specific to the ORF50 promoter region. Template DNA was recovered from sonicated chromatin after immunoprecipitation with anti-ORF50 (lane 2) or anti-ORF57 (GH) (lane 3) rabbit polyclonal Abs or with no Ab (lane 4). A positive PCR size control from plasmid DNA containing the ORF50 promoter is shown (lane 5). The semi-quantitative ratio shown below lanes 2, 3 and 4 indicates the relative intensity of each band calculated with FluorChem software. The amplified ORF50 promoter band is indicated. (b) Negative control PCR amplification using the same immunoprecipitates as in (a) from induced BCBL-1 cell chromatin extracts but using primers LGH5297 and LGH5298 specific to the KSHV ORF64 coding region. Input control DNA recovered from the cell extract before immunoprecipitation is shown in lane 2. Template DNA recovered from immunoprecipitates with anti-ORF50 Ab (lane 3), anti-ORF57 (GH) Ab (lane 4) or the no Ab control (lane 5) are shown. The amplified ORF64 coding region band is indicated.

 

   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
The ORF50 upstream region has intrinsic promoter activity (Seaman et al., 1999Down; Deng et al., 2000Down; Sakakibara et al., 2001Down). However, its precise boundaries have not yet been defined. Consistent with previous reports, we observed stimulation of the ORF50 promoter by ORF50 alone (Seaman et al., 1999Down; Deng et al., 2000Down; Sakakibara et al., 2001Down). The ORF50 promoter region (–500 bp) used in the present study contains the octamer binding sequence (–227/–190 bp) for the octamer-binding protein 1, involved in autoregulation of ORF50 (Sakakibara et al., 2001Down). Several KSHV promoters, including that of ORF57, contain ORF50-specific DNA-binding sites and are activated by ORF50 (Lukac et al., 2001Down; Song et al., 2001Down; Chang et al., 2002Down). However, the mechanism of ORF50-mediated activation of its responsive elements in KSHV promoters is not yet fully understood. ORF50 can activate certain viral promoters by interacting with the cellular DNA-binding protein RBP-J{kappa} and replacing its repressing activity with activation (Liang et al., 2002Down).

In the present study, the contribution of the ORF57 protein to the transcriptional activity from the ORF50 promoter in the absence of the downstream ORF50 coding region was assessed independently of its possible effects on ORF50 RNA sequences. In 293 cells, ORF57 protein alone activated expression from the ORF50 promoter independently of B cell-specific factors and other virus-specific factors. The ORF57 C-terminal region, comprising aa 329–455, stimulated expression from the ORF50 promoter as efficiently as full-length protein, whereas ORF57 aa 387–455 showed much reduced reporter gene activity. However, the N terminus of ORF57 and not the C terminus was shown to interact with ORF50, indicating that activation by the ORF57 C terminus may be via a cellular factor. Interestingly, KSHV ORF57, unlike its homologues in other herpesviruses, contains a putative leucine zipper motif located between aa 343 and 364 (our unpublished observations; Gupta et al., 2000Down) with a possible role in protein dimerization, and KSHV ORF57 is capable of interacting with itself via the C terminus (data not shown). Repressing and enhancing functions have both been shown to map to the C-terminal regions of HVS ORF57 and the herpes simplex virus 1 (HSV-1) ICP27 proteins (McMahan & Schaffer, 1990Down; Goodwin et al., 2000Down). These regions are required to modulate viral gene expression very early in HSV-1 infection (McMahan & Schaffer, 1990Down).

When ORF57 and ORF50 proteins were co-expressed, activity from the ORF50 promoter was further upregulated by 13-fold compared with the 4-fold level obtained with ORF50 alone. Thus, ORF57 augments the ORF50-inducible effect on its own promoter and these two proteins act co-operatively to promote expression from the ORF50 promoter. The synergistic effects of ORF57 and ORF50 protein co-expression, previously observed with viral early promoters, used ORF50 expressed under the control of the HCMV promoter (Kirshner et al., 2000Down), which is unaffected by ORF57 (Gupta et al., 2000Down; Kirshner et al., 2000Down). The synergy was attributed to a post-translational enhancement by ORF57 of ORF50 transcriptional activity (Kirshner et al., 2000Down).

We have shown by co-immunoprecipitation and pull-down assays that ORF57 and ORF50 proteins are present in the same complex and therefore interact physically. To ensure the biological relevance of this interaction, studies were performed with naturally infected BCBL-1 cells, in which these two proteins are expressed during the course of KSHV reactivation following TPA treatment. Kirshner et al. (2000)Down were unable to detect an interaction between the products of the ORF57 and ORF50 genes (Kirshner et al., 2000Down) but no experimental details were provided. A possible explanation could reflect the fact that our binding assays used recently generated Abs specific to viral ORF57 and ORF50 proteins, and that studies were performed in KSHV-infected TPA-treated BCBL-1 cells, where other viral proteins are also expressed. A ChIP assay using ORF50 promoter region primers revealed that ORF50 promoter sequences were indeed preferentially associated with immunoprecipitated chromatin using both anti-ORF50 and anti-ORF57 Abs. This result is fully consistent with both an in vivo physical association between ORF57 and ORF50 and a potential role for ORF57 at the transcriptional level, although a post-transcriptional action could also explain the presence of ORF57 in close association with active promoter-associated complexes. In the case of the ORF50 promoter, ORF50 itself may not bind directly to the promoter DNA sequences, but rather be present in a complex with enhanced levels of both the cellular C/EBP{alpha} and cJUN/cFOS proteins (Wang et al., 2003aDown, bDown, 2004Down), and ORF57 might also be a part of either these or other similar large complexes.

This is the first demonstration of an interaction between these two immediate-early regulatory proteins in the gammaherpesviruses. However, in alphaherpesviruses, the HSV-1 counterpart of ORF57, ICP27, complexes with the ICP4 protein, the HSV-1 counterpart of ORF50 (Panagiotidis et al., 1997Down). ICP27 affects intracellular localization (Zhu & Schaffer, 1995Down) and electrophoretic mobility of ICP4 (Rice & Knipe, 1988Down; Su & Knipe, 1989Down). ICP27 acts at transcriptional (Jean et al., 2001Down) and post-transcriptional levels, influencing pre-mRNA processing and promoting export of viral RNAs (Sandri-Goldin & Mendoza, 1992Down; Koffa et al., 2001Down). Recently, ICP27 protein has been demonstrated to associate with RNA polymerase II (Zhou & Knipe, 2002Down). Similarly, varicella-zoster virus proteins IE62 and IE4, counterparts of KSHV ORF50 and ORF57, interact with each other (Spengler et al., 2000Down). A functional and physical interaction between these two protein counterparts, which have transcriptional and post-transcriptional actions, could be a general characteristic of herpesviruses and it will be interesting to look for it in the betaherpesviruses. The association of herpesviral regulatory proteins that have transcriptional and post-transcriptional actions reflects the close interconnection of transcription and pre-mRNA processing steps with each other (reviewed by Proudfoot et al., 2002Down; Reed & Hurt, 2002Down) and facilitates cross-regulation of protein activities.

Studies of cultured cells have indicated that inefficient spontaneous lytic reactivation is a likely explanation for the narrow host range of KSHV and, as ORF50 protein is sufficient to overcome this block, control of its expression may be the key determinant of KSHV spread in vivo (Bechtel et al., 2003Down). Activation of ORF50 promoter activity could be one mechanism by which KSHV lytic gene expression is regulated by the ORF50 and ORF57 proteins together, since basal transcription from the ORF50 promoter is upregulated by these two proteins in reporter gene assays. In the present study, new insights into the co-ordinated action of these two key regulatory proteins have been demonstrated in which augmentation of ORF50 activity by ORF57 protein, and vice versa, would facilitate the cascade of KSHV lytic viral gene expression, overcoming the inefficiency of spontaneous lytic viral reactivation and breaking latency. The co-operative effect between ORF57 and ORF50 proteins observed here could be due to one or more transcriptional, post-transcriptional, translational or post-translational effects.


   ACKNOWLEDGEMENTS
 
This work was supported by an award from the Medical Research Council to J. B. C. (G9826324) and in part by grants to D. J. B. from the Wellcome Trust (059008/Z/99/Z) and the Association for International Cancer Research (01/242). P. M. was the recipient of a UK Commonwealth Postgraduate Scholarship. Thanks go to Dr Nigel Stow for comments on the manuscript.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Bechtel, J. T., Liang, Y., Hvidding, J. & Ganem, D. (2003). Host range of Kaposi's sarcoma-associated herpesvirus in cultured cells. J Virol 77, 6474–6481.[Abstract/Free Full Text]

Bello, L. J., Davison, A. J., Glenn, M. A., Whitehouse, A., Rethmeier, N., Schulz, T. F. & Clements, J. B. (1999). The human herpesvirus-8 ORF 57 gene and its properties. J Gen Virol 80, 3207–3215.[Abstract/Free Full Text]

Boshoff, C. & Chang, Y. (2001). Kaposi's sarcoma-associated herpesvirus: a new DNA tumor virus. Annu Rev Med 52, 453–470.[CrossRef][Medline]

Boshoff, C. & Weiss, R. A. (2001). Epidemiology and pathogenesis of Kaposi's sarcoma-associated herpesvirus. Philos Trans R Soc Lond B Biol Sci 356, 517–534.[Medline]

Boshoff, C., Schulz, T. F., Kennedy, M. M., Graham, A. K., Fisher, C., Thomas, A., McGee, J. O., Weiss, R. A. & O'Leary, J. J. (1995). Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells. Nat Med 1, 1274–1278.[CrossRef][Medline]

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266, 1865–1869.[Abstract/Free Full Text]

Chang, P. J., Shedd, D., Gradoville, L., Cho, M. S., Chen, L. W., Chang, J. & Miller, G. (2002). Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements. J Virol 76, 3168–3178.[Abstract/Free Full Text]

Cunningham, C., Barnard, S., Blackbourn, D. J. & Davison, A. J. (2003). Transcription mapping of human herpesvirus 8 genes encoding viral interferon regulatory factors. J Gen Virol 84, 1471–1483.[Abstract/Free Full Text]

Deng, H., Young, A. & Sun, R. (2000). Auto-activation of the RTA gene of human herpesvirus-8/Kaposi's sarcoma-associated herpesvirus. J Gen Virol 81, 3043–3048.[Abstract/Free Full Text]

Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A. & Lukac, D. M. (2003). Molecular genetics of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) epidemiology and pathogenesis. Microbiol Mol Biol Rev 67, 175–212.[Abstract/Free Full Text]

Foreman, K. E., Friborg, J., Jr, Kong, W. P., Woffendin, C., Polverini, P. J., Nickoloff, B. J. & Nabel, G. J. (1997). Propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma. N Engl J Med 336, 163–171.[Abstract/Free Full Text]

Goodwin, D. J., Hall, K. T., Giles, M. S., Calderwood, M. A., Markham, A. F. & Whitehouse, A. (2000). The carboxy terminus of the herpesvirus saimiri ORF 57 gene contains domains that are required for transactivation and transrepression. J Gen Virol 81, 2253–2265.[Abstract/Free Full Text]

Gradoville, L., Gerlach, J., Grogan, E., Shedd, D., Nikiforow, S., Metroka, C. & Miller, G. (2000). Kaposi's sarcoma-associated herpesvirus open reading frame 50/RTA protein activates the entire viral lytic cycle in the HH-B2 primary effusion lymphoma cell line. J Virol 74, 6207–6212.[Abstract/Free Full Text]

Gupta, A. K., Ruvolo, V., Patterson, C. & Swaminathan, S. (2000). The human herpesvirus 8 homolog of Epstein–Barr virus SM protein (KS-SM) is a posttranscriptional activator of gene expression. J Virol 74, 1038–1044.[Abstract/Free Full Text]

Hardwick, J. M., Lieberman, P. M. & Hayward, S. D. (1988). A new Epstein–Barr virus transactivator, R, induces expression of a cytoplasmic early antigen. J Virol 62, 2274–2284.[Abstract/Free Full Text]

Jean, S., LeVan, K. M., Song, B., Levine, M. & Knipe, D. M. (2001). Herpes simplex virus 1 ICP27 is required for transcription of two viral late (gamma 2) genes in infected cells. Virology 283, 273–284.[CrossRef][Medline]

Kenney, S., Kamine, J., Holley-Guthrie, E., Mar, E. C., Lin, J. C., Markovitz, D. & Pagano, J. (1989). The Epstein–Barr virus immediate-early gene product, BMLF1, acts in trans by a posttranscriptional mechanism which is reporter gene dependent. J Virol 63, 3870–3877.[Abstract/Free Full Text]

Kirshner, J. R., Lukac, D. M., Chang, J. & Ganem, D. (2000). Kaposi's sarcoma-associated herpesvirus open reading frame 57 encodes a posttranscriptional regulator with multiple distinct activities. J Virol 74, 3586–3597.[Abstract/Free Full Text]

Koffa, M. D., Clements, J. B., Izaurralde, E., Wadd, S., Wilson, S. A., Mattaj, I. W. & Kuersten, S. (2001). Herpes simplex virus ICP27 protein provides viral mRNAs with access to the cellular mRNA export pathway. EMBO J 20, 5769–5778.[CrossRef][Medline]

Liang, Y. & Ganem, D. (2003). Lytic but not latent infection by Kaposi's sarcoma-associated herpesvirus requires host CSL protein, the mediator of Notch signaling. Proc Natl Acad Sci U S A 100, 8490–8495.[Abstract/Free Full Text]

Liang, Y., Chang, J., Lynch, S. J., Lukac, D. M. & Ganem, D. (2002). The lytic switch protein of KSHV activates gene expression via functional interaction with RBP-J{kappa} (CSL), the target of the Notch signaling pathway. Genes Dev 16, 1977–1989.[Abstract/Free Full Text]

Lieberman, P. M., O'Hare, P., Hayward, G. S. & Hayward, S. D. (1986). Promiscuous trans activation of gene expression by an Epstein–Barr virus-encoded early nuclear protein. J Virol 60, 140–148.[Abstract/Free Full Text]

Lukac, D. M., Renne, R., Kirshner, J. R. & Ganem, D. (1998). Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252, 304–312.[CrossRef][Medline]

Lukac, D. M., Kirshner, J. R. & Ganem, D. (1999). Transcriptional activation by the product of open reading frame 50 of Kaposi's sarcoma-associated herpesvirus is required for lytic viral reactivation in B cells. J Virol 73, 9348–9361.[Abstract/Free Full Text]

Lukac, D. M., Garibyan, L., Kirshner, J. R., Palmeri, D. & Ganem, D. (2001). DNA binding by Kaposi's sarcoma-associated herpesvirus lytic switch protein is necessary for transcriptional activation of two viral delayed early promoters. J Virol 75, 6786–6799.[Abstract/Free Full Text]

McMahan, L. & Schaffer, P. A. (1990). The repressing and enhancing functions of the herpes simplex virus regulatory protein ICP27 map to C-terminal regions and are required to modulate viral gene expression very early in infection. J Virol 64, 3471–3485.[Abstract/Free Full Text]

Mears, W. E. & Rice, S. A. (1996). The RGG box motif of the herpes simplex virus ICP27 protein mediates an RNA-binding activity and determines in vivo methylation. J Virol 70, 7445–7453.[Abstract]

Milligan, S., Robinson, M., O'Donnell, E. & Blackbourn, D. J. (2004). Inflammatory cytokines inhibit KSHV lytic gene transcription in in vitro-infected endothelial cells. J Virol 78, 2591–2596.[Abstract/Free Full Text]

Moore, P. S. & Chang, Y. (2001). Molecular virology of Kaposi's sarcoma-associated herpesvirus. Philos Trans R Soc Lond B Biol Sci 356, 499–516.[CrossRef][Medline]

Nicholas, J., Gompels, U. A., Craxton, M. A. & Honess, R. W. (1988). Conservation of sequence and function between the product of the 52-kilodalton immediate-early gene of herpesvirus saimiri and the BMLF1-encoded transcriptional effector (EB2) of Epstein–Barr virus. J Virol 62, 3250–3257.[Abstract/Free Full Text]

Panagiotidis, C. A., Lium, E. K. & Silverstein, S. J. (1997). Physical and functional interactions between herpes simplex virus immediate-early proteins ICP4 and ICP27. J Virol 71, 1547–1557.[Abstract]

Paulose-Murphy, M., Ha, N. K., Xiang, C. & 7 other authors (2001). Transcription program of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus). J Virol 75, 4843–4853.[Abstract/Free Full Text]

Proudfoot, N. J., Furger, A. & Dye, M. J. (2002). Integrating mRNA processing with transcription. Cell 108, 501–512.[CrossRef][Medline]

Reed, R. & Hurt, E. (2002). A conserved mRNA export machinery coupled to pre-mRNA splicing. Cell 108, 523–531.[CrossRef][Medline]

Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D. & Ganem, D. (1996). Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med 2, 342–346.[CrossRef][Medline]

Rice, S. A. & Knipe, D. M. (1988). Gene-specific transactivation by herpes simplex virus type 1 alpha protein ICP27. J Virol 62, 3814–3823.[Abstract/Free Full Text]

Sakakibara, S., Ueda, K., Chen, J., Okuno, T. & Yamanishi, K. (2001). Octamer-binding sequence is a key element for the autoregulation of Kaposi's sarcoma-associated herpesvirus ORF50/Lyta gene expression. J Virol 75, 6894–6900.[Abstract/Free Full Text]

Sandri-Goldin, R. M. & Mendoza, G. E. (1992). A herpesvirus regulatory protein appears to act post-transcriptionally by affecting mRNA processing. Genes Dev 6, 848–863.[Abstract/Free Full Text]

Sarid, R., Olsen, S. J. & Moore, P. S. (1999). Kaposi's sarcoma-associated herpesvirus: epidemiology, virology, and molecular biology. Adv Virus Res 52, 139–232.[Medline]

Schulz, T. F. (1998). Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J Gen Virol 79, 1573–1591.[Medline]

Schulz, T. F. (1999). Epidemiology of Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8. Adv Cancer Res 76, 121–160.[Medline]

Seaman, W. T., Ye, D., Wang, R. X., Hale, E. E., Weisse, M. & Quinlivan, E. B. (1999). Gene expression from the ORF50/K8 region of Kaposi's sarcoma-associated herpesvirus. Virology 263, 436–449.[CrossRef][Medline]

Song, M. J., Brown, H. J., Wu, T. T. & Sun, R. (2001). Transcription activation of polyadenylated nuclear RNA by RTA in human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus. J Virol 75, 3129–3140.[Abstract/Free Full Text]

Spengler, M. L., Ruyechan, W. T. & Hay, J. (2000). Physical interaction between two varicella zoster virus gene regulatory proteins, IE4 and IE62. Virology 272, 375–381.[CrossRef][Medline]

Staskus, K. A., Zhong, W., Gebhard, K. & 8 other authors (1997). Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells. J Virol 71, 715–719.[Abstract]

Su, L. & Knipe, D. M. (1989). Herpes simplex virus alpha protein ICP27 can inhibit or augment viral gene transactivation. Virology 170, 496–504.[CrossRef][Medline]

Sun, R., Lin, S. F., Gradoville, L., Yuan, Y., Zhu, F. & Miller, G. (1998). A viral gene th