|
|
||||||||

1 Institut National de la Recherche Agronomique, Unité Mixte de Recherche Vigne et Vins d'Alsace, Laboratoire de Virologie, 28 rue de Herrlisheim, 68021 Colmar, France
2 Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, 12 rue du Général Zimmer, 67081 Strasbourg, France
3 Institut National de la Recherche Agronomique, Unité Mixte de Recherche Biologie des Organismes et des Populations Appliquées à la Protection des Plantes, BP 35327, 35653 Le Rheu, France
Correspondence
Marc Fuchs
fuchs{at}colmar.inra.fr
| ABSTRACT |
|---|
|
|
|---|
The GenBank accession numbers of the novel GFLV sequences reported in this paper are AY370941AY371027.
Supplementary tables showing characteristics of RFLP groups, oligonucleotide sequences and nucleotide and amino acid sequence identities are available in JGV Online.
Present address: Department of Biology, University of North Carolina, CB # 3280, Coker Hall, Chapel Hill, NC 27599, USA. ![]()
| INTRODUCTION |
|---|
|
|
|---|
GFLV belongs to the plant virus genus Nepovirus in the family Comoviridae (Mayo & Robinson, 1996
). The genome of GFLV is bipartite and composed of two single-stranded positive-sense RNAs, called RNA1 and RNA 2, which carry a small genome-linked protein or VPg at their 5' ends and a poly(A) stretch at their 3' extremities (Pinck et al., 1988
) (Fig. 1a
). Each genomic RNA encodes a polyprotein from which functional proteins are released by proteolytic processing at defined dipeptide cleavage sites (Fig. 1a
). RNA1 encodes the proteinase, which matures the polyproteins in cis and in trans, and the replicative functions (Ritzenthaler et al., 1991
) (Fig. 1a
). RNA2 encodes protein 2A which is essential for RNA2 replication (Gaire et al., 1999
), protein 2BMP (movement protein) which forms tubules through which virions move from cell to cell within plasmodesmata (Ritzenthaler et al., 1995
), and the 56 kDa coat protein 2CCP which assembles into icosahedral particles (Serghini et al., 1990
) (Fig. 1a
).
|
The present study expands on our previous work (Vigne et al., 2004
) by examining the population structure and genetic diversity within 347 GFLV isolates that challenged transgenic and conventional grapevines, using IC-RT-PCR-RFLP and sequence analysis of the CP gene. We found that the majority of isolates (55 %, 191 of 347) had a population structure consisting of one major variant. Sequencing data of a subsample of 51 isolates representing the different restrictotypes demonstrated the existence of mixed infection with at least two genetically distinct variants, at a frequency of 33 % (17 of 51). No correlation was observed between CP gene variation and host plant (transgenic vs conventional) or field site for most restrictotypes and for haplotypes in most phylogenetic groups. The characteristics of five GFLV hybrid variants that developed through distinct recombination events in the coding region of the CP gene in the absence of selective constraints against the recombinants are described. This study provides new insights into the population structure and genetic diversity within GFLV isolates, which are relevant for designing alternative control strategies against this detrimental grapevine virus.
| METHODS |
|---|
|
|
|---|
DAS-ELISA and IC-RT-PCR.
GFLV was detected in leaf samples of individual vines by double antibody sandwich (DAS) enzyme-linked immunosorbent assay (ELISA) (Walter & Etienne, 1987
). The CP gene of GFLV isolates was further amplified by IC-RT-PCR assays using leaf samples that reacted positively in DAS-ELISA (Vigne et al., 2004
). Briefly, GFLV particles were immunocaptured on microtitre plates with immunoglobulins and denatured for 10 min at 70 °C. Viral RNAs were used as template for RT-PCR with 15 U AMV reverse transcriptase (Promega) and primer EV00N1 5'-3574GACTATCTAGACACATATATACACTTGGGTCTTTTAA3601-3' (with an additional XbaI site underlined) in a final volume of 20 µl. PCR was performed in a 50 µl volume containing 2·5 µl of the RT solution, 5 µl 10x Taq buffer, 3 µl 25 mM MgCl2, 0·2 mM each dNTP, 50 pmoles each primer, EV00N3 5'-2045ACTGTCTAGAGGATTRGCYGGYAGAGGAGT2067-3' (with an additional XbaI site underlined) and EV00N1 and 2 units Taq DNA polymerase (Promega). The samples were incubated first at 94 °C for 3 min, followed by 30 cycles of 94 °C (30 sec), 55 °C (60 sec) and 72 °C (90 sec) with a final 3 min extension at 72 °C.
RFLP analysis, cDNA cloning and sequencing.
The IC-RT-PCR-amplified DNA products corresponding to the CP gene of GFLV isolates from test plants were characterized by RFLP using EcoRI and StyI (Vigne et al., 2004
). DNA digests were analysed by electrophoresis on 1·5 % agarose gels. RT-PCR products were subsequently cloned into the pGEM-3Zf(+) vector (Promega) using T4 DNA ligase after digestion with XbaI (Promega), followed by transformation into Escherichia coli DH5
. Selected clones were sequenced on both strands using an ABI DNA sequencer 373 (Perkin-Elmer) at the sequencing facility of the Institut de Biologie Moléculaire des Plantes, in Strasbourg, France. The rate of intra- and inter-clonal nucleotide variability was determined in three independent experiments by sequencing at least two clones corresponding to the PCR products of GFLV strain F13 (Serghini et al., 1990
; accession number X16907) and isolate A15a selected for this study (accession no. AY370954) (Vigne et al., 2004
).
Nucleotide and amino acid sequence analyses.
Nucleotide and amino acid sequences were analysed using the University of Wisconsin Genetics Computer Group version 10.2 and Vector NTI sequence analysis software packages. The program CLUSTAL W was used for alignment of nucleotide sequences (Thompson et al., 1994
) and the distance matrix based on Jukes and Cantor's model was used to estimate nucleotide divergence. The phylogenetic relationships were determined with neighbour-joining (NJ) (Saitou & Nei, 1987
). The robustness of the inferred evolutionary relationships was assessed by 1000 bootstrap replicates. Phylogenetic relationships were also determined with the maximum-likelihood (ML) algorithm of TREE-PUZZLE version 5.0 (Strimmer & von Haeseler, 1996
). Branches with a reliability percentage <50 were collapsed. The substitution model of Tamura & Nei (1993)
was used and the shape parameters, including the transition to transversion ratio with an eight category gamma distribution, were estimated during the tree reconstruction. The occurrence of suspected recombination events was confirmed with the program SISCAN version 2.0 (Gibbs et al., 2000
). This algorithm calculates Z values for pairwise identity scores of aligned sequences of the putative recombinant and its two putative parents within a sliding window (in our case, 100 or 250 nt) that moves by steps of 50 nt by using 250 equivalent randomized sequences.
Nucleotide sequence accession numbers.
Sequencing data identified 85 haplotypes, i.e. sequence variants, associated with the 51 GFLV isolates analysed in this study, 35 from field A (GenBank accession nos AY370941AY370997 and AY371027) and 16 from field B (GenBank accession nos AY370998AY371024). The CP gene sequences of GFLV isolates b844 from France and GHu from Hungary, which were determined in this study, have been made available in GenBank (accession nos AY371025 and AY371026, respectively). Other GFLV CP nucleotide sequences used in our analyses were from the following GenBank entries: isolate AU (U11768) from Austria (Brandt et al., 1995
), isolate Ca100 (X60775) from California (Sanchez et al., 1991
), strain F13 (X16907) from Frontignan, France (Serghini et al., 1990
), isolate Ha (AJ318415) from Hangzhou, The People's Republic of China and isolate NW (AY017339) from Neustadt-an-der-Weinstrasse, Germany (Wetzel et al., 2001
). The nucleotide sequence of isolate Gh from the People's Republic of China (Hancheng et al., 1996
) was also used in this study.
| RESULTS |
|---|
|
|
|---|
2) using contingency tables indicated that the frequency distribution of restrictotypes 111 was independent of host (P=0·47), except for restrictotype 9, which was present at a higher frequency in conventional plants. Similar results were obtained if restrictotype 12 was included in the analysis. Furthermore, the frequency distribution of most restrictotypes (3, 6, 7, 8, 9, 11 and 12) was independent of field site (P=0·22), except for restrictotypes 1 and 2, which were present at a higher frequency in field B, and for restrictotypes 4, 5 and 10, which were present at a higher frequency in field A.
A subsample of 51 out of the 347 GFLV isolates typified by RFLP was selected for further characterization. These 51 isolates were from transgenic (27 isolates) or conventional (24 isolates) grapevines, and from field A (35 isolates) or B (16 isolates) (Table 1
). They represented the different restrictotypes identified, with some of them (43 %, 22 of 51) belonging to RFLP groups 111 and others (57 %, 29 of 51) to RFLP group 12. A closer analysis of the restriction patterns of the latter subset of isolates further indicated that seven of these 29 isolates had major restrictotypes that were different from those in RFLP groups 111, whereas 22 of them had more complex patterns, probably corresponding to a mixture of several restrictotypes. These 29 isolates were classified in RFLP subgroups 12
to 12
(Table 2
). Altogether, our typification assays indicated that the majority (57 %, 29 of 51) of the subsample of 51 isolates had a population structure with one predominant variant, whereas 43 % (22 of 51) of them were probably composed of at least two genetically related variants (Table 2
).
2 analysis indicated that the frequency distribution of the different restrictotypes was independent of host (transgenic vs conventional) (P=0·45) or field site (A vs B) (P=0·60) (Table 2
).
|
|
Sequencing data identified 85 distinct variants associated with the 51 GFLV isolates sequenced. A multiple sequence alignment was used to determine nucleotide diversity within and between subsets of haplotype populations. As expected, heterogeneity within haplotype subsets was low (0·0050·028) and heterogeneity between haplotype subsets was high (0·0830·138) at the nucleotide level (Supplementary Table C, which is available as supplementary data in JGV Online). Similar data were obtained at the amino acid level with limited within (0·0020·034), and higher between (0·0240·069), population heterogeneity. Phylogenetic relationships were inferred using the NJ and ML methods for the 85 sequences, together with 6 sequences available in GenBank and 2 additional sequences (b844 and GHu) which were characterized in this study. Trees calculated with the NJ and ML methods were closely similar, with the 93 GFLV CP gene haplotypes falling into nine consistent groups, designated AI (Fig. 2
). The variants from the Chardonnay vineyard clustered into eight of these groups (AE and GI) and the two variants from China fell into group F (Fig. 2
). The majority of 85 haplotypes from the Chardonnay vineyard belonged to groups A (36 %, 31 of 85) and B (34 %, 29 of 85) (Fig. 2
). Group I had nine haplotypes (11 %) and the four next more frequent groups (C, E, G and H) had 45 % (3 to 4 haplotypes) of the population each, while group D had only two haplotypes (2 %) (Fig. 2
). Some haplotypes were only present in transgenic (those in groups D and G) or in conventional (those in group H) plants, and almost all haplotypes, except those in group H, were present in field A, while a few (those in groups D, E and G) were missing from field B, probably because of the smaller number of isolates (27 vs 58) (Fig. 2
).
2 analysis indicated that the frequency distribution of haplotypes in most phylogenetic groups was independent of host (P=0·12), except for those in group A, which were present at a higher frequency in transgenic plants. Also, the frequency distribution of haplotypes in most phylogenetic groups was independent of field site (P=0·60), except for those in groups H and I that were present at a higher frequency in field B. Interestingly, no dependency on field site was found if haplotypes related to mixed infection were omitted in contingency tables analysed by
2 distribution (P=0·85).
|
2 analysis further indicated that the frequency distribution of haplotypes was independent of host (P=0·95) or field site (P=0·95). In addition, there was no apparent correlation between the geographic origin of the GFLV isolates and their nucleotide distance. For example, isolate GHu from Hungary branched with variants from the Chardonnay vineyard in France in phylogenetic group G (Fig. 2
|
|
|
|
Putative recombination sites were searched based on sequences with no definite relatedness signals between the recombinants and their two parents. Interestingly, cross-over sites were identified at different locations for the five recombinants: nt 425446 for A17b, 11371138 for A17a, 283294 for B6b, 618638 for B6f and 818849 for B2a. To examine whether amino acid stretches corresponding to these recombination sites map to certain structures on the GFLV capsid, we examined a 3D model recently constructed in our laboratory (M. Bergdoll and M. Fuchs, unpublished results) from the crystal structure of Tobacco ringspot virus (Chandrasekar & Johnson, 1997
), the type member of the genus Nepovirus. Our structural studies mapped the putative recombination sites to the three encoded trapezoid-shaped
-barrel domains of the CP: domain C for recombinants A17b and B6b, domain B for recombinants B6f and B2a and domain A for recombinant A17a (data not shown).
| DISCUSSION |
|---|
|
|
|---|
In our study, we used RFLP analysis and sequencing to estimate the population structure and genetic diversity within 347 naturally occurring GFLV isolates from a Chardonnay vineyard in the Champagne region of France. Analysis of the CP gene in a subsample of 51 isolates indicated 18 distinct restrictotypes and eight phylogenetic groups for 85 sequence variants, of which some were dominant in the population. The variability of the CP gene found at the nucleotide level (0·0020·138) for the 85 GFLV variants is within the range described for the structural protein or other protein open reading frames of numerous other plant viruses (0·0020·224) (Garcia-Arenal et al., 2001
).
Remarkably, seven plants were infected by three to five distinct variants that belonged to two or three phylogenetic groups, demonstrating that some variant populations were likely to have originated from mixed infection by two or more divergent GFLV isolates through successive infections by variants of different groups. For instance, plant A30 was hosting haplotypes from phylogenetic groups A and G. It is conceivable that the mixture of haplotypes in plant A30 could result from infection first with haplotypes of cluster A and then with haplotypes of cluster G, or vice-versa. The fact that heterogeneous populations of GFLV variants in a single vine (this study; Naraghi-Arani et al., 2001
) are likely to result from isolate mixing due to repeated transmissions of individual variants by viruliferous nematodes is in agreement with the constant exposure of grapevines to Xiphinema index vectors for long periods of time (usually 3040 years). In addition, mixed infections are common in grapevines and the occurrence of multiple variants has been reported for several viruses other than GFLV (Goszczynski & Jooste, 2003
; Little et al., 2001
; Meng et al., 1999
; Shi et al., 2003
). Viticulture practices such as vegetative propagation and grafting can also contribute to the simultaneous presence of multiple variants in a single vine, although GFLV-free certified material was used in the Chardonnay vineyard selected for this study.
The genetic structure described here suggests a displacement of some GFLV isolates among geographically isolated populations, since isolates from various regions distant by several hundreds or thousands of kilometres had identical genetic structure. For example, the same percentage of diversity was obtained among variants from the Champagne region and other viticultural regions (F13 and b844) in France. Similarly, the same magnitude of diversity was obtained among variants from several European countries (Austria, Germany, Hungary, France), The People's Republic of China (Gh and Ha) and the USA (Ca100). The fact that some variants were not distributed according to their geographic origin indicates a single undifferentiated population. These findings are probably explained by the intense exchange of grapevine propagation material, including GFLV-infected material, between distant regions of the world. Interestingly, a lack of correlation between genetic and geographic proximity was also reported for two viruses that infect perennial crops like GFLV: Tobacco mild green mosaic virus (TMGMV) in Nicotiana glauca (Fraile et al., 1996
) and Citrus tristeza virus (CTV) in citrus species (Albiach-Marti et al., 2000
; Rubio et al., 2001
). A probable hypothesis for this phenomenon is functional constraints to genetic divergence. In addition, the vegetative propagation of grapevine clonal material may create a genetically homogeneous environment at the plant level that could favour GFLV optimization and stability, as shown for Potato leafroll virus in potato (Guyader & Giblot Ducray, 2002
).
Recombination has been suspected previously in some nepovirus species based on sequence data (Mayo & Robinson, 1996
). Experimental evidence was obtained by Le Gall et al. (1995)
who showed template switching in the 3' untranslated region of pseudorecombinants constituted by RNA1 of Grapevine chrome mosaic virus and RNA2 of Tomato black ring virus. Although described for numerous viruses (Aaziz & Tepfer, 1999
; Garcia-Arenal et al., 2001
), the natural occurrence of recombination was only recently reported for the first time in the CP of the nepovirus GFLV (Vigne et al., 2004
). Our observations indicate that recombination was achieved in the absence of strong, if any, selective pressure against hybrid variants in the CP gene. Indeed, all the conventional and the majority of transgenic grapevines tested were susceptible to GFLV (Vigne et al., 2004
). Therefore, no resistance-driven selective pressure was imposed on the GFLV isolates. Nevertheless, the fitness of some of the GFLV recombinants is under investigation in our laboratory, since they may have similar characteristics as their parental lineages or new biological properties such as changes in vector specificity, expanded host range, and/or increased pathogenicity (Aaziz & Tepfer, 1999
; Garcia-Arenal et al., 2001
).
There is apparently a strong genetic stability in the GFLV CP gene. Indeed, the divergence at the nucleotide level (0·0020·138) found in 93 variants translates into limited divergence at the amino acid level (0·0020·069) (Supplementary Table C). The CP has constraints related to particle structure and stability, cell-to-cell and long-distance movement (Belin et al., 1999
) and interaction with the host and nematode vector (Andret-Link et al., 2004
). Thus, the emergence of GFLV recombinants in the CP domain is likely to have occurred because the amino acids that are highly critical for these important functions were not affected. This hypothesis is supported by the fact that recombination events occurred in the three, and not only in one, encoded
-barrel domains of the predicted capsid structure. Selection constraints on the CP amino acid sequences and global sequence stability imply a negative-selection evolutionary model for GFLV, as demonstrated for other viruses (Azzam et al., 2000
; Glais et al., 2002
).
Our study provided new insights into the GFLV population structure, genetic relationship and diversity between variants. This knowledge will help us to understand the complexity of GFLV better and consequently design effective and environmentally sound strategies to control this detrimental grapevine virus based on cross protection with genetically engineered mild strains and post-transcriptional RNA silencing-mediated transgenic resistance.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Albiach-Marti, M. R., Mawassi, M., Gowda, S. & 11 other authors (2000). Sequences of Citrus tristeza virus separated in time and space are essentially identical. J Virol 74, 68566865.
Andret-Link, P., Schmitt-Keichinger, C., Demangeat, G., Komar, V. & Fuchs, M. (2004). The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein. Virology 320, 1222.[CrossRef][Medline]
Azzam, O., Yambao, M. L. M., Muhsin, M., McNally, K. L. & Umadhay, K. M. L. (2000). Genetic diversity of rice tungro spherical virus in tungro-endemic provinces of the Philippines and Indonesia. Arch Virol 145, 11831197.[CrossRef][Medline]
Belin, C., Schmitt, C., Gaire, F., Walter, B., Demangeat, G. & Pinck, L. (1999). The nine C-terminal residues of grapevine fanleaf nepovirus movement protein are critical for systemic virus spread. J Gen Virol 80, 13471356.[Abstract]
Brandt, S., Ibl, M. & Himmler, G. (1995). Coat protein gene sequence of an Austrian isolate of grapevine fanleaf virus. Arch Virol 140, 157164.[CrossRef][Medline]
Chandrasekar, V. & Johnson, J. E. (1998). The structure of tobacco ringspot virus: a link in the evolution of icosahedral capsids in the picornavirus superfamily. Structure 6, 157171.[Medline]
Fajardo, T. V. M., Kuhn, G. B., Eiras, M. & Nickel, O. (2001). Partial characterization of an isolate of Grapevine fanleaf virus. Fitopatol Bras 26, 505511.
Fraile, A., Malpica, J. M., Aranda, M. A., Rodriguez-Cerezo, E. & Garcia-Arenal, F. (1996). Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 223, 148155.[CrossRef][Medline]
Gaire, F., Schmitt, C., Stussi-Garaud, C., Pinck, L. & Ritzenthaler, C. (1999). Protein 2A of grapevine fanleaf nepovirus is implicated in RNA2 replication and colocalizes to the replication site. Virology 264, 2536.[CrossRef][Medline]
Garcia-Arenal, F., Fraile, A. & Malpica, J. M. (2001). Variability and genetic structure of plant virus populations. Annu Rev Phytopathol 39, 157186.[CrossRef][Medline]
Gibbs, M. J., Armstrong, J. S. & Gibbs, A. J. (2000). Sister-scanning: a Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 16, 573582.
Glais, L., Tribodet, M. & Kerlan, C. (2002). Genomic variability in Potato potyvirus Y (PVY): evidence that PVYNW and PVYNTN variants are single to multiple recombinants between PVYO and PVYN isolates. Arch Virol 147, 363378.[CrossRef][Medline]
Goszczynski, D. E. & Jooste, A. E. C. (2003). Identification of grapevines infected with divergent variants of Grapevine virus A using variant-specific RT-PCR. J Virol Methods 112, 157164.[CrossRef][Medline]
Guyader, S. & Giblot Ducray, D. (2002). Sequence analysis of Potato leafroll virus isolates reveals genetic stability, major evolutionary events and differential selection pressure between overlapping reading frame products. J Gen Virol 83, 17991807.
Hancheng, G., Wenqi, C. & Keqiang, M. (1996). The cloning, sequence analysis, and expression in E. coli of coat protein gene of grapevine fanleaf virus Gh. Chin J Biotechnol 12, 7379.[Medline]
Hewitt, W. B., Raski, D. J. & Goheen, A. C. (1958). Nematode vector of soil-borne fanleaf virus of grapevines. Phytopathology 48, 586595.
Huss, B., Muller, S., Sommermeyer, G., Walter, B. & Van Regenmortel, M. H. V. (1987). Grapevine fanleaf virus monoclonal antibodies: their use to distinguish different isolates. J Phytopathol 119, 358370.
Huss, B., Walter, B. & Fuchs, M. (1989). Cross-protection between arabis mosaic virus and grapevine fanleaf virus isolates in Chenopodium quinoa. Ann Appl Biol 114, 4560.
Le Gall, O., Candresse, T. & Dunez, J. (1995). Transfer of the 3' non-translated region of grapevine chrome mosaic virus RNA-1 by recombination to tomato black ring virus RNA-2 in pseudorecombinant isolates. J Gen Virol 76, 12851289.
Little, A., Fazeli, C. F. & Rezaian, M. A. (2001). Hypervariable genes in Grapevine leafroll associated virus 1. Virus Res 80, 109116.[CrossRef][Medline]
Martelli, G. P. & Savino, V. (1990). Fanleaf degeneration. In Compendium of Grape Diseases, pp. 4849. Edited by R. Pearson & A. C. Goheen. St Paul, MN, USA: APS Press.
Mauro, M. C., Toutain, S., Walter, B., Pinck, L., Otten, L., Coutos-Thevenot, P., Deloire, A. & Barbier, P. (1995). High efficiency regeneration of grapevine plants transformed with the GFLV coat protein gene. Plant Sci 112, 97106.[CrossRef]
Mayo, M. A. & Robinson, D. J. (1996). Nepoviruses: molecular biology and replication. In The Plant Viruses, vol. 5: Polyhedral Virions and Bipartite RNA Genomes. Edited by B. D. Harrison & A. F. Murant. New York: Plenum Press.
Meng, B., Zhu, H. & Gonsalves, D. (1999). Rupestris stem pitting associated virus-1 consists of a family of sequence variants. Arch Virol 144, 20712085.[CrossRef][Medline]
Naraghi-Arani, P., Daubert, S. & Rowhani, A. (2001). Quasispecies nature of the genome of Grapevine fanleaf virus. J Gen Virol 82, 17911795.
Nolasco, G. & de Sequeira, O. A. (1993). Genome diversity of field isolates of Grapevine fanleaf virus (GFLV) analyzed by single stranded conformation (SSCP) and restriction fragment length (RFLP) polymorphisms. In Extended Abstracts of the 11th Meeting of the International Council for the Study of Viruses and Virus-like Diseases of the Grapevine, 69 September 1993, Montreux, Switzerland, pp. 3132. Edited by P. Gugerli.
Pinck, L., Fuchs, M., Pinck, M., Ravelonandro, M. & Walter, B. (1988). A satellite RNA in grapevine fanleaf virus strain F13. J Gen Virol 69, 233239.
Raski, D. J., Goheen, A. C., Lider, L. A. & Meredith, C. P. (1983). Strategies against grapevine fanleaf virus and its nematode vector. Plant Dis 67, 335339.
Ritzenthaler, C., Viry, M., Pinck, M., Margis, R., Fuchs, M. & Pinck, L. (1991). Complete nucleotide sequence and genetic organization of grapevine fanleaf nepovirus RNA1. J Gen Virol 72, 23572365.
Ritzenthaler, C., Schmitt, A. C., Michler, P., Stussi-Garaud, C. & Pinck, L. (1995). Grapevine fanleaf nepovirus P38 putative movement protein is located on tubules in vivo. Mol PlantMicrobe Interact 8, 379387.
Rubio, L., Ayllon, M. A., Kong, P., Fernandez, A., Polek, M., Guerri, J., Moreno, P. & Falk, B. W. (2001). Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. J Virol 75, 80548062.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406425.[Abstract]
Sanchez, F., Chay, C., Borja, M. J., Rowhani, A., Romero, J., Bruening, G. & Ponz, F. (1991). cDNA sequence of the capsid protein gene and 3' untranslated region of a fanleaf isolate of grapevine fanleaf virus. Nucleic Acids Res 19, 5440.
Savino, V., Cherif, C. & Martelli, G. P. (1985). A natural serological variant of grapevine fanleaf virus. Phytopathol Mediterr 24, 325328.
Serghini, M. A., Fuchs, M., Pinck, M., Reinbolt, J., Walter, B. & Pinck, L. (1990). RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location. J Gen Virol 71, 14331441.
Shi, B. J., Habili, N. & Symons, R. H. (2003). Nucleotide sequence variation in a small region of the Grapevine fleck virus replicase provides evidence for two sequence variants of the virus. Ann Appl Biol 142, 349355.[CrossRef]
Strimmer, K. & von Haeseler, A. (1996). Quartet puzzling: a quartet maximum-likelihood method for reconstructing tree topologies. Mol Biol Evol 13, 964969.
Szychowski, J. A., McHenry, M. V., Walker, M. A., Walpert, J. A., Credi, R. & Semancik, J. S. (1995). The vein-banding disease syndrome: a synergistic reaction between grapevine viroids and fanleaf virus. Vitis 34, 229232.
Tamura, K. & Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10, 512526.[Abstract]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.
Vigne, E., Komar, V. & Fuchs, M. (2004). Field safety assessment of recombination in transgenic grapevines expressing the coat protein gene of Grapevine fanleaf virus. Transgenic Res 13, 165179.[CrossRef][Medline]
Vuittenez, A., Munck, M. C. & Kuszala, J. (1964). Souches de virus à hautes aggressivité isolées de vignes atteintes de dégénérescence infectieuse. Etud Virol Appl 5, 6978 (in French).
Walter, B. & Etienne, L. (1987). Detection of the grapevine fanleaf viruses away from the period of vegetation. J Phytopathol 120, 355364.
Wetzel, T., Meunier, L., Jaeger, U., Reustle, G. M. & Krczal, G. (2001). Complete nucleotide sequences of the RNAs 2 of German isolates of Grapevine fanleaf virus and Arabis mosaic nepoviruses. Virus Res 75, 139145.[CrossRef][Medline]
Received 15 December 2003;
accepted 17 May 2004.
This article has been cited by other articles:
![]() |
S. Martin, M. L. Garcia, A. Troisi, L. Rubio, G. Legarreta, O. Grau, D. Alioto, P. Moreno, and J. Guerri Genetic variation of populations of Citrus psorosis virus. J. Gen. Virol., October 1, 2006; 87(Pt 10): 3097 - 3102. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Meng, A. R. Rebelo, and H. Fisher Genetic diversity analyses of grapevine Rupestris stem pitting-associated virus reveal distinct population structures in scion versus rootstock varieties J. Gen. Virol., June 1, 2006; 87(6): 1725 - 1733. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Dennehy, N. A. Friedenberg, Y. W. Yang, and P. E. Turner Bacteriophage Migration via Nematode Vectors: Host-Parasite-Consumer Interactions in Laboratory Microcosms. Appl. Envir. Microbiol., March 1, 2006; 72(3): 1974 - 1979. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jridi, J.-F. Martin, V. Marie-Jeanne, G. Labonne, and S. Blanc Distinct Viral Populations Differentiate and Evolve Independently in a Single Perennial Host Plant J. Virol., March 1, 2006; 80(5): 2349 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Rebenstorf, T. Candresse, M. J. Dulucq, C. Buttner, and C. Obermeier Host Species-Dependent Population Structure of a Pollen-Borne Plant Virus, Cherry Leaf Roll Virus J. Virol., March 1, 2006; 80(5): 2453 - 2462. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |