J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 85 (2004), 2435-2445; DOI 10.1099/vir.0.79904-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Tables
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vigne, E.
Right arrow Articles by Fuchs, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vigne, E.
Right arrow Articles by Fuchs, M.
Agricola
Right arrow Articles by Vigne, E.
Right arrow Articles by Fuchs, M.
© 2004 Society for General Microbiology

Population structure and genetic variability within isolates of Grapevine fanleaf virus from a naturally infected vineyard in France: evidence for mixed infection and recombination

Emmanuelle Vigne1, Marc Bergdoll2, Sébastien Guyader3,{dagger} and Marc Fuchs1

1 Institut National de la Recherche Agronomique, Unité Mixte de Recherche Vigne et Vins d'Alsace, Laboratoire de Virologie, 28 rue de Herrlisheim, 68021 Colmar, France
2 Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, 12 rue du Général Zimmer, 67081 Strasbourg, France
3 Institut National de la Recherche Agronomique, Unité Mixte de Recherche Biologie des Organismes et des Populations Appliquées à la Protection des Plantes, BP 35327, 35653 Le Rheu, France

Correspondence
Marc Fuchs
fuchs{at}colmar.inra.fr


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
The nematode-borne Grapevine fanleaf virus, from the genus Nepovirus in the family Comoviridae, causes severe degeneration of grapevines in most vineyards worldwide. We characterized 347 isolates from transgenic and conventional grapevines from two vineyard sites in the Champagne region of France for their molecular variant composition. The population structure and genetic diversity were examined in the coat protein gene by IC-RT-PCR-RFLP analysis with EcoRI and StyI, and nucleotide sequencing, respectively. RFLP data suggested that 55 % (191 of 347) of the isolates had a population structure consisting of one predominant variant. Sequencing data of 51 isolates representing the different restrictotypes confirmed the existence of mixed infection with a frequency of 33 % (17 of 51) and showed two major predominant haplotypes representing 71 % (60 of 85) of the sequence variants. Comparative nucleotide diversity among population subsets implied a lack of genetic differentiation according to host (transgenic vs conventional) or field site for most restrictotypes (17 of 18 and 13 of 18) and for haplotypes in most phylogenetic groups (seven of eight and six of eight), respectively. Interestingly, five of the 85 haplotypes sequenced had an intermediate divergence (0·036–0·066) between the lower (0·005–0·028) and upper range (0·083–0·138) of nucleotide variability, suggesting the occurrence of homologous RNA recombination. Sequence alignments clearly indicated a mosaic structure for four of these five variants, for which recombination sites were identified and parental lineages proposed. This is the first in-depth characterization of the population structure and genetic diversity in a nepovirus.

The GenBank accession numbers of the novel GFLV sequences reported in this paper are AY370941AY371027.

Supplementary tables showing characteristics of RFLP groups, oligonucleotide sequences and nucleotide and amino acid sequence identities are available in JGV Online.

{dagger}Present address: Department of Biology, University of North Carolina, CB # 3280, Coker Hall, Chapel Hill, NC 27599, USA. Back


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Grapevine fanleaf virus (GFLV) is responsible for fanleaf degeneration, which is the most severe viral disease of grapevines (Vitis spp.) (Martelli & Savino, 1990Down). GFLV occurs in most vineyards worldwide and causes important economic losses by reducing yield, lowering fruit quality and substantially reducing the longevity of grapevines. GFLV isolates differing in type of leaf symptoms, ranging from fanleaf to yellow mosaic, vein banding, line pattern, chlorotic ringspots and mottle, have been described in numerous grapevine varieties in several countries (Martelli & Savino, 1990Down). Similarly, isolates differing in type and severity of symptoms have been described in herbaceous hosts (Huss et al., 1989Down; Vuittenez et al., 1964Down). GFLV is specifically transmitted from grapevine to grapevine by the ectoparasitic nematode species Xiphinema index (Hewitt et al., 1958Down). Current strategies to control GFLV rely on cultural practices, including uprooting and soil disinfection with nematicides, and prolonged fallow periods. These approaches are of limited efficacy and are not environmentally friendly (Raski et al., 1983Down).

GFLV belongs to the plant virus genus Nepovirus in the family Comoviridae (Mayo & Robinson, 1996Down). The genome of GFLV is bipartite and composed of two single-stranded positive-sense RNAs, called RNA1 and RNA 2, which carry a small genome-linked protein or VPg at their 5' ends and a poly(A) stretch at their 3' extremities (Pinck et al., 1988Down) (Fig. 1aDown). Each genomic RNA encodes a polyprotein from which functional proteins are released by proteolytic processing at defined dipeptide cleavage sites (Fig. 1aDown). RNA1 encodes the proteinase, which matures the polyproteins in cis and in trans, and the replicative functions (Ritzenthaler et al., 1991Down) (Fig. 1aDown). RNA2 encodes protein 2A which is essential for RNA2 replication (Gaire et al., 1999Down), protein 2BMP (movement protein) which forms tubules through which virions move from cell to cell within plasmodesmata (Ritzenthaler et al., 1995Down), and the 56 kDa coat protein 2CCP which assembles into icosahedral particles (Serghini et al., 1990Down) (Fig. 1aDown).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. (a) Genome organization and expression of GFLV strain F13. Open boxes represent open reading frames, the 5' and 3' untranslated regions are denoted by horizontal lines, and the VPg is represented by a closed circle. The processed proteins are indicated within the polyproteins encoded by the two genomic RNAs: Pol, RNA-dependent RNA polymerase; Pro, proteinase; VPg, viral genome-linked protein; CP, coat protein; MP, movement protein. The cleavage sites are indicated in italics below the polyproteins. (b) EcoRI and (c) StyI RFLP analysis of the CP gene amplicon of selected GFLV isolates with a population structure consisting of a single dominant variant (lanes 4–7) or multiple variants (lanes 8–11). GFLV isolates correspond to the following RFLP patterns: lane 4, A9 from RFLP group 2; 5, A13 from RFLP group 4; 6, A10 from RFLP group 5; 7, A11 from RFLP group 10; 8, A17 from RFLP group 12; 9, A20 from RFLP group 12; 10, A40 from RFLP group 12 and 11, A34 from RFLP group 12. Lanes 2 and 12 are undigested and digested GFLV strain F13, respectively, lane 1 is a healthy plant and lane 3 is a 100 bp DNA size standard.

 
A certain degree of variability in the GFLV genome was suggested by restriction fragment length polymorphism (RFLP) and single stranded conformation polymorphism analysis of the 5' end of the CP gene (Nolasco & de Sequeira, 1993Down). Variability was further ascertained by complete or partial sequencing of the CP gene of several isolates from Europe, America, Africa and the People's Republic of China (Brandt et al., 1995Down; Fajardo et al., 2001Down; Hancheng et al., 1996Down; Naraghi-Arani et al., 2001Down; Sanchez et al., 1991Down; Serghini et al., 1990Down; Wetzel et al., 2001Down; GenBank accession numbers AY525605 and AY525606). Recently, Naraghi-Arani et al. (2001)Down studied the genetic variability of 14 GFLV isolates from eight California vineyards by IC-RT-PCR-RFLP and sequencing, and reported on CP gene divergence at the nucleotide (13 %) and amino acids (9 %) levels. More recently, we conducted a comparative molecular analysis of isolates from a naturally infected vineyard in the Champagne region of France where conventional and transgenic grapevines expressing a GFLV CP gene construct were tested (Vigne et al., 2004Down). No significant difference in CP gene variability was detected at the nucleotide level between isolates from transgenic (190 isolates) vs conventional (157 isolates) plants, and no viable GFLV recombinant with characteristics typical of the CP transgene mRNAs was detected among the 347 isolates surveyed.

The present study expands on our previous work (Vigne et al., 2004Down) by examining the population structure and genetic diversity within 347 GFLV isolates that challenged transgenic and conventional grapevines, using IC-RT-PCR-RFLP and sequence analysis of the CP gene. We found that the majority of isolates (55 %, 191 of 347) had a population structure consisting of one major variant. Sequencing data of a subsample of 51 isolates representing the different restrictotypes demonstrated the existence of mixed infection with at least two genetically distinct variants, at a frequency of 33 % (17 of 51). No correlation was observed between CP gene variation and host plant (transgenic vs conventional) or field site for most restrictotypes and for haplotypes in most phylogenetic groups. The characteristics of five GFLV hybrid variants that developed through distinct recombination events in the coding region of the CP gene in the absence of selective constraints against the recombinants are described. This study provides new insights into the population structure and genetic diversity within GFLV isolates, which are relevant for designing alternative control strategies against this detrimental grapevine virus.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
GFLV isolates and sample collection.
The GFLV isolates used in this study were collected in two distinct field sites, designated A and B that were 500 m apart in a naturally infected vineyard in the Champagne region of France. Test plants consisted of Chardonnay scions grafted onto rootstocks SO4 (V. berlandierixV. riparia), 41B (V. viniferaxV. berlandieri) or 420A (V. berlandierixV. riparia) (Vigne et al., 2004Down). Some of the 41B and SO4 rootstocks were engineered to express the CP gene of GFLV strain F13 (Mauro et al., 1995Down). Leaf samples were collected from each plant in the two field sites and from plants in close spatial surroundings (Vigne et al., 2004Down). We considered a GFLV isolate as a viral culture derived from a single infected test plant.

DAS-ELISA and IC-RT-PCR.
GFLV was detected in leaf samples of individual vines by double antibody sandwich (DAS) enzyme-linked immunosorbent assay (ELISA) (Walter & Etienne, 1987Down). The CP gene of GFLV isolates was further amplified by IC-RT-PCR assays using leaf samples that reacted positively in DAS-ELISA (Vigne et al., 2004Down). Briefly, GFLV particles were immunocaptured on microtitre plates with immunoglobulins and denatured for 10 min at 70 °C. Viral RNAs were used as template for RT-PCR with 15 U AMV reverse transcriptase (Promega) and primer EV00N1 5'-3574GACTATCTAGACACATATATACACTTGGGTCTTTTAA3601-3' (with an additional XbaI site underlined) in a final volume of 20 µl. PCR was performed in a 50 µl volume containing 2·5 µl of the RT solution, 5 µl 10x Taq buffer, 3 µl 25 mM MgCl2, 0·2 mM each dNTP, 50 pmoles each primer, EV00N3 5'-2045ACTGTCTAGAGGATTRGCYGGYAGAGGAGT2067-3' (with an additional XbaI site underlined) and EV00N1 and 2 units Taq DNA polymerase (Promega). The samples were incubated first at 94 °C for 3 min, followed by 30 cycles of 94 °C (30 sec), 55 °C (60 sec) and 72 °C (90 sec) with a final 3 min extension at 72 °C.

RFLP analysis, cDNA cloning and sequencing.
The IC-RT-PCR-amplified DNA products corresponding to the CP gene of GFLV isolates from test plants were characterized by RFLP using EcoRI and StyI (Vigne et al., 2004Down). DNA digests were analysed by electrophoresis on 1·5 % agarose gels. RT-PCR products were subsequently cloned into the pGEM-3Zf(+) vector (Promega) using T4 DNA ligase after digestion with XbaI (Promega), followed by transformation into Escherichia coli DH5{alpha}. Selected clones were sequenced on both strands using an ABI DNA sequencer 373 (Perkin-Elmer) at the sequencing facility of the Institut de Biologie Moléculaire des Plantes, in Strasbourg, France. The rate of intra- and inter-clonal nucleotide variability was determined in three independent experiments by sequencing at least two clones corresponding to the PCR products of GFLV strain F13 (Serghini et al., 1990Down; accession number X16907) and isolate A15a selected for this study (accession no. AY370954) (Vigne et al., 2004Down).

Nucleotide and amino acid sequence analyses.
Nucleotide and amino acid sequences were analysed using the University of Wisconsin Genetics Computer Group version 10.2 and Vector NTI sequence analysis software packages. The program CLUSTAL W was used for alignment of nucleotide sequences (Thompson et al., 1994Down) and the distance matrix based on Jukes and Cantor's model was used to estimate nucleotide divergence. The phylogenetic relationships were determined with neighbour-joining (NJ) (Saitou & Nei, 1987Down). The robustness of the inferred evolutionary relationships was assessed by 1000 bootstrap replicates. Phylogenetic relationships were also determined with the maximum-likelihood (ML) algorithm of TREE-PUZZLE version 5.0 (Strimmer & von Haeseler, 1996Down). Branches with a reliability percentage <50 were collapsed. The substitution model of Tamura & Nei (1993)Down was used and the shape parameters, including the transition to transversion ratio with an eight category gamma distribution, were estimated during the tree reconstruction. The occurrence of suspected recombination events was confirmed with the program SISCAN version 2.0 (Gibbs et al., 2000Down). This algorithm calculates Z values for pairwise identity scores of aligned sequences of the putative recombinant and its two putative parents within a sliding window (in our case, 100 or 250 nt) that moves by steps of 50 nt by using 250 equivalent randomized sequences.

Nucleotide sequence accession numbers.
Sequencing data identified 85 haplotypes, i.e. sequence variants, associated with the 51 GFLV isolates analysed in this study, 35 from field A (GenBank accession nos AY370941AY370997 and AY371027) and 16 from field B (GenBank accession nos AY370998AY371024). The CP gene sequences of GFLV isolates b844 from France and GHu from Hungary, which were determined in this study, have been made available in GenBank (accession nos AY371025 and AY371026, respectively). Other GFLV CP nucleotide sequences used in our analyses were from the following GenBank entries: isolate AU (U11768) from Austria (Brandt et al., 1995Down), isolate Ca100 (X60775) from California (Sanchez et al., 1991Down), strain F13 (X16907) from Frontignan, France (Serghini et al., 1990Down), isolate Ha (AJ318415) from Hangzhou, The People's Republic of China and isolate NW (AY017339) from Neustadt-an-der-Weinstrasse, Germany (Wetzel et al., 2001Down). The nucleotide sequence of isolate Gh from the People's Republic of China (Hancheng et al., 1996Down) was also used in this study.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Population structure of GFLV isolates
The population structure of 347 GFLV isolates from two field sites, designated A and B, from a Chardonnay vineyard in the Champagne region in France was investigated by IC-RT-PCR-RFLP analysis of the CP gene. Some of the isolates tested originated from transgenic grapevines expressing a GFLV CP gene (190 isolates) and others were from non-transgenic grapevines (157 isolates). Transgenic and conventional grapevines were exposed to Xiphinema index-mediated GFLV infection (Vigne et al., 2004Down). The primers used in RT-PCR assays were designed from nucleotide sequences conserved in the two GFLV isolates for which the complete CP gene and 3' untranslated regions are known (Serghini et al., 1990Down; Wetzel et al., 2001Down), in order to minimize primer-oriented selection of sequence variants within an isolate. EcoRI and StyI RFLP data indicated that the majority (55 %, 191 of 347) of GFLV isolates tested had well-defined patterns, for which the combined size of DNA digest fragments accounted for the expected 1573 bp fragment of the CP gene amplicon (Fig. 1b and 1cUp, lanes 4–7), indicating a population structure with one predominant restrictotype. Based on the number and size of EcoRI and StyI bands, these 191 isolates were classified into 11 distinct groups whose characteristics are described in Supplementary Table A, which is available as supplementary data in JGV Online. The remaining GFLV isolates tested (45 %, 156 of 347) had more complex banding patterns. The combined size of their DNA digests often exceeded the expected size of the CP gene amplicon (1573 bp), suggesting that the corresponding RT-PCR products probably represented a population structure with at least two distinct restrictotypes (Fig. 1b and 1cUp, lanes 8–11). The latter isolates were classified in RFLP group 12 (Supplementary Table A). Most restrictotypes were detected in transgenic and conventional plants, except restrictotypes 3 and 6, which were only found in conventional plants. Furthermore, all restrictotypes were present in field A but several of them were not found in field B, most likely because of the smaller sample size (70 vs 277 plants). Chi-squared association tests ({chi}2) using contingency tables indicated that the frequency distribution of restrictotypes 1–11 was independent of host (P=0·47), except for restrictotype 9, which was present at a higher frequency in conventional plants. Similar results were obtained if restrictotype 12 was included in the analysis. Furthermore, the frequency distribution of most restrictotypes (3, 6, 7, 8, 9, 11 and 12) was independent of field site (P=0·22), except for restrictotypes 1 and 2, which were present at a higher frequency in field B, and for restrictotypes 4, 5 and 10, which were present at a higher frequency in field A.

A subsample of 51 out of the 347 GFLV isolates typified by RFLP was selected for further characterization. These 51 isolates were from transgenic (27 isolates) or conventional (24 isolates) grapevines, and from field A (35 isolates) or B (16 isolates) (Table 1Down). They represented the different restrictotypes identified, with some of them (43 %, 22 of 51) belonging to RFLP groups 1–11 and others (57 %, 29 of 51) to RFLP group 12. A closer analysis of the restriction patterns of the latter subset of isolates further indicated that seven of these 29 isolates had major restrictotypes that were different from those in RFLP groups 1–11, whereas 22 of them had more complex patterns, probably corresponding to a mixture of several restrictotypes. These 29 isolates were classified in RFLP subgroups 12{alpha} to 12{gamma} (Table 2Down). Altogether, our typification assays indicated that the majority (57 %, 29 of 51) of the subsample of 51 isolates had a population structure with one predominant variant, whereas 43 % (22 of 51) of them were probably composed of at least two genetically related variants (Table 2Down). {chi}2 analysis indicated that the frequency distribution of the different restrictotypes was independent of host (transgenic vs conventional) (P=0·45) or field site (A vs B) (P=0·60) (Table 2Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Origin of the 51 GFLV isolates characterized by IC-RT-PCR-RFLP and nucleotide sequencing

Field sites A and B were 500 m apart in a naturally GFLV-infected vineyard in the Champagne region of France (Vigne et al., 2004Down). Test plants consisted of conventional V. vinifera cv Chardonnay grafted onto either transgenic rootstocks 41B or SO4 expressing the coat protein gene of GFLV strain F13 (Mauro et al., 1995Down), or conventional rootstocks 41B or SO4. Test plants were exposed to GFLV infection via X. index nematodes.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Distribution of the 51 GFLV isolates into 18 distinct RFLP groups

 
Genetic diversity within and between GFLV isolates
The genetic diversity within and between GFLV isolates was analysed by sequencing the CP gene of the subsample of 51 isolates using eight different oligonucleotides (Supplementary Table B, which is available as supplementary data in JGV Online). The nucleotide sequence determined represented 40 % (1515 of 3774 nt) of GFLV RNA2 (Serghini et al., 1990Down; Wetzel et al., 2001Down). PCR products were first cloned and then sequenced to identify haplotype-specific rather than consensus sequences, which would have been obtained by directly sequencing PCR products. The robustness of our approach was illustrated by identical RFLP patterns found before and after cloning of the CP gene amplicons, and by limited intra-clonal (0·0022±0·0012) and inter-clonal (0·0035±0·0026) nucleotide variability obtained after sequencing at least two independent clones in three separate experiments. These data demonstrate that very low nucleotide variation was added as an artefact of RT-PCR. Based on these results, only one clone of each restrictotype was sequenced on both strands per isolate. No sequence editing was necessary because no stop codons, deletions or insertions were obtained in any of the sequences.

Sequencing data identified 85 distinct variants associated with the 51 GFLV isolates sequenced. A multiple sequence alignment was used to determine nucleotide diversity within and between subsets of haplotype populations. As expected, heterogeneity within haplotype subsets was low (0·005–0·028) and heterogeneity between haplotype subsets was high (0·083–0·138) at the nucleotide level (Supplementary Table C, which is available as supplementary data in JGV Online). Similar data were obtained at the amino acid level with limited within (0·002–0·034), and higher between (0·024–0·069), population heterogeneity. Phylogenetic relationships were inferred using the NJ and ML methods for the 85 sequences, together with 6 sequences available in GenBank and 2 additional sequences (b844 and GHu) which were characterized in this study. Trees calculated with the NJ and ML methods were closely similar, with the 93 GFLV CP gene haplotypes falling into nine consistent groups, designated A–I (Fig. 2Down). The variants from the Chardonnay vineyard clustered into eight of these groups (A–E and G–I) and the two variants from China fell into group F (Fig. 2Down). The majority of 85 haplotypes from the Chardonnay vineyard belonged to groups A (36 %, 31 of 85) and B (34 %, 29 of 85) (Fig. 2Down). Group I had nine haplotypes (11 %) and the four next more frequent groups (C, E, G and H) had 4–5 % (3 to 4 haplotypes) of the population each, while group D had only two haplotypes (2 %) (Fig. 2Down). Some haplotypes were only present in transgenic (those in groups D and G) or in conventional (those in group H) plants, and almost all haplotypes, except those in group H, were present in field A, while a few (those in groups D, E and G) were missing from field B, probably because of the smaller number of isolates (27 vs 58) (Fig. 2Down). {chi}2 analysis indicated that the frequency distribution of haplotypes in most phylogenetic groups was independent of host (P=0·12), except for those in group A, which were present at a higher frequency in transgenic plants. Also, the frequency distribution of haplotypes in most phylogenetic groups was independent of field site (P=0·60), except for those in groups H and I that were present at a higher frequency in field B. Interestingly, no dependency on field site was found if haplotypes related to mixed infection were omitted in contingency tables analysed by {chi}2 distribution (P=0·85).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. ML unrooted phylogenetic tree reconstructed from the complete nucleotide sequence of the CP gene of 93 GFLV variants, including 85 from a Chardonnay vineyard in France and eight from various geographical origins (b844 from France, GHu from Hungary, Au from Austria, Ca100 from California, F13 from France, NW from Germany and Gh and Ha from China) using TREE-PUZZLE version 5.0. The numbers above the branches are reliability percentages computed after 10 000 quartet puzzling steps (only percentages greater than 50 % are represented). The numbers below critical branches are significant boostrap values (%) obtained by the NJ method. Branch length represents phylogenetic distances determined with distance matrices of nucleotide sequences. Ellipses correspond to the nine groups identified (A–I). The ML scale bar represents a relative genetic distance of 0·1. Arrows indicate putative recombinants, which are also in bold and surrounded by a second-order ellipse within their groups. The field origin (A or B) and isolate number is indicated for each haplotype. For example, A40a is haplotype a of isolate A40 from field A. Haplotypes from transgenic and conventional grapevines are shown in red and blue, respectively.

 
Lack of genetic differentiation according to host plant or field site
To assess a correlation between nucleotide variability and host plant or field site, the sequences of the ten isolates with single haplotypes from the most prevalent phylogenetic group A were compared (Table 3Down). These ten isolates represented single infection and consisted of four subpopulations from either transgenic (six isolates) or conventional (four isolates) grapevines, and from field A (seven isolates) and B (three isolates). Remarkably, the genetic divergence between haplotypes both within and between subpopulations was very small, suggesting no genetic differentiation according to host or site (Table 3Down). {chi}2 analysis further indicated that the frequency distribution of haplotypes was independent of host (P=0·95) or field site (P=0·95). In addition, there was no apparent correlation between the geographic origin of the GFLV isolates and their nucleotide distance. For example, isolate GHu from Hungary branched with variants from the Chardonnay vineyard in France in phylogenetic group G (Fig. 2Up). Isolate Ca100 from California fell with isolates Au from Austria, NW from Germany and b844 and F13 from France (Fig. 2Up). Also, the same magnitude of divergence was observed among the 85 variants from the Chardonnay vineyard in France (groups A–E and G–I) and the six variants from distant geographical origins (Supplementary Table C).


View this table:
[in this window]
[in a new window]
 
Table 3. Nucleotide divergence in the CP gene within and between four subsets of GFLV haplotype populations of phylogenetic group A

The sequences of ten haplotypes representing single infections were analysed. Seven isolates (A10a, A11a, A15a, A16a, A18a, A28b, A33a) were from field A and three isolates (B8a, B9a, B18a) were from field B. Among these variants, six were from transgenic (A10a, A15a, A18a, A33a, B9a, B18a) and four were from conventional (A11a, A16a, A28b, B8b) grapevines. Chi-squared analysis of RxC contingency tables indicated that the frequency distribution of these ten haplotypes was not dependent on field site (A vs B) (P=0·95) or host plant (conventional vs transgenic) (P=0·95).

 
Occurrence of GFLV mixed infection
Phylogenetic analysis further indicated that some of the 51 GFLV isolates sequenced showed a high intra-isolate genetic diversity, as they had haplotypes more genetically similar to those of other isolates than to other haplotypes from the same isolate (Fig. 2Up). These observations confirmed the existence of mixed infection. For example, haplotypes from isolate A7 were found in clusters A and B. Also, haplotypes of isolate B13 were found in clusters B and I. A similar frequency of mixed infection was determined in transgenic (48 %, 13 of 27) vs conventional (38 %, 9 of 24) grapevines (P=0·35), and in field A (45 %, 10 of 22) vs B (50 %, 8 of 16) (P=0·49), indicating that mixed infection was independent of host plant or field site (Table 4Down). Mixed infection by two or more divergent variants occurred at a frequency of 33 % (17 of 51) (Table 4Down). Interestingly, isolate A17 had four haplotypes of three different phylogenetic groups (A17a of group A, A17b and A17c of group B and A17d of group E) and isolate B6 had two haplotypes of group H (B6a and B6d) and two haplotypes of group I (B6b and B6f) (Table 5Down). In addition, 15 isolates had mixtures of haplotypes of two distinct phylogenetic groups, mainly A and B (7 isolates), and also to a lesser extent, of B and I (3 isolates), A and D (2 isolates) or A and E, A and G, A and I and H and I, with one isolate each (Table 5Down). Also, 5 of the 51 isolates (10 %) had two haplotypes of either group A or group B. Interestingly, mixed infection systematically involved one haplotype of group A in isolates from field A, and one haplotype of group I in isolates from field B (Table 5Down).


View this table:
[in this window]
[in a new window]
 
Table 4. Distribution of 51 GFLV isolates with single and mixed infection according to host plant and field site

 

View this table:
[in this window]
[in a new window]
 
Table 5. Haplotype composition of 22 GFLV isolates with multiple genetically distinct variants

 
Identification of GFLV recombinants
Five of the haplotypes sequenced in this study (A17a, A17b, B2a, B6b and B6f) were outliers within their own phylogenetic groups, suggesting the occurrence of recombination (Fig. 2Up). Remarkably, the five recombinants were detected in conventional grapevines. Analysis of multiple nucleotide sequence alignments by the program SISCAN clearly indicated a mosaic structure for four (A17a, A17b, B6b and B6f) of these five variants (Fig. 3a, bDown). The chimeric nature of haplotype A17b, an outlier within group B, was established based on molecular features typical of haplotype A17a from group A in the 5' part of the CP sequence, and of haplotype A17c from group B in the 3' part (Fig. 3aDown). Also, haplotype A17a, an outlier within group A, shares some molecular features typical of any variant of group A (for example A6f) in the 5' and central parts, but is more related to haplotype A17d of group E in the 3' part of the CP gene (Fig. 3aDown). In addition, haplotype B6b, an outlier within group I, contains nucleotide sequences of haplotype B6a from group H at the 5' end joined to nucleotide sequences of any representative of group I (for example haplotype B3a) in the remaining part of the CP gene (Fig. 3bDown). Similarly, haplotype B6f, another outlier within group I, has striking identical features in common with haplotype B6a from group H in the 5' part and with haplotype B3a from group I in the remaining part of the CP gene (Fig. 3bDown). For haplotype B2a, an outlier within group C, a recombination event between a representative of groups C and A (A22 and A39a for example, respectively) could be hypothesized on a short stretch of sequence, although with a weak support (low Z-value) (Fig. 3cDown). Attempts to identify putative parental lineages with a representative of group C, to which recombinant B2a belongs, or any of the other groups were unsuccessful.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. Analysis of aligned nucleotide sequences of the CP gene of GFLV variants in plants (a) A17, (b) B6 and (c) B2 using the SISCAN program. The window covered 250 (a, b) or 100 (c) nt positions and moved through the alignment with a step size of 50 nt. Graphs are based on Z values using the total nucleotide identity scores. Values are shown for the comparative nucleotide sequences of (a) recombinant A17b with recombinant A17a ({blacksquare}) and variant A17c ({square}), and recombinant A17a with variants A6f ({bullet}) and A17d ({circ}); (b) recombinant B6b with variants B6a ({blacksquare}) and B3a ({square}), and recombinant B6f with variants B6a ({bullet}) and B3a ({circ}); and (c) recombinant B2a with variants A22a ({blacksquare}) and A39a ({square}).

 
Interestingly, plant A17 hosted two recombinants, one (haplotype A17b) which could derive by recombination between haplotypes A17a and A17c, and one (haplotype A17a) which could derive by recombination between haplotypes A17d and A6f or any other haplotype from group A. It is noteworthy that haplotype A17a not only was a recombinant, but could be one of the parents of recombinant A17b.

Putative recombination sites were searched based on sequences with no definite relatedness signals between the recombinants and their two parents. Interestingly, cross-over sites were identified at different locations for the five recombinants: nt 425–446 for A17b, 1137–1138 for A17a, 283–294 for B6b, 618–638 for B6f and 818–849 for B2a. To examine whether amino acid stretches corresponding to these recombination sites map to certain structures on the GFLV capsid, we examined a 3D model recently constructed in our laboratory (M. Bergdoll and M. Fuchs, unpublished results) from the crystal structure of Tobacco ringspot virus (Chandrasekar & Johnson, 1997Down), the type member of the genus Nepovirus. Our structural studies mapped the putative recombination sites to the three encoded trapezoid-shaped {beta}-barrel domains of the CP: domain C for recombinants A17b and B6b, domain B for recombinants B6f and B2a and domain A for recombinant A17a (data not shown).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Plant RNA viruses, in particular those like GFLV that infect perennial crops, have a great potential for genetic variation, because they infect their host for long periods of time and their replication process is error-prone, since no proof-reading correction mechanism is associated with their RNA-dependent RNA polymerase. Consequently, each viral isolate is expected to consist of a population of genetically related variants, termed quasispecies (Garcia-Arenal et al., 2001Down). A number of GFLV isolates with distinct biological, serological and molecular characteristics have been reported from various viticulture regions of the world (Brandt et al., 1995Down; Hancheng et al., 1996Down; Huss et al., 1987Down, 1989Down; Martelli & Savino, 1990Down; Naraghi-Arani et al., 2001Down; Nolasco & de Sequeira, 1993Down; Sanchez et al., 1991Down; Savino et al., 1985Down; Szychowski et al., 1995Down; Vuittenez et al., 1964Down; Wetzel et al., 2001Down). To explain the changes in GFLV properties it has been suggested that individual field isolates may contain multiple molecular variants that eventually can be separated after passages to different host species or by vector transmission. This prediction was recently demonstrated with a limited number of GFLV isolates from eight California vineyards (Naraghi-Arani et al., 2001Down).

In our study, we used RFLP analysis and sequencing to estimate the population structure and genetic diversity within 347 naturally occurring GFLV isolates from a Chardonnay vineyard in the Champagne region of France. Analysis of the CP gene in a subsample of 51 isolates indicated 18 distinct restrictotypes and eight phylogenetic groups for 85 sequence variants, of which some were dominant in the population. The variability of the CP gene found at the nucleotide level (0·002–0·138) for the 85 GFLV variants is within the range described for the structural protein or other protein open reading frames of numerous other plant viruses (0·002–0·224) (Garcia-Arenal et al., 2001Down).

Remarkably, seven plants were infected by three to five distinct variants that belonged to two or three phylogenetic groups, demonstrating that some variant populations were likely to have originated from mixed infection by two or more divergent GFLV isolates through successive infections by variants of different groups. For instance, plant A30 was hosting haplotypes from phylogenetic groups A and G. It is conceivable that the mixture of haplotypes in plant A30 could result from infection first with haplotypes of cluster A and then with haplotypes of cluster G, or vice-versa. The fact that heterogeneous populations of GFLV variants in a single vine (this study; Naraghi-Arani et al., 2001Down) are likely to result from isolate mixing due to repeated transmissions of individual variants by viruliferous nematodes is in agreement with the constant exposure of grapevines to Xiphinema index vectors for long periods of time (usually 30–40 years). In addition, mixed infections are common in grapevines and the occurrence of multiple variants has been reported for several viruses other than GFLV (Goszczynski & Jooste, 2003Down; Little et al., 2001Down; Meng et al., 1999Down; Shi et al., 2003Down). Viticulture practices such as vegetative propagation and grafting can also contribute to the simultaneous presence of multiple variants in a single vine, although GFLV-free certified material was used in the Chardonnay vineyard selected for this study.

The genetic structure described here suggests a displacement of some GFLV isolates among geographically isolated populations, since isolates from various regions distant by several hundreds or thousands of kilometres had identical genetic structure. For example, the same percentage of diversity was obtained among variants from the Champagne region and other viticultural regions (F13 and b844) in France. Similarly, the same magnitude of diversity was obtained among variants from several European countries (Austria, Germany, Hungary, France), The People's Republic of China (Gh and Ha) and the USA (Ca100). The fact that some variants were not distributed according to their geographic origin indicates a single undifferentiated population. These findings are probably explained by the intense exchange of grapevine propagation material, including GFLV-infected material, between distant regions of the world. Interestingly, a lack of correlation between genetic and geographic proximity was also reported for two viruses that infect perennial crops like GFLV: Tobacco mild green mosaic virus (TMGMV) in Nicotiana glauca (Fraile et al., 1996Down) and Citrus tristeza virus (CTV) in citrus species (Albiach-Marti et al., 2000Down; Rubio et al., 2001Down). A probable hypothesis for this phenomenon is functional constraints to genetic divergence. In addition, the vegetative propagation of grapevine clonal material may create a genetically homogeneous environment at the plant level that could favour GFLV optimization and stability, as shown for Potato leafroll virus in potato (Guyader & Giblot Ducray, 2002Down).

Recombination has been suspected previously in some nepovirus species based on sequence data (Mayo & Robinson, 1996Down). Experimental evidence was obtained by Le Gall et al. (1995)Down who showed template switching in the 3' untranslated region of pseudorecombinants constituted by RNA1 of Grapevine chrome mosaic virus and RNA2 of Tomato black ring virus. Although described for numerous viruses (Aaziz & Tepfer, 1999Down; Garcia-Arenal et al., 2001Down), the natural occurrence of recombination was only recently reported for the first time in the CP of the nepovirus GFLV (Vigne et al., 2004Down). Our observations indicate that recombination was achieved in the absence of strong, if any, selective pressure against hybrid variants in the CP gene. Indeed, all the conventional and the majority of transgenic grapevines tested were susceptible to GFLV (Vigne et al., 2004Down). Therefore, no resistance-driven selective pressure was imposed on the GFLV isolates. Nevertheless, the fitness of some of the GFLV recombinants is under investigation in our laboratory, since they may have similar characteristics as their parental lineages or new biological properties such as changes in vector specificity, expanded host range, and/or increased pathogenicity (Aaziz & Tepfer, 1999Down; Garcia-Arenal et al., 2001Down).

There is apparently a strong genetic stability in the GFLV CP gene. Indeed, the divergence at the nucleotide level (0·002–0·138) found in 93 variants translates into limited divergence at the amino acid level (0·002–0·069) (Supplementary Table C). The CP has constraints related to particle structure and stability, cell-to-cell and long-distance movement (Belin et al., 1999Down) and interaction with the host and nematode vector (Andret-Link et al., 2004Down). Thus, the emergence of GFLV recombinants in the CP domain is likely to have occurred because the amino acids that are highly critical for these important functions were not affected. This hypothesis is supported by the fact that recombination events occurred in the three, and not only in one, encoded {beta}-barrel domains of the predicted capsid structure. Selection constraints on the CP amino acid sequences and global sequence stability imply a negative-selection evolutionary model for GFLV, as demonstrated for other viruses (Azzam et al., 2000Down; Glais et al., 2002Down).

Our study provided new insights into the GFLV population structure, genetic relationship and diversity between variants. This knowledge will help us to understand the complexity of GFLV better and consequently design effective and environmentally sound strategies to control this detrimental grapevine virus based on cross protection with genetically engineered mild strains and post-transcriptional RNA silencing-mediated transgenic resistance.


   ACKNOWLEDGEMENTS
 
This work was partially supported by a competitive grant from the European Commission (Environmental impact assessment of transgenic grapevines and plums on the diversity and dynamics of virus populations, QLK3-CT-2002-02140). We are grateful to Professor J. Guern and Drs L. M. Yepes and G. Demangeat for critically reading the manuscript. We are also indebted to Dr L. M. Yepes for the statistical analyses.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Aaziz, R. & Tepfer, M. (1999). Recombination in RNA viruses and in virus-resistant transgenic plants. J Gen Virol 80, 1339–1346.[Medline]

Albiach-Marti, M. R., Mawassi, M., Gowda, S. & 11 other authors (2000). Sequences of Citrus tristeza virus separated in time and space are essentially identical. J Virol 74, 6856–6865.[Abstract/Free Full Text]

Andret-Link, P., Schmitt-Keichinger, C., Demangeat, G., Komar, V. & Fuchs, M. (2004). The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein. Virology 320, 12–22.[CrossRef][Medline]

Azzam, O., Yambao, M. L. M., Muhsin, M., McNally, K. L. & Umadhay, K. M. L. (2000). Genetic diversity of rice tungro spherical virus in tungro-endemic provinces of the Philippines and Indonesia. Arch Virol 145, 1183–1197.[CrossRef][Medline]

Belin, C., Schmitt, C., Gaire, F., Walter, B., Demangeat, G. & Pinck, L. (1999). The nine C-terminal residues of grapevine fanleaf nepovirus movement protein are critical for systemic virus spread. J Gen Virol 80, 1347–1356.[Abstract]

Brandt, S., Ibl, M. & Himmler, G. (1995). Coat protein gene sequence of an Austrian isolate of grapevine fanleaf virus. Arch Virol 140, 157–164.[CrossRef][Medline]

Chandrasekar, V. & Johnson, J. E. (1998). The structure of tobacco ringspot virus: a link in the evolution of icosahedral capsids in the picornavirus superfamily. Structure 6, 157–171.[Medline]

Fajardo, T. V. M., Kuhn, G. B., Eiras, M. & Nickel, O. (2001). Partial characterization of an isolate of Grapevine fanleaf virus. Fitopatol Bras 26, 505–511.

Fraile, A., Malpica, J. M., Aranda, M. A., Rodriguez-Cerezo, E. & Garcia-Arenal, F. (1996). Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 223, 148–155.[CrossRef][Medline]

Gaire, F., Schmitt, C., Stussi-Garaud, C., Pinck, L. & Ritzenthaler, C. (1999). Protein 2A of grapevine fanleaf nepovirus is implicated in RNA2 replication and colocalizes to the replication site. Virology 264, 25–36.[CrossRef][Medline]

Garcia-Arenal, F., Fraile, A. & Malpica, J. M. (2001). Variability and genetic structure of plant virus populations. Annu Rev Phytopathol 39, 157–186.[CrossRef][Medline]

Gibbs, M. J., Armstrong, J. S. & Gibbs, A. J. (2000). Sister-scanning: a Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 16, 573–582.[Abstract/Free Full Text]

Glais, L., Tribodet, M. & Kerlan, C. (2002). Genomic variability in Potato potyvirus Y (PVY): evidence that PVYNW and PVYNTN variants are single to multiple recombinants between PVYO and PVYN isolates. Arch Virol 147, 363–378.[CrossRef][Medline]

Goszczynski, D. E. & Jooste, A. E. C. (2003). Identification of grapevines infected with divergent variants of Grapevine virus A using variant-specific RT-PCR. J Virol Methods 112, 157–164.[CrossRef][Medline]

Guyader, S. & Giblot Ducray, D. (2002). Sequence analysis of Potato leafroll virus isolates reveals genetic stability, major evolutionary events and differential selection pressure between overlapping reading frame products. J Gen Virol 83, 1799–1807.[Abstract/Free Full Text]

Hancheng, G., Wenqi, C. & Keqiang, M. (1996). The cloning, sequence analysis, and expression in E. coli of coat protein gene of grapevine fanleaf virus Gh. Chin J Biotechnol 12, 73–79.[Medline]

Hewitt, W. B., Raski, D. J. & Goheen, A. C. (1958). Nematode vector of soil-borne fanleaf virus of grapevines. Phytopathology 48, 586–595.

Huss, B., Muller, S., Sommermeyer, G., Walter, B. & Van Regenmortel, M. H. V. (1987). Grapevine fanleaf virus monoclonal antibodies: their use to distinguish different isolates. J Phytopathol 119, 358–370.

Huss, B., Walter, B. & Fuchs, M. (1989). Cross-protection between arabis mosaic virus and grapevine fanleaf virus isolates in Chenopodium quinoa. Ann Appl Biol 114, 45–60.

Le Gall, O., Candresse, T. & Dunez, J. (1995). Transfer of the 3' non-translated region of grapevine chrome mosaic virus RNA-1 by recombination to tomato black ring virus RNA-2 in pseudorecombinant isolates. J Gen Virol 76, 1285–1289.[Abstract/Free Full Text]

Little, A., Fazeli, C. F. & Rezaian, M. A. (2001). Hypervariable genes in Grapevine leafroll associated virus 1. Virus Res 80, 109–116.[CrossRef][Medline]

Martelli, G. P. & Savino, V. (1990). Fanleaf degeneration. In Compendium of Grape Diseases, pp. 48–49. Edited by R. Pearson & A. C. Goheen. St Paul, MN, USA: APS Press.

Mauro, M. C., Toutain, S., Walter, B., Pinck, L., Otten, L., Coutos-Thevenot, P., Deloire, A. & Barbier, P. (1995). High efficiency regeneration of grapevine plants transformed with the GFLV coat protein gene. Plant Sci 112, 97–106.[CrossRef]

Mayo, M. A. & Robinson, D. J. (1996). Nepoviruses: molecular biology and replication. In The Plant Viruses, vol. 5: Polyhedral Virions and Bipartite RNA Genomes. Edited by B. D. Harrison & A. F. Murant. New York: Plenum Press.

Meng, B., Zhu, H. & Gonsalves, D. (1999). Rupestris stem pitting associated virus-1 consists of a family of sequence variants. Arch Virol 144, 2071–2085.[CrossRef][Medline]

Naraghi-Arani, P., Daubert, S. & Rowhani, A. (2001). Quasispecies nature of the genome of Grapevine fanleaf virus. J Gen Virol 82, 1791–1795.[Abstract/Free Full Text]

Nolasco, G. & de Sequeira, O. A. (1993). Genome diversity of field isolates of Grapevine fanleaf virus (GFLV) analyzed by single stranded conformation (SSCP) and restriction fragment length (RFLP) polymorphisms. In Extended Abstracts of the 11th Meeting of the International Council for the Study of Viruses and Virus-like Diseases of the Grapevine, 6–9 September 1993, Montreux, Switzerland, pp. 31–32. Edited by P. Gugerli.

Pinck, L., Fuchs, M., Pinck, M., Ravelonandro, M. & Walter, B. (1988). A satellite RNA in grapevine fanleaf virus strain F13. J Gen Virol 69, 233–239.

Raski, D. J., Goheen, A. C., Lider, L. A. & Meredith, C. P. (1983). Strategies against grapevine fanleaf virus and its nematode vector. Plant Dis 67, 335–339.

Ritzenthaler, C., Viry, M., Pinck, M., Margis, R., Fuchs, M. & Pinck, L. (1991). Complete nucleotide sequence and genetic organization of grapevine fanleaf nepovirus RNA1. J Gen Virol 72, 2357–2365.[Abstract/Free Full Text]

Ritzenthaler, C., Schmitt, A. C., Michler, P., Stussi-Garaud, C. & Pinck, L. (1995). Grapevine fanleaf nepovirus P38 putative movement protein is located on tubules in vivo. Mol Plant–Microbe Interact 8, 379–387.

Rubio, L., Ayllon, M. A., Kong, P., Fernandez, A., Polek, M., Guerri, J., Moreno, P. & Falk, B. W. (2001). Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. J Virol 75, 8054–8062.[Abstract/Free Full Text]

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425.[Abstract]

Sanchez, F., Chay, C., Borja, M. J., Rowhani, A., Romero, J., Bruening, G. & Ponz, F. (1991). cDNA sequence of the capsid protein gene and 3' untranslated region of a fanleaf isolate of grapevine fanleaf virus. Nucleic Acids Res 19, 5440.[Free Full Text]

Savino, V., Cherif, C. & Martelli, G. P. (1985). A natural serological variant of grapevine fanleaf virus. Phytopathol Mediterr 24, 325–328.

Serghini, M. A., Fuchs, M., Pinck, M., Reinbolt, J., Walter, B. & Pinck, L. (1990). RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location. J Gen Virol 71, 1433–1441.[Abstract/Free Full Text]

Shi, B. J., Habili, N. & Symons, R. H. (2003). Nucleotide sequence variation in a small region of the Grapevine fleck virus replicase provides evidence for two sequence variants of the virus. Ann Appl Biol 142, 349–355.[CrossRef]

Strimmer, K. & von Haeseler, A. (1996). Quartet puzzling: a quartet maximum-likelihood method for reconstructing tree topologies. Mol Biol Evol 13, 964–969.

Szychowski, J. A., McHenry, M. V., Walker, M. A., Walpert, J. A., Credi, R. & Semancik, J. S. (1995). The vein-banding disease syndrome: a synergistic reaction between grapevine viroids and fanleaf virus. Vitis 34, 229–232.

Tamura, K. & Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10, 512–526.[Abstract]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.[Abstract/Free Full Text]

Vigne, E., Komar, V. & Fuchs, M. (2004). Field safety assessment of recombination in transgenic grapevines expressing the coat protein gene of Grapevine fanleaf virus. Transgenic Res 13, 165–179.[CrossRef][Medline]

Vuittenez, A., Munck, M. C. & Kuszala, J. (1964). Souches de virus à hautes aggressivité isolées de vignes atteintes de dégénérescence infectieuse. Etud Virol Appl 5, 69–78 (in French).

Walter, B. & Etienne, L. (1987). Detection of the grapevine fanleaf viruses away from the period of vegetation. J Phytopathol 120, 355–364.

Wetzel, T., Meunier, L., Jaeger, U., Reustle, G. M. & Krczal, G. (2001). Complete nucleotide sequences of the RNAs 2 of German isolates of Grapevine fanleaf virus and Arabis mosaic nepoviruses. Virus Res 75, 139–145.[CrossRef][Medline]

Received 15 December 2003; accepted 17 May 2004.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
S. Martin, M. L. Garcia, A. Troisi, L. Rubio, G. Legarreta, O. Grau, D. Alioto, P. Moreno, and J. Guerri
Genetic variation of populations of Citrus psorosis virus.
J. Gen. Virol., October 1, 2006; 87(Pt 10): 3097 - 3102.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. Meng, A. R. Rebelo, and H. Fisher
Genetic diversity analyses of grapevine Rupestris stem pitting-associated virus reveal distinct population structures in scion versus rootstock varieties
J. Gen. Virol., June 1, 2006; 87(6): 1725 - 1733.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. J. Dennehy, N. A. Friedenberg, Y. W. Yang, and P. E. Turner
Bacteriophage Migration via Nematode Vectors: Host-Parasite-Consumer Interactions in Laboratory Microcosms.
Appl. Envir. Microbiol., March 1, 2006; 72(3): 1974 - 1979.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Jridi, J.-F. Martin, V. Marie-Jeanne, G. Labonne, and S. Blanc
Distinct Viral Populations Differentiate and Evolve Independently in a Single Perennial Host Plant
J. Virol., March 1, 2006; 80(5): 2349 - 2357.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Rebenstorf, T. Candresse, M. J. Dulucq, C. Buttner, and C. Obermeier
Host Species-Dependent Population Structure of a Pollen-Borne Plant Virus, Cherry Leaf Roll Virus
J. Virol., March 1, 2006; 80(5): 2453 - 2462.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Tables
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vigne, E.
Right arrow Articles by Fuchs, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vigne, E.
Right arrow Articles by Fuchs, M.
Agricola
Right arrow Articles by Vigne, E.
Right arrow Articles by Fuchs, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS