J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 85 (2004), 2525-2533; DOI 10.1099/vir.0.80036-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jacob, J. R.
Right arrow Articles by Mansfield, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacob, J. R.
Right arrow Articles by Mansfield, K. G.
Agricola
Right arrow Articles by Jacob, J. R.
Right arrow Articles by Mansfield, K. G.
© 2004 Society for General Microbiology

GB virus B infection of the common marmoset (Callithrix jacchus) and associated liver pathology

James R. Jacob1, Kuei-Chin Lin2, Bud C. Tennant1 and Keith G. Mansfield2

1 Departments of Clinical Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA
2 Division of Clinical Research, New England Regional Primate Research Center, Harvard Medical School, PO Box 9102, One Pine Hill Drive, Southborough, MA 01772-9102, USA

Correspondence
Keith G. Mansfield
keith_mansfield{at}hms.harvard.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
GB virus B (GBV-B) is a flavivirus that is related closely to hepatitis C virus (HCV) and induces an acute hepatitis when inoculated into several species of New World primates. Common marmosets (Callithrix jacchus) are a widely available, non-endangered primate species that is susceptible to GBV-B infection and develops a characteristic acute hepatitis. Here, animals were found to be susceptible to serially passaged serum and GBV-B transcripts. Hepatic pathology and peripheral viraemia could be quantified biochemically, immunophenotypically and morphologically, and persisted for periods of up to 6 months in some animals. Hepatitis was characterized by a marked influx of CD3+ CD8+ T lymphocytes and CD20+ B cells within the first 2 months of primary infection. The results of this study document the marmoset as another small, non-human primate species in which the pathogenesis of GBV-B can be studied and used as a surrogate model of HCV infection for investigation of pathogenesis and antiviral drug development.


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Over 100 million people worldwide are chronic carriers of hepatitis C virus (HCV), with over 3·9 million in the USA alone (NIH, 2002Down). HCV infection is a significant cause of human morbidity and mortality, and animal models for development of new antiviral therapies are not readily available. Three decades ago, animal models to study the pathogenesis of viral hepatitis were limited to the chimpanzee (Pan troglodytes) (Houghton, 1996Down). Research on hepatitis B virus (HBV) now utilizes related hepadnaviruses from duck, ground squirrel and woodchuck. The woodchuck infected with woodchuck hepatitis virus is now an accepted model for investigation of the pathogenesis of HBV infection of humans (Tennant, 2001Down) and has been instrumental in the development of antiviral treatment for chronic hepadnaviral infections (Korba et al., 2000Down).

Research on HCV has not benefited from such affordable and accessible animal models. Until recently, the only model available was the HCV-infected chimpanzee. This system has several drawbacks including expense, availability, biocontainment and ethical considerations. It is also questionable whether HCV-infected chimpanzees adequately model all aspects of the human disease. Furthermore, research is impeded by the lack of appropriate infectious cell culture models for this hepatotropic pathogen (Lanford et al., 1994Down). A small non-human primate surrogate model of HCV infection would allow the in vivo examination of host–virus interactions, disease pathogenesis and potential chemotherapeutic agents.

HCV is a member of the virus family Flaviviridae, composed of the flaviviruses, the pestiviruses and the hepatitis C viruses, which have similar genomic organization and replication strategies (Rice, 1996Down). Bovine viral diarrhoea virus (BVDV) is a pestivirus that has been developed for cell-based screening assays to assess antiviral drug activity (Meyers & Thiel, 1996Down; Zitzmann et al., 1999Down). The GB viruses (GBVs), based on their genetic sequences, have been categorized as flaviviruses (Muerhoff et al., 1995Down). Their historical background has been reviewed (Karayiannis & McGarvey, 1995Down; Robertson, 2001Down). Briefly, GBV-B was isolated from New World monkeys (tamarins) after inoculation with serum from a human patient with hepatitis (Deinhardt et al., 1967Down). Subsequent work has demonstrated and characterized three distinct viral agents termed GBV-A, GBV-B and GBV-C. GBV-C, previously called hepatitis G virus (HGV), has been found in 1–2 % of the human population (Simmons et al., 1995Down; Linnen et al., 1996Down). The association of GBV-B with human disease has not been firmly established (Alter et al., 1997Down). All three flaviviruses are related to HCV, but GBV-B is phylogenetically most closely related to HCV, showing up to 25 % amino acid sequence identity (Muerhoff et al., 1995Down; Ohba et al., 1996Down). Although each exhibits different host tropisms and disease sequelae, both HCV and GBV-B have similar cellular mechanisms of processing viral gene products (Reed et al., 1998Down) and both are associated with persistent infections in their respective hosts (Beames et al., 2001Down).

The natural host of GBV-B is unknown but several species of New World primates including tamarins (Saguinus sp.) and owl monkeys (Aotus sp.) are susceptible to experimental inoculation (Bukh et al., 2001Down). Recently, susceptibility of the common marmoset (Callithrix jacchus) to GBV-B infection has been demonstrated as an alternative small-animal model (Lanford et al., 2003Down; Bright et al., 2004Down). In the report that follows, the successful infection of common marmosets with GBV-B and associated hepatic pathology and inflammatory changes are described. The availability of GBV-B-infected marmosets now allows investigation of both host and viral processes as they relate to the pathogenesis of HCV infection of the liver.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Experimental animals.
Animals were housed in an animal biocontainment facility in accordance with the Harvard Medical School's Standing Committee on Animals and the Guide for the Care and Use of Laboratory Animals (National Research Council, 1996Down). Prior to inoculation, animals were checked for GBV-A and GBV-B by RT-PCR performed on sera. After GBV-B inoculation, animals were examined prospectively with sequential blood and hepatic biopsies. Blood was obtained for measurement of hepatic enzymes including alkaline phosphatase, aspartate aminotransferase and alanine aminotransferase. The presence of GBV-B viraemia and viral RNA load was detected by RT-PCR.

Inoculum.
Marmosets were inoculated intravenously with 1·0 ml of a 10–3 dilution of GBV-B-infectious serum. This serum was derived from a common marmoset inoculated with ‘GB Agent Pool, Mystax 661, 8/93’ kindly provided by Dr Jens Bukh (Hepatitis Viruses Section, NIH, NIAID, USA). Two animals were subject to direct transfection of the liver with recombinant (r)GBV-B RNA, as described previously (Bukh et al., 1999Down), with the plasmid pGGB (kindly provided by Dr Bukh). Subsequently, six animals were inoculated and three were immunosuppressed with oral FK506 (Prograf) at a dose of 0·2 mg kg–1 twice daily for 4 weeks starting 1 week prior to inoculation with GBV-B-infectious serum.

Virus quantification.
Quantification of GBV-B was performed using previously described protocols (Beames et al., 2000Down). One-step RT-PCR amplification utilized the following primer pair and probe: forward, 5'-AACGAGCAAAGCGCAAAGTC-3'; reverse, 5'-CATCATGGATACCAGCAATTTTGT-3'; and probe, 5'-6Fam–AGCGCGATGCTCGGCCTCGTA–Tamra-3' (6Fam, 6-carboxyfluorescein; Tamra, 6-carboxytetramethylrhodamine). The primer pairs and fluorescence reporter probe for the sequence analysis were synthesized commercially (Applied BioSystems). RT-PCR was employed for quantifying GBV-B serum titres (TaqMan system, Applied BioSystems, Sequence Detection System). A reference standard of GBV-positive serum was calculated to contain 1x107 GBV genome equivalents (g.e.) ml–1 in a head-to-head comparison with an rGBV RNA transcript standard (Bukh et al., 1999Down).

Histology.
In initial experiments, eight animals were inoculated intravenously with serially passaged GBV-B serum. Two of these animals were euthanized and necropsies were performed at 4 weeks after infection. One animal was euthanized at 7 weeks and the remainder were followed to 22 weeks. Hepatic biopsies were obtained under general anaesthesia with ultrasonic guidance and samples divided for histological evaluation, RNA isolation and determination of lymphocyte subsets. Sections of liver were stained with haematoxylin and eosin (H&E) and examined for morphological evidence of hepatic inflammation. To examine the immunophenotype of cells within the liver, tissues were also stained for CD3, CD8, CD20 and HLA-DR (Dako). Tissue sections (5 µm) were immunostained using an avidin–biotin–horseradish peroxidase complex (ABC) technique with diaminobenzene chromogen as described previously (Mansfield et al., 1995Down; Wykrzykowska et al., 1996Down). Lymphocytes were also isolated by mechanical disruption and Ficoll separation from hepatic biopsies and stained for CD3, CD8, CD4, CD20 and HLA-DR (Dako). Lymphocyte subsets were determined by fluorescence-activated cell sorting (FACS) analysis (Genain & Hauser, 1996Down).

Peripheral blood mononuclear cell (PBMC) analysis.
Whole blood was collected at weekly intervals from two marmosets inoculated with infectious GBV-B serum as described above. PBMCs were isolated from whole blood by density-gradient centrifugation. Briefly, after centrifugation of 2 ml whole blood in EDTA anticoagulant at 4500 r.p.m. using a Sorvall SH3000 rotor, the plasma was removed and the cell pellet (1 ml) suspended in 3 ml RPMI and layered onto 3 ml lymphocyte separation medium, followed by centrifugation at 4500 r.p.m. The PBMC interface (0·7 ml) was collected with a needle and syringe, diluted twofold in PBS and centrifuged at 4500 r.p.m. The cell pellets (50 µl) were diluted into 1·5 ml PBS, followed by centrifugation at 4500 r.p.m. In one case, PBMCs were stained for CD3+ and isolated by FACS analysis as described above. The final cell pellets were suspended in 100 µl PBS and stored at –80 °C. Total cell RNA was isolated and titres of GBV-B RNA were quantified in both the plasma and PBMC extracts by the procedures described above. At 7 weeks post-inoculation (p.i.), animals were euthanized for the recovery of primary hepatocytes used for in vitro assays.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Susceptibility of the common marmoset to GBV-B infection
The natural host of GBV-B is unknown; however, several New World primates develop a characteristic hepatopathy following experimental inoculation. Following inoculation with infectious serum in a time-course pathogenesis study, 8/8 (100 %) marmosets became infected, with peripheral viraemia detected as early as 2 weeks p.i. (Table 1Down). Direct transfection of rGBV-B into the liver of two animals resulted in detection of peripheral viraemia beginning 2 weeks p.i. (Table 2Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Experimental inoculation of common marmosets with GBV-B

All animals became infected, with peripheral viraemia and hepatic infection detected by RT-PCR as early as 2 weeks p.i. Animals were euthanized at predetermined time points to examine morphological alterations in hepatic tissue.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Susceptibility of the common marmoset to GBV-B-infectious RNA transcripts and tissue culture supernatants obtained from transfected hepatocytes

These two animals were subject to direct transfection of the liver with rGBV-B RNA, as described previously (Bukh et al., 1999Down), using the pGGB plasmid. Supernatant fluid was derived from primary marmoset hepatocytes transfected with infectious rGBV-B RNA transcripts.

 
Among animals inoculated with infectious serum, a rapid rise in viraemia 3–4 weeks p.i., attaining titres of >108 GBV-B g.e. ml–1, could be demonstrated and was associated with an increase in hepatic enzymes. Two characteristic patterns of peripheral viraemia were observed and correlated with hepatic viral load (Fig. 1Down). In some animals, peak viraemia was achieved in 4–6 weeks followed by rapid clearance from both plasma and the hepatic tissue. In other animals, peak viral load was delayed and such animals remained viraemic for periods of up to 6 months. Intrahepatic GBV-B was detected only during periods of peripheral viraemia.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Patterns of GBV-B viraemia following experimental inoculation of common marmosets. Two patterns in peripheral viral load were noted. Peak viral loads of >108 RNA copies (ml plasma)–1 were reached between 4 and 20 weeks p.i. Peripheral viraemia (filled circles) persisted past 24 weeks in some animals (a), but was cleared in 12–15 weeks in others (b). GBV-B genomic copies in hepatic biopsies (shaded bars) and elevations of serum alkaline phosphatase levels (solid lines) correlated with measures of peripheral viraemia.

 
Liver histology during GBV-B infection of marmosets
Biopsy or necropsy samples of liver were obtained prior to and following experimental infection and evaluated histologically (Fig. 2Down). Hepatitis was evident as early as 4 weeks after inoculation and recognized initially as multifocal random non-suppurative inflammation within the hepatic parenchyma. Subsequently, marked lymphocytic infiltrates developed within portal tracts (Fig. 2aDown). Portal lymphocytic hepatitis was associated with erosion of the limiting plate and areas of piecemeal necrosis (Fig. 2bDown). Immunophenotypically, the hepatitis was characterized by the infiltration of large numbers of CD3+ and CD8+ lymphocytes within both the hepatic parenchyma and portal areas (Fig. 2cDown). CD20+ lymphocytes were observed primarily within portal tracts (Fig. 2dDown) and progressed to form well-defined lymphoid nodules in some animals. Alterations in liver enzymes correlated directly with the morphological changes observed histologically. The increase in alkaline phosphatase coincided with a prominent portal inflammatory cell infiltration, suggesting ongoing damage to the biliary epithelium. Increased numbers of CD3+ lymphocytes were observed within septal duct epithelium (Fig. 2eDown) and were associated with increased expression of HLA-DR, an MHC II antigen, on biliary epithelium (Fig. 2fDown).



View larger version (131K):
[in this window]
[in a new window]
 
Fig. 2. GBV-B hepatitis in the common marmoset. Hepatic necropsy and biopsy material was obtained from animals during the course of GBV-B infection and evaluated by H&E staining and immunocytochemistry. (a) Lymphocytic infiltrates expand and disrupt normal hepatic cord architecture (H&E staining, original magnification x200). (b) Piecemeal necrosis and erosion of the limiting plate (H&E staining, original magnification x1000). (c) Multifocal random non-suppurative hepatitis is composed primarily of CD3+ lymphocytes within hepatic parenchyma. Original magnification x400. Inset: CD3+ lymphocytes within portal tracts. (d) CD20+ B cells within portal tracts (ABC immunostaining, original magnification x400). (e) CD3+ lymphocytes infiltrating biliary epithelium of the septal duct (ABC immunostaining, magnification x1000). (f) Increased expression of HLA-DR within biliary epithelium of the septal duct (ABC immunostaining, original magnification x1000).

 
Immunophenotype of infiltrating lymphocytes
Intrahepatic lymphocytes were isolated from liver tissues collected 1 and 2 months p.i. and the immunophenotype of the cells was determined (Fig. 3Down). Compared with pre-inoculation samples, there was a statistically significant increase in CD3+ CD8+ T lymphocytes (0 vs 4 weeks, P=0·006, and 0 vs 8 weeks, P=0·016; Mann–Whitney rank sum test) that correlated with changes noted histologically. This population of cells comprised primarily cytotoxic T lymphocytes, an MHC class I-restricted immune cell that most likely plays a critical role in controlling viral infection. Concurrent with these alterations, a statistically significant increase in CD20+ B cells was also observed (0 vs 4 weeks, P=0·014, and 0 vs 8 weeks, P=0·009; Mann–Whitney rank sum test). An increase in the number of CD3+ CD4+ helper T lymphocytes, an MHC class II-restricted immune cell, was not evident. A slight increase in lymphocytes expressing the MHC class II antigen HLA-DR was observed on lymphocytes, but the overall population of naive T cells, CD45RA+ cells, did not reflect this trend.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. Alterations in hepatic lymphocyte subsets. Sequential hepatic biopsies were obtained from animals prior to inoculation and at 4 and 8 weeks p.i. and analysed by FACS to determine the relative proportion of lymphocyte subsets. Statistically significant increases in CD3+ CD8+ ({circ}) and CD20+ ({blacktriangledown}) lymphocytes were observed, but there was no increase in CD3+ CD4+ lymphocytes ({bullet}).

 
Treatment of animals with FK506
Immunosuppressive therapy is known to alter the pathogenicity of viral infection. All marmosets (3/3) treated with FK506 1 week prior to inoculation showed viraemia 2 weeks p.i., similar to untreated controls (3/3) (Table 3Down). In two animals, GBV-B viraemia persisted for 24 weeks p.i., with or without FK506 treatment. However, the viral load in the animal treated with FK506 was 0·5–1·5 logs greater than that measured in the untreated control up to 9 weeks p.i. (5·04x107 compared with 8·41x105, respectively). Necropsy or biopsy samples of liver were obtained from both FK506-treated and control animals at 2, 4, 8 and 15 weeks p.i. No changes in histological features were noted between the treated and control groups at 2, 4 and 8 weeks. At 15 weeks p.i., the liver from the untreated control animal appeared normal, with minimal lymphocytic infiltration (Fig. 4Downa). A normal distribution of lymphocytes in the liver parenchyma was observed upon staining for CD3+ cells (Fig. 4bDown). These features were in contrast to the liver of the FK506-treated animal, in which a multifocal hepatitis was apparent (Fig. 4cDown), with a significant increase in the number of T lymphocytes infiltrating the liver (Fig. 4dDown).


View this table:
[in this window]
[in a new window]
 
Table 3. Experimental inoculation of common marmosets with GBV-B with and without treatment with FK506

Peripheral viraemia and hepatic infection were detected by RT-PCR as early as 2 weeks p.i. Animals were euthanized at predetermined time points to examine morphological alterations in hepatic tissue.

 


View larger version (151K):
[in this window]
[in a new window]
 
Fig. 4. Treatment of animals with the immunosuppressive agent FK506 results in enhanced hepatic pathology. Hepatic biopsy material was obtained at 15 weeks p.i. from control (a, b) and FK506-treated (c, d) animals. Tissues were evaluated by H&E staining (a, c) and infiltrating lymphocytes were identified by staining for CD3+ antigen (b, d). Peripheral viraemia was monitored on plasma extracted from serum at the specified time points. Original magnification x100.

 
Detection of GBV-B in PBMCs
RNA extracted from pre-inoculation sera and PBMCs from two additional marmosets (animals cj500-00 and cj96-01) were found to be negative for GBV-B RNA. Animal cj500-00 showed a rapid increase in GBV-B serum titres beginning at 1 week p.i., fluctuating between 1·01x105 and 3·8x106 g.e. ml–1 and then increasing steadily to 6·48x107 g.e. ml–1 at 7 weeks p.i. (Fig. 5aDown). Animal cj96-01 exhibited a delayed onset of viraemia, beginning at 3 weeks p.i. and gradually reaching 4·8x105 g.e. ml–1 at 7 weeks p.i.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. GBV-B titres in serum and PBMCs isolated during infection of marmosets cj500-00 ({blacktriangledown}) and cj96-01 ({bullet}). RNA was extracted from serum, PBMCs were collected at weekly intervals and viral loads were quantified by RT-PCR. Serum titres are expressed as g.e. ml–1 (a) and intracellular PBMC titres are expressed as g.e. (µg RNA)–1 after normalization to the 18S ribosome content of total cellular RNA (b).

 
The RNA extracted from PBMCs isolated at weekly intervals was analysed for GBV-B content (Fig. 5bUp). Measurable levels of GBV-B were not detected at any time point of infection in animal cj96-01. GBV-B genomes were quantified in the PBMC pellets from animal cj500-00 that were proportionate to viraemia. The titre of GBV-B in PBMCs appeared to correlate with serum titres, although the quantities in PBMCs were 1–2 logs greater than would have been expected if serum virus co-purified with the PBMCs during the isolation procedures. The titre of GBV-B in PBMCs reached a plateau at 2·28x104 g.e. (µg RNA)–1 by 5–7 weeks p.i. as serum titres increased progressively. PBMCs collected from a marmoset at 14 weeks p.i. were stained for CD3+ cells, isolated by FACS and analysed for GBV-B content. Titres of GBV-B were enhanced fivefold in the non-CD3-staining lymphocyte population.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
The results of this study document the use of the common marmoset as a small non-human primate in which the pathogenesis of GBV-B can be studied as a surrogate model of human HCV infection. Marmosets are a widely available, non-endangered primate species. They are susceptible to GBV-B infection and develop a characteristic hepatitis. Here, hepatic pathology and peripheral viraemia were found to persist for periods of at least 6 months and could be quantified biochemically, immunophenotypically and morphologically. All animals showed signs of infection 2–4 weeks p.i. followed by a period of viraemia of up to 24 weeks. The infection of naive marmosets via transfection of rGBV-B into the liver resulted in patterns of viraemia similar to that following inoculation of infectious serum. This facet of the study also demonstrated the capacity to examine molecular clones of GBV-B to identify virulence factors of the virus. Recently, a chronic infection was documented in one of two tamarins inoculated with rGBV-B (Martin et al., 2003Down). Whether this is characteristic for the clone or due to individual responses to infection will require further investigation. However, similar variations in the duration of viraemia were observed in our study of marmosets (duration of 8–12 weeks vs >24 weeks). Larger cohorts of experimentally infected animals and head-to-head comparison of infectious clones would be valuable in clarifying the factors that determine virus persistence.

In comparison with the tamarin model, the marmoset is equally susceptible to GBV-B infection. In a study presented by Bright et al. (2004)Down, GBV-B-infectious serum from tamarins led to increased infectivity upon serial passage in the marmoset model, from a rate of infection with tamarin serum of 65 % (13/20 marmosets) to a rate of 100 % (9/9 marmosets) with marmoset-derived material. The onset of viraemia peaked at 3 weeks p.i. and attained serum titres of approximately 109–1010 g.e. ml–1 before clearing virus by 8 weeks p.i. The onset of viraemia in the study reported here occurred as early as 1–2 weeks p.i. followed by increasing titres to 7 weeks p.i. averaging 108 g.e. ml–1. In a report by Lanford et al. (2001)Down, viraemia was detected in tamarins as early as 1–2 weeks p.i., with sustained viral titres of 107 g.e. ml–1 for 12 weeks until clearance of virus from the serum. In a study comparing the viraemia in GBV-B-infected marmosets and tamarins, the kinetics of infection were similar (Lanford et al., 2003Down). In this report, persistent GBV-B infection of immunologically normal marmosets was documented for periods of up to 24 weeks p.i.

Immunosuppressive treatment of marmosets prior to inoculation of GBV-B resulted in higher viral load and more severe liver pathology. These data suggest that the virus may have established a more productive infection in the liver during immunosuppressive treatment, leading to a more vigorous immune response once the suppression diminished. Although both an FK506-treated and control animal showed evidence of chronic infection for 24 weeks, a larger cohort of animals, treated in a similar fashion, must be monitored for a period of >6 months to determine the full outcome of immunosuppressive therapy. Immunosuppressive therapy on GBV-B-infected tamarins resulted in some persistent infections (Lanford et al., 2003Down). These results coupled with those presented here imply that immune modulation of either New World primate model will allow us to investigate factors that contribute to the establishment of the persistent carrier state.

The common marmoset is an accepted model to study inflammatory diseases such as demyelination associated with multiple sclerosis in humans (Genain & Hauser, 1996Down; Villoslada et al., 2001Down; Genain et al., 1996Down). The origins for utilizing this New World primate as an alternative in vitro model for hepatitis research have been described as well (Stephensen et al., 1991Down). Based on the susceptibility of the marmoset to infection with GBV-B, we believe it should be useful as a small primate model to investigate the mechanism of hepatic damage and inflammatory changes during the course of viral infection. The presence of lymphoid nodules was particularly interesting, as this is often cited as a defining change in chronic HCV infection in man. The increase in alkaline phosphatase coincided with a prominent portal inflammatory cell infiltration. This suggests ongoing damage to the biliary epithelium, which is a feature of chronic HCV in man as well. The finding of increased numbers of MHC class I-restricted CD8+ lymphocytes, indicative of cytotoxic T cells, is in accordance with previous studies showing CD8+ cells predominant in the liver during either chronic HBV or HCV infections (Fiore et al., 1997Down). The contribution of class I-restricted CD8+ T cells to liver injury during virus clearance has been demonstrated in other animal models of viral hepatitis (Fiore et al., 1997Down). However, HCV infections persist despite an immune response, and the role of CD8+ cells and whether HCV is able to escape immune elimination are issues of pathogenesis that need to be studied further (Cerny & Chisari, 1999Down; Ferrari et al., 1999Down). In this study, MHC class I expression in association with the observed increase in CD8+ cells was not examined. An increase in the CD4+ T lymphocytes was not detected; whether this reflects a dysfunction of the immune response requires further experimentation.

Extrahepatic sites of replication are characteristic for some members of the Flaviviridae, specifically BVDV (Liebler-Tenorio et al., 1997Down). BVDV can replicate in PBMCs and antigen expression can be localized to several organs including brain tissues (Bielefeldt-Ohmann et al., 1987Down; Gruber et al., 1993Down). Extrahepatic manifestations of disease have not been well characterized in animal models for HCV (Gruber et al., 1993Down). Several papers suggest that HCV and HGV (GBV-C) may be lymphotropic (Fogeda et al., 1999Down; Afonso et al., 1999Down; Rodriguez-Inigo et al., 2000Down) and a recent paper describes the identification of HCV genomic material in brain tissue from humans (Radkowski et al., 2002Down).

In this study, the data suggest that lymphocytes may be an extrahepatic site of GBV-B replication in the common marmoset. Although there was variation in detecting GBV-B in PBMCs from infected animals, the quantified levels of GBV-B in RNA extracted from PBMCs were 1–2 logs greater than could be accounted for by the dilution factor of contaminating serum carried through the PMBC isolation procedure (1 : 7200). It is possible that GBV-B adhered to the erythrocytes or to the platelets in the PMBC preparation. However, if this were the case, we would expect detectable levels of GBV-B in the PMBCs of cj96-01, which were prepared in parallel with cj500-00 samples. GBV-B was not detected in the PBMCs of cj96-01 and in a control experiment we did not detect GBV-B in normal PBMCs seeded with infectious virus. Furthermore, a recent report (Ducoulombier et al., 2004Down) describes the absence of HCV compartmentalized to the CD4+ and CD8+ fractions of PMBCs isolated from chronic carriers. This attests to our finding of increased GBV-B titres in the non-CD3+ fraction of PBMCs isolated from infected marmosets.

As discussed previously, the availability of the marmoset for research purposes provides an affordable, assessable animal resource allowing experimental studies utilizing the surrogate GBV-B system. Our data show characteristic immunophenotypic and morphological features following GBV-B inoculation of marmosets that have been observed during chronic HCV infections in man. This work and that reported by others further supports the use of New World primates infected with GBV-B as a surrogate model for the study of HCV pathogenesis.


   ACKNOWLEDGEMENTS
 
This work was supported by PHS funded grant RR 00168.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Afonso, A. M., Jiang, J., Penin, F., Tareau, C., Samuel, D., Petit, M. A., Bismuth, H., Dussaix, E. & Féray, C. (1999). Nonrandom distribution of hepatitis C virus quasispecies in plasma and peripheral blood mononuclear cells, and liver. J Virol 73, 9213–9221.[Abstract/Free Full Text]

Alter, M. J., Gallagher, M., Morris, T. T., Moyer, L. A., Meeks, E. L., Krawczynski, K., Kim, J. P. & Margolis, H. S. (1997). Acute non-A–E hepatitis in the United States and the role of hepatitis G infection. Sentinel counties viral hepatitis team. N Engl J Med 336, 741–746.[Abstract/Free Full Text]

Beames, B., Chavez, D., Guerra, B., Notvall, L., Brasky, K. M. & Lanford, R. E. (2000). Development of a primary tamarin hepatocyte culture system for GB virus-B: a surrogate model for hepatitis C virus. J Virol 74, 11764–11772.[Abstract/Free Full Text]

Beames, B., Chavez, D. & Lanford, R. E. (2001). GB virus B as a model for hepatitis C virus. ILAR J 42, 152–160.[Medline]

Bielefeldt-Ohmann, H., Ronsholt, L. & Bloch, B. (1987). Demonstration of bovine viral diarrhoea virus in peripheral blood mononuclear cells of persistently infected, clinically normal cattle. J Gen Virol 68, 1971–1982.[Abstract/Free Full Text]

Bright, H., Carroll, A. R., Watts, P. A. & Fenton, R. J. (2004). Development of a GB virus B marmoset model and its validation with a novel series of hepatitis C virus NS3 protease inhibitors. J Virol 78, 2062–2071.[Abstract/Free Full Text]

Bukh, J., Apgar, C. L. & Yanagi, M. (1999). Toward a surrogate model for hepatitis C virus: an infectious molecular clone of the GBV virus-B hepatitis agent. Virology 262, 470–478.[CrossRef][Medline]

Bukh, J., Apgar, C. L., Govindarajan, S. & Purcell, R. H. (2001). Host range studies of GB virus-B hepatitis agent, the closest relative of hepatitis C virus, in New World monkeys and chimpanzees. J Med Virol 65, 694–697.[CrossRef][Medline]

Cerny, A. & Chisari, F. V. (1999). Pathogenesis of chronic hepatitis C: immunologic features of hepatic injury and viral persistence. Hepatology 30, 595–601.[CrossRef][Medline]

Deinhardt, F., Holmes, A. W., Capps, R. B. & Popper, H. (1967). Studies on the transmission of human viral hepatitis to marmoset monkeys: transmission of disease, serial passages, and description of liver lesions. J Exp Med 125, 673–687.[Abstract]

Ducoulombier, D., Rogue-Afonso, A.-M., DiLiberto, G., Penin, F., Kara, R., Richard, Y., Dussaix, E. & Feray, C. (2004). Frequent compartmentalization of hepatitis C virus variants in circulating B cells and monocytes. Hepatology 39, 817–825.[CrossRef][Medline]

Ferrari, C., Urbani, S., Penna, A. & 8 other authors (1999). Immunopathogenesis of hepatitis C virus infection. J Hepatol 31, 31–38.

Fiore, G., Piazzolla, G., Angarano, I., Galetta, V., Caccetta, L., Jirillo, E., Schiraldi, O. & Antonaci, S. (1997). Intrahepatic cytotoxic cell infiltrates in chronic hepatitis B and C: a comparative immunohistochemical study. Med Sci Res 25, 755–758.

Fogeda, M., Navas, S., Martin, J., Casqueiro, M., Rodríguez, E., Arocena, C. & Carreño, V. (1999). In vitro infection of human peripheral blood mononuclear cells by GB virus C/hepatitis G virus. J Virol 73, 4052–4061.[Abstract/Free Full Text]

Genain, C. P. & Hauser, S. L. (1996). Allergic encephalomyelitis in common marmosets: pathogenesis of a multiple sclerosis-like lesion. Methods 10, 420–434.[CrossRef][Medline]

Genain, C. P., Abel, K., Belmar, N., Villinger, F., Rosenberg, D. P., Linington, C., Raine, C. S. & Hauser, S. L. (1996). Late complications of immune deviation therapy in a nonhuman primate. Science 274, 2054–2057.[Abstract/Free Full Text]

Gruber, A. D., Greiser-Wilke, I. M., Hass, L., Hewicker-Trautwein, M. & Moennig, V. (1993). Detection of bovine viral diarrhea virus RNA in formalin-fixed, paraffin-embedded brain tissue by nested chain reaction. J Virol Methods 43, 309–320.[CrossRef][Medline]

Houghton, M. (1996). Hepatitis C viruses. In Fields Virology, 3rd edn, pp. 1035–1058. Edited by B. H. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Karayiannis, P. & McGarvey, M. J. (1995). The GBV hepatitis viruses. J Viral Hepat 2, 221–226.[Medline]

Korba, B. E., Cote, P., Hornbuckle, W., Tennant, B. C. & Gerin, J. L. (2000). Treatment of chronic woodchuck hepatitis virus infection in the Eastern woodchuck (Marmota monax) with nucleoside analogs is predictive of therapy for chronic hepatitis B virus infection in humans. Hepatology 31, 1165–1175.[CrossRef][Medline]

Lanford, R. E., Sureau, C., Jacob, J. R., White, B. & Fuerst, T. R. (1994). Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR. Virology 202, 606–614.[CrossRef][Medline]

Lanford, R. E., Chavez, D., Guerra, B., Lau, J. Y., Hong, Z., Brasky, K. M. & Beames, B. (2001). Ribavirin induces error-prone replication of GB virus B in primary tamarin hepatocytes. J Virol 75, 8074–8081.[Abstract/Free Full Text]

Lanford, R. E., Chavez, D., Notvall, L. & Brasky, K. M. (2003). Comparison of tamarins and marmosets as hosts for GBV-B infections and the effect of immunosuppression on duration of viremia. Virology 311, 72–80.[CrossRef][Medline]

Liebler-Tenorio, E. M., Greiser-Wilke, I. & Pohlenz, J. F. (1997). Organ and tissue distribution of the antigen of the cytopathogenic bovine virus diarrhea virus in the early and advanced phase of experimental mucosal disease. Arch Virol 142, 1613–1634.[CrossRef][Medline]

Linnen, J., Wages, J., Jr, Zhang-Keck, Z. Y. & 27 other authors (1996). Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 271, 505–508.[Abstract]

Mansfield, K. G., Pauley, D., Young, H. L. & Lackner, A. A. (1995). Mycobacterium avium complex in macaques with AIDS is associated with a specific strain of simian immunodeficiency virus and prolonged survival after primary infection. J Infect Dis 172, 1149–1152.[Medline]

Martin, A., Bodola, F., Sangar, D. V., Goettge, K., Popov, V., Rijnbrand, R., Lanford, R. E. & Lemon, S. M. (2003). Chronic hepatitis associated with GB virus B persistence in a tamarin after intrahepatic inoculation of synthetic viral RNA. Proc Natl Acad Sci U S A 100, 9962–9967.[Abstract/Free Full Text]

Meyers, G. & Thiel, H.-J. (1996). Molecular characterization of pestiviruses. Adv Virus Res 47, 53–118.[Medline]

Muerhoff, A. S., Leary, T. P., Simons, J. N. & 7 other authors (1995). Genomic organization of GB viruses A and B: two new members of the Flaviviridae associated with GB agent hepatitis. J Virol 69, 5621–5630.[Abstract]

National Research Council (1996). Guide for the Care and Use of Laboratory Animals. Washington, DC: National Academy Press.

NIH (2002). National Institutes of Health Consensus Development Conference: Management of hepatitis C: 2002. Hepatology 36 (Suppl. 1), S3–S20.[CrossRef][Medline]

Ohba, K. I., Mizokami, M., Lau, J. Y. N., Orito, E., Ikeo, K. & Gojobori, T. (1996). Evolutionary relationship of hepatitis C, pesti-, flavi-, plantviruses, and newly discovered GB hepatitis agents. FEBS Lett 378, 232–234.[CrossRef][Medline]

Radkowski, M., Wilkinson, J., Nowicki, M., Adair, D., Vargas, H., Ingui, C., Rakela, J. & Laskus, T. (2002). Search for hepatitis C virus negative-strand RNA sequences in the central nervous system: evidence of replication. J Virol 76, 600–608.[Abstract/Free Full Text]

Reed, K. E., Gorbalenya, A. E. & Rice, C. M. (1998). The NS5A/NS5 proteins of viruses from three genera of the family Flaviviridae are phosphorylated by associated serine/threonine kinases. J Virol 72, 6199–6206.[Abstract/Free Full Text]

Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology, 3rd edn, pp. 931–959. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Robertson, B. H. (2001). Viral hepatitis and primates: historical and molecular analysis of human and nonhuman primate hepatitis A, B, and the GB-related viruses. J Viral Hepat 8, 233–242.[CrossRef][Medline]

Rodriguez-Inigo, E., Casqueiro, M., Navas, S., Bartolomé, J., Pardo, M. & Carreño, V. (2000). Fluorescent "in situ" hybridization of hepatitis C virus RNA in peripheral blood mononuclear cells from patients with chronic hepatitis C. J Med Virol 60, 269–274.[CrossRef][Medline]

Simmons, J. N., Leary, T. P., Dawson, G. J., Pilot-Matias, T. J., Muerhoff, A. S., Schlauder, G. G., Desai, S. M. & Mushahwar, I. K. (1995). Isolation of novel virus-like sequences associated with human hepatitis. Nat Med 1, 564–569.[CrossRef][Medline]

Stephensen, C. B., Jacob, J. R., Montali, R. J., Holmes, K. V., Muchmore, E., Compans, R. W., Arms, E. D., Buchmeier, M. J. & Lanford, R. E. (1991). Isolation of an arenavirus from a marmoset with callitrichid hepatitis and its serologic association with disease. J Virol 65, 3995–4000.[Abstract/Free Full Text]

Tennant, B. C. (2001). The woodchuck model of hepatitis B virus infection. ILAR J 42, 89–102.[Medline]

Villoslada, P., Abel, K., Heald, N., Goertsches, R., Hauser, S. L. & Genain, C. P. (2001). Frequency, heterogeneity and encephalitogenicity of T cells specific for myelin oligodendrocyte glycoprotein in naive outbred primates. Eur J Immunol 31, 2942–2950.[CrossRef][Medline]

Wykrzykowska, J. J., Pauley, D. R., Lackner, A. A. & Simon, M. A. (1996). Evaluation of anti-human antibodies for immunohistochemistry on archival nonhuman primate tissues. J Med Primatol 25, 71–77.[Medline]

Zitzmann, N., Mehta, A. S., Carrouee, S., Butters, T. D., Platt, F. M., McCauley, J., Blumberg, B. S., Dwek, R. A. & Block, T. M. (1999). Imino sugars inhibit the formation and secretion of bovine viral diarrhea virus, a pestivirus model of hepatitis C virus: implications for the development of broad spectrum anti-hepatitis virus agents. Proc Natl Acad Sci U S A 96, 11878–11882.[Abstract/Free Full Text]

Received 13 February 2004; accepted 20 May 2004.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
J. Mankouri, A. Milward, K. R. Pryde, L. Warter, A. Martin, and M. Harris
A comparative cell biological analysis reveals only limited functional homology between the NS5A proteins of hepatitis C virus and GB virus B
J. Gen. Virol., August 1, 2008; 89(8): 1911 - 1920.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Murakami, T. Kimura, M. Osaki, K. Ishii, T. Miyamura, T. Suzuki, T. Wakita, and I. Shoji
Virological characterization of the hepatitis C virus JFH-1 strain in lymphocytic cell lines
J. Gen. Virol., July 1, 2008; 89(7): 1587 - 1592.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Carrion Jr., K. Brasky, K. Mansfield, C. Johnson, M. Gonzales, A. Ticer, I. Lukashevich, S. Tardif, and J. Patterson
Lassa Virus Infection in Experimentally Infected Marmosets: Liver Pathology and Immunophenotypic Alterations in Target Tissues
J. Virol., June 15, 2007; 81(12): 6482 - 6490.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
G. Haqshenas, X. Dong, H. Netter, J. Torresi, and E. J. Gowans
A chimeric GB virus B encoding the hepatitis C virus hypervariable region 1 is infectious in vivo
J. Gen. Virol., March 1, 2007; 88(3): 895 - 902.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Targett-Adams, T. Schaller, G. Hope, R. E. Lanford, S. M. Lemon, A. Martin, and J. McLauchlan
Signal Peptide Peptidase Cleavage of GB Virus B Core Protein Is Required for Productive Infection in Vivo
J. Biol. Chem., September 29, 2006; 281(39): 29221 - 29227.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. G. M. Doxiadis, M. K. H. van der Wiel, H. P. M. Brok, N. G. de Groot, N. Otting, B. A. 't Hart, J. J. van Rood, and R. E. Bontrop
Reactivation by exon shuffling of a conserved HLA-DR3-like pseudogene segment in a New World primate species
PNAS, April 11, 2006; 103(15): 5864 - 5868.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Takikawa, R. E. Engle, S. U. Emerson, R. H. Purcell, M. St. Claire, and J. Bukh
Functional analyses of GB virus B p13 protein: Development of a recombinant GB virus B hepatitis virus with a p7 protein
PNAS, February 28, 2006; 103(9): 3345 - 3350.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jacob, J. R.
Right arrow Articles by Mansfield, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacob, J. R.
Right arrow Articles by Mansfield, K. G.
Agricola
Right arrow Articles by Jacob, J. R.
Right arrow Articles by Mansfield, K. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS