|
|
||||||||

1 Laboratory for Molecular Biology, Department of Pediatrics, Charité, 10098 Berlin, Germany
2 Bone Marrow Transplant Program, Medical College of Wisconsin, Milwaukee, WI 53226, USA
3 Viral Oncology Program, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD 21231, USA
Correspondence
Sebastian Voigt
sebastian.voigt{at}charite.de
| ABSTRACT |
|---|
|
|
|---|
-chemokine MCK-2, SGG1 and an Fc
receptor gene, as reported here, the basic architecture of the MIE region (reported previously) and the level of IE2 and DNA polymerase (POL) protein conservation in phylogenetic analyses, it is clear that the English strain of RCMV is also a member of the genus Muromegalovirus, but is a
-herpesvirus species that is very distinct from both MCMV and RCMV (Maastricht). Both the lack of a CD200 homologue in the other two rodent viruses and the depth of sequence divergence of the rodent CMV IE2 and POL proteins suggest that these three viruses have evolved as separate species in the genus Muromegalovirus since very early in the host rodent lineage.
In memory of William H. Burns. ![]()
The sequences of the RCMV-E HindIII J and M fragments have been deposited in GenBank/EMBL/DDBJ under accession no. AY166871. The sequence of the RCMV-E POL protein has also been deposited under accession no. AY728086.
Predicted protein sequence alignments and a table of protein sequence identities are available as supplementary material in JGV Online.
| INTRODUCTION |
|---|
|
|
|---|
-herpesvirus species, including guinea pig cytomegalovirus (CMV), porcine CMV, tupaia herpesvirus and elephant endotheliolytic herpesvirus do not fit readily into any of these groups, based on partial phylogenetic and gene-content analyses. Human cytomegalovirus (HCMV) HHV-5 is an important pathogen in immunocompromised hosts and as a cause of developmental defects after congenital infections. The 220250 kb genomes of HCMV AD169 (Chee et al., 1990
-herpesviruses species or lineages, rather than different strains of the same virus (Beisser et al., 1998
Identification and characterization of genes in rodent CMVs is important for fully understanding and optimizing their use as models for HCMV infection and disease. A comparison of HCMV, CCMV, MCMV and RCMV-M shows that the middle portion of their genomes, encoding genes that are necessary for DNA replication and structural proteins, is very similar in both the position and orientation of most open reading frames (ORFs) and that they share considerable similarity. However, there is divergence in the ORFs to the right of the major immediate-early (MIE) enhancer, with the presence of an immediate-early US22-type ORF (ie2) in MCMV (Cardin et al., 1995
; Messerle et al., 1991
) and RCMV-M (Vink et al., 2000
), followed by several ORFs that are not present in the attenuated and deleted HCMV laboratory strains AD169 and Towne, compared to the clinical isolate Toledo (Cha et al., 1996
).
We wondered whether these ORFs that are unique to MCMV and RCMV-M are also present in RCMV-E and, if so, whether conserved coding regions might be identified, suggesting important functional domains. This information would be particularly useful, as the production of recombinant viruses in rodent CMVs is possible and such recombinants can be used in animal experiments to elucidate the biological functions of these genes (Brune et al., 2000
).
Here, we report three cellular and five viral gene homologues that are present in the genome of RCMV-E. Except for the four HindIII-M homologues e135, e136, e137 and e138, we present the expression kinetics of these genes and compare them with the corresponding homologues in RCMV-M and MCMV. By structural analysis and homology comparisons of the two RCMV isolates, we show further evidence that these two viruses are distinct species. This conclusion is supported strongly by both the results of phylogenetic analyses and the finding of a novel viral CD200 (OX2) homologue in RCMV-E. Other ORFs that we identified include a homologue for salivary gland gene 1 (SGG1), a spliced gene shown in MCMV mutation studies to be important for growth in salivary glands, but not for replication of the virus in vitro (Lagenaur et al., 1994
; Vieira et al., 1994
), a
(CC)-chemokine (MacDonald et al., 1997
, 1999
) and an Fc
receptor homologue, which are also present in MCMV (Thäle et al., 1994
). The significance of these findings in an evolutionary context is discussed.
| METHODS |
|---|
|
|
|---|
3' and 5' rapid amplification of cDNA ends (RACE) and DNA sequencing.
Poly(A) RNA, tagged magnetically with µMACS oligo(dT) beads (Miltenyi Biotec), was extracted from REF cells that had been infected with RCMV for 24 h. RACE experiments were performed with a FirstChoice RLM-RACE kit (Ambion). After reverse transcription, the cDNA was first amplified by PCR using the 5'-RACE outer primer 5'-GCTGATGGCGATGAATGAACACTG-3' and a first gene-specific outer primer (5' outer GSP) (Table 1
). The cDNA was then reamplified with a 5'-RACE inner primer, 5'-CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3', and a second gene-specific inner primer (5' inner GSP) (Table 1
). To map the 3' end, cDNA was amplified with the 3'-RACE outer primer 5'-GCGAGCACAGAATTAATACGACT-3' and a gene-specific primer (3' GSP) (Table 1
). Products were amplified for 35 cycles on a Perkin Elmer 2400 thermocycler, visualized by electrophoresis on a 2 % agarose gel and cloned into the vector TOPO TA 2.1 (Invitrogen). The 3' and 5' cDNA ends were determined by sequencing the inserts with forward or reverse primers provided by the manufacturer on an ABI Prism 310 analyser (Perkin Elmer). Sequence data were assembled and analysed with DNASTAR (DNASTAR Inc.). Confirming information was obtained in duplicate experiments performed with 3'- and 5'-RACE kits obtained from Life Technologies.
|
-chemokine homologue and SGG1 were amplified by PCR, purified and nick-translated with [
-32P]dATP.
The following primers were used for amplification of DNA templates for Northern blot analysis: vOX2, ATGGCCACGTATAGCAAA (3228)/TAACTTAGGACACAACGGAAC (3890); ie2, CGATCACACCTATGTCAT (4241)/CACCATCGGTACTCGGAT (4791);
-chemokine, AGGTTCGTACTTGTAAAAGCA (5470)/ACGCGTTCGAATAGAACAGTA(6051); SGG1, ACCGTCACCAGTCCGTCGGCC (7201)/ACACACCTCACTATGGCA (7903). Numbers in parentheses delineate the position in nucleotides of the RCMV HindIII J and M fragments.
Identification of homologous genes and potential signal peptides.
ORFs over 300 nt in length that do not overlap with other ORFs by more than 60 % of their length were sought by using the DNASTAR ORF search procedure. The BLAST program was used to search for regions homologous to previously described genes. Alignments of homologous genes were generated with the help of the CLUSTAL X program and the BOXSHADE server (http://www.ch.embnet.org/software/BOX_form.html). Potential signal peptides were predicted by the SignalP program (http://www.cbs.dtu.dk/services/SignalP-2.0/).
| RESULTS |
|---|
|
|
|---|
-chemokine, Fc
receptor) or viral (ie2 and SGG1) homologues. Candidate TATA boxes were identified upstream of all eight ORFs. A summary of the overall ORF arrangements is depicted in Fig. 1
|
ORF encoding vOX2 (e127)
The first ORF upstream of the MIE enhancer in RCMV-E is e127, which is a highly conserved homologue of rat OX2 (Fig. 1a and b
). e127, like the cellular OX2, comprises an N-terminal variable domain fused to a similarly sized constant domain; this structure is characteristic of immunoglobulin superfamily (IGSF) proteins, suggesting that it interacts with other cell-surface molecules. Data obtained from RACE studies revealed major and minor start sites for transcription initiation at positions 2715 and 3093, which are both preceded by an appropriate TATA sequence (Table 1
). 3'-RACE analysis identified a poly(A) signal 53 bp after the termination codon at position 3963, followed by a poly(A) tag after 19 bp, as indicated in Table 1
. Therefore, the major transcript should consist of 1248 bp, which is consistent with the 1·5 kb poly(A) mRNA species detected by Northern blot analysis, which displayed late kinetics and complete inhibition by PFA (Fig. 2
a).
|
ORF encoding ie2 (e128)
An RCMV-E gene (e128) with strong similarity to RCMV-M r128 and MCMV m128 and lower similarity to U95 of HHV-6 and HHV-7 maps at a similar position and orientation upstream from the MIE domain as in the other rodent CMVs (Fig. 1a and b
). A TATA box and cap site, as well as an AAUAAA signal and a poly(A) tail, were identified by 5'-RACE and 3'-RACE analyses (Table 1
). Surprisingly, kinetic studies revealed that e128, in contrast to m128, is expressed at late times post-infection (Fig. 2b
). The unspliced e128 ORF (for a comparison with m128 and r128, see Table 2
) is 1430 bp in length and encodes a putative protein of 412 aa. e128 and m128 show 47 % identity, whereas r128 and e128 have 41 % identity. The amino acid sequences of all three proteins are provided in Supplementary Fig. B in JGV Online.
|
-chemokine (e131/129)
-chemokine. Northern blot analysis revealed a predominant spliced transcript of 1·5 kb, encompassing the originally defined ORFs 129 and 131 (Fig. 2c
|
The ECK-2 protein initiates with a putative signal peptide that is predicted to be cleaved from the protein between amino acid positions 18 and 19. Four conserved cysteines are located at positions 22, 23, 45 and 60 in the N terminus of the predicted 306 aa sequence, which is characteristic of the
(CC) class of chemokines. The ECK-2 protein is more similar to MCMV MCK-2 (28 % identity) than to the RCMV-M r131 product (22 % identity; see Supplementary Fig. C in JGV Online).
ORF encoding SGG1 (e133)
The next ORF encodes a leftwards-oriented RCMV-E gene that has been named e133 (Fig. 1a
). Based on the results of our 5'- and 3'-RACE studies, RCMV-E e133 contains two TATA boxes and two transcription start sites, indicating that there is one transcript of 1·5 kb and another of 1·8 kb, with a common ATG and a single, common poly(A) tail (Fig. 3
a, top illustration; Table 1
). Both RCMV-E transcripts are similarly spliced and contain an intron of 265 bp (Fig. 3a
, intron A). The 1·5 kb RCMV-E transcript harbours a first exon of 864 bp that is separated from a second exon of 353 bp, with an ORF of 295 aa. The 1·8 kb e133 transcript consists of a first exon of 1041 bp that is shared for the most part with the 1·5 kb transcript. This larger 1·8 kb transcript encodes 347 aa in total. Both the 1·5 and 1·8 kb RCMV-E mRNA transcripts were detected at 6 h post-infection in the presence of PFA, thereby characterizing e133 as an early gene (Fig. 3a
).
|
ORFs encoding HJ3HJ6 (e135e138)
Further, we identified ORFs that are homologous to known ORFs in MCMV and RCMV-M that have been numbered e135, e136, e137 and e138, the latter being a Fc
receptor homologue. Protein sequence alignments of the putative Fc
receptor protein encoded by RCMV-E e138 and MCMV m138 revealed 24 % identity and 42 % similarity, whereas RCMV-E e138 and RCMV-M r138 show 26 % identity and 41 % similarity (see Supplementary Fig. E in JGV Online).
Phylogenetic analysis of e127 and e138
Based on the protein alignment generated by CLUSTAL X, phylogenetic trees of OX2 homologues and viral Fc
receptor homologues were created (Fig. 4a and b
). Alignment of three herpesvirus OX2 (KSHV K14, HHV-7 U85 and RCMV-E e127) and three host OX2 (rat, human and mouse) protein sequences shows that RCMV-E OX2 is clearly most closely related evolutionarily to the host OX2 genes and is more distant from the other viral homologues. RCMV-E e138 was more distantly related to the cellular Fc
receptors than MCMV m138, but more closely than r138.
|
-herpesviruses
-herpesvirus from RCMV-M, rather than the two being strains of the same species, we also carried out phylogenetic analyses with protein sequence data from the conserved exon 5-coding region of the RCMV-E IE2 gene (Sandford et al., 1993
-herpesviruses. We found a significantly closer relationship for both the IE2/ie3 (Fig. 4| DISCUSSION |
|---|
|
|
|---|
-herpesvirus species (Beisser et al., 1998
-herpesvirus species and not simply as two strains of RCMV; it remains to be seen which, if either, is the predominant strain of RCMV in wild rats.
The first viral conserved ORF that was identified upstream from the RCMV-E MIE region has been named e128 and is a homologue of the muromegalovirus genes m128 and r128. These are all members of the paralogous US22 family of genes of unknown function that occur as multiple dispersed and highly diverged copies in all sequenced
-herpesviruses. So far, no directly matching homologue for this version of the US22 family has been identified within the HCMV or other primate CMV genomes; the positionally equivalent HCMV and CCMV UL128 genes instead appear to be related more closely to chemokines (Akter et al., 2003
).
In comparison with e128, which is 1430 bp in length, the RCMV-M r128 ORF comprises 1223 bp, encoding a putative 408 aa protein, and thus parallels the size of e128. However, the e128 transcript, totalling 1·65 kb, exhibits expression characteristics distinct from those of MCMV m128. Firstly, RACE analyses of e128 (Table 1
) did not reveal any splicing modifications, but rather one long transcript and a single exon that parallel the structure of r128. In contrast, the m128 gene is spliced into three exons, with the third exon giving rise to a 391 aa protein that has been shown to be dispensable for growth, as well as for latency, in mice and does not show a growth phenotype when disrupted (Cardin et al., 1995
; Ménard et al., 2003
). Secondly, unlike the MCMV version, which is expressed most abundantly at 2 h post-infection (Messerle et al., 1991
), e128 mRNA was not expressed at immediate-early times, but rather at delayed-early and late times after infection, as shown by its partial sensitivity to the addition of PFA (Fig. 2b
). Kinetic studies for r128 have not been reported.
Further, we identified a homologue (ECK-2) of a gene encoding a spliced
-chemokine (CC) protein that is present in both RCMV-M (r131) (Vink et al., 2000
) and MCMV (m131/129 or MCK-2) (MacDonald et al., 1999
). This leftwards-oriented gene (e131/129) of RCMV-E DNA occurs in a similar position and orientation to those in MCMV (Fig. 1a
). Other homologues of cellular genes encoding
(CXC)-chemokines or chemokine receptors have been described in HCMV (UL146, ULl47 and UL33, UL78, US27 or US28).
(CC)-chemokine genes have been reported for rodent CMV, KSHV (Nicholas et al., 1997
), HHV-6B (French et al., 1999
; Lüttichau et al., 2003
) and guinea pig CMV (Haggerty & Schleiss, 2002
; Penfold et al., 2003
). Moreover, it has been predicted that the UL128 genes of simian CMV, CCMV and HCMV may also encode spliced
-chemokines, and HCMV UL128 is modified upon passage of the virus in cell culture (Akter et al., 2003
).
RCMV-E e131/129 (ECK-2) is structurally very similar to MCMV m131/129, which is also spliced, and both genes contain a similarly sized intron of approximately 80 bp. The RCMV-M
-chemokine was initially identified as unspliced (Vink et al., 2000
). However, the presence of an additional, but previously unrecognized, spliced
-chemokine gene in RCMV-M (named RCK-3), located immediately adjacent to r131, has recently been reported (Akter et al., 2003
). Further analysis revealed that RCK-3 is the spliced form of r129 (Kaptein et al., 2004
).
The ECK-2 gene contains a highly basic insertion that is not present in MCK-2 or RCK-2/-3 (see Supplementary Fig. C in JGV Online). In comparison with ECK-2, only the spliced MCK-2 mRNA is expressed abundantly in MCMV, although its size in Northern blot analysis is smaller (MacDonald et al., 1999
).
Another gene, RCMV-E e133, is homologous to r133 and m133 (also named SGG1). The latter has been reported to be important for MCMV replication in salivary-gland acinar cells (Lagenaur et al., 1994
; Manning et al., 1992
). By RACE analyses, we identified two identically spliced mRNAs of 1·5 and 1·8 kb for e133. Similarly spliced mRNAs have been documented for m133. However, our sequence analyses predict another, hitherto unreported, splice variant for both e133 and m133. Moreover, we predict four possible splice variants for RCMV-M r133, which has been reported to encode a single exon and thus an unspliced gene (Vink et al., 2000
) (Fig. 3
and Table 2
).
Northern blot analysis of e133 showed two similarly expressed 1·5 and 1·8 kb transcripts, corresponding to those that have also been reported for MCMV m133. However, in that case, the 1·8 kb transcript was less abundant than the 1·5 kb transcript. Both e133 transcripts were readily detectable at late times post-infection (Fig. 3a
), whereas only the 1·5 kb MCMV m133 transcript has been reported to be detectable at low levels late in infection (Lagenaur et al., 1994
).
Homologues of RCMV-M r135 (HJ3), r136 (HJ4), r137 (HJ5) and r138 (HJ6) (Vink et al., 2000
), as well as m135m138 of MCMV (Vieira et al., 1994
), were identified within the RCMV-E sequence, with all having the same arrangement and orientation (Fig. 1a
). Based on similarity to cellular Fc receptor genes (see Supplementary Fig. E in JGV Online), we predict that e138, like MCMV m138 (or FCR-1) (Thäle et al., 1994
), may act as a receptor for the Fc domain of immunoglobulin G (IgG). Similar genes have been described for HCMV (Atalay et al., 2002
; Lilley et al., 2001
). Analysis of a MCMV m138 deletion mutant showed that this virus replicates poorly in vivo, but normally in vitro, compared with wild-type MCMV (Crnkovi
-Mertens et al., 1998
).
A surprise finding was a highly conserved homologue of the rat OX2 (CD200) gene, located in the place of the AAV REP homologue found in RCMV-M (Vink et al., 2000
). The host rat CD200 gene was originally defined as the target of a monoclonal antibody against rat thymocytes (McMaster & Williams, 1979
; Ragheb et al., 1999
) and has been shown to bind CD200R (Wright et al., 2000
). The CD200CD200R interaction is important in negative regulation of myeloid function. CD200 is present on the cell surface of a variety of cell types, including neurons, endothelial cells, B cells, T cells and follicular dendritic cells (Barclay, 1981
; Barclay & Ward, 1982
; Barclay et al., 1986
; Wright et al., 2001
).
Another, very different viral homologue of OX2 is found in two related
-herpesviruses in the genus Rhadinovirus: KSHV vOX2 or K14 and rhesus rhadinovirus (RRV) R15 (Alexander et al., 2000
; Russo et al., 1996
). KSHV K14 has been reported to target and activate myeloid-lineage cells, resulting in the production of inflammatory cytokines (Chung et al., 2002
). On the contrary, another analysis of the same protein demonstrated that, similarly to the host CD200 protein, K14 downregulates myeloid function (Foster-Cuevas et al., 2004
). Similarly, analyses with the host mouse OX2 gene have shown that it has inhibitory effects on macrophage function (Hoek et al., 2000
). Further, an antagonistic role for cellular OX2 in antigen presentation has been described (Gorczynski et al., 1999
).
Less conserved OX2 homologues are also found in both HHV-6 (U85) (Gompels et al., 1995
) and HHV-7 (U85) (Nicholas, 1996
), as well as in several members of the family Poxviridae (Cameron et al., 1999
; Kilpatrick & Rouhandeh, 1985
; Lee et al., 2001
; Tulman et al., 2001
; Willer et al., 1999
). A phylogenetic analysis of OX2 protein sequences from KSHV K14, HHV-7 and RCMV-E revealed that there is no reason to suggest that there is any collinearity between the three viral OX2 genes and they appear to have been captured and evolved independently of one another, with the RCMV-E version retaining the greatest similarity to the cellular versions (therefore being the most recently captured?).
Moreover, phylogenetic analyses of the conserved exon 5 segment of the IE2/ie3 protein sequences, as well as of the viral POL proteins, were carried out to further investigate the relationship of RCMV-E to RCMV-M and MCMV. Both phylogenetic trees clearly demonstrate the close relationships among HHV-6A/B and HHV-7, the primate CMV lineages and all of the rodent CMV isolates, but, importantly, they also reveal significant sequence divergence among the rodent CMV IE2/ie3 and POL proteins, suggesting that RCMV-E, RCMV-M and MCMV have been evolving as separate and distinct species since very early in the development of the rodent lineage. In general, comparison of the ie2,
-chemokine, SGG1 and Fc receptor genes between RCMV-E, RCMV-M and MCMV revealed slightly higher identities in all cases between the RCMV-E and MCMV versions than between the RCMV-M and MCMV versions, with the exception of the Fc receptor homologue (see Fig. 4
and Supplementary Fig. E in JGV Online). Remarkably, the complex, experimentally proven splicing patterns for both the RCMV-E chemokine and SGG1 homologues were not found in RCMV-M and thus are also more similar to the MCMV versions. These findings argue strongly for RCMV-E being designated as a distinct species in the genus Muromegalovirus.
Why have the two RCMVs acquired different genes and what are the possible consequences? Both were apparently isolated from Rattus norvegicus (Bruggeman et al., 1982
; Priscott & Tyrrell, 1982
). However, as virus species survive by occupying distinct biological niches (Davison, 2002
), it is plausible that RCMV-E and RCMV-M either evolved originally within very distinct genera of rats or that they occupy different biological niches within the same host species. The former scenario is supported by the finding that multiple CMVs isolated from R. norvegicus and Rattus rattus in Australia show similar growth phenotypes to RCMV-E and RCMV-M, respectively. However, the R. rattus isolates were found to be genetically different from both RCMV-E and RCMV-M (Smith et al., 2004
).
The OX2 gene has been described in R. norvegicus (Clark et al., 1985
) and it is possible that RCMV-E has captured this gene from the host genome fairly recently. The two RCMVs differ not only by their genomic content, but also by overall genome size (as measured by restriction-enzyme digests). It is not known whether freshly isolated RCMV-E may have originally resembled the size of RCMV-M and MCMV, or whether it perhaps lost genes during passage in tissue culture, as has been demonstrated for HCMV laboratory strains AD169 and Towne (Cha et al., 1996
). Possibly, RCMV-E has captured cellular genes, such as OX2 and a C-type lectin homologue, to substitute for genes mapping elsewhere along the genome that may have been lost during the evolutionary process, or only one or the other of these two viruses underwent positive selection to retain certain gene functions. The absence of approximately 25 kb from the RCMV-E genome does not appear to handicap virus replication, either in vitro or in vivo. On the contrary, RCMV-E replicates even better in tissue culture than RCMV-M. It remains to be determined whether particular RCMV-E genes, such as OX2, contribute to viral fitness in vivo and whether these genes are advantageous to the virus. Currently, we are investigating the role of RCMV OX2 in vitro and in vivo to understand how this viral homologue functionally affects the biology of viral infection.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B. & Desrosiers, R. C. (2000). The primary sequence of rhesus monkey rhadinovirus isolate 26-95: sequence similarities to Kaposi's sarcoma-associated herpesvirus and rhesus monkey rhadinovirus isolate 17577. J Virol 74, 33883398.
Atalay, R., Zimmermann, A., Wagner, M., Borst, E., Benz, C., Messerle, M. & Hengel, H. (2002). Identification and expression of human cytomegalovirus transcription units coding for two distinct Fc
receptor homologs. J Virol 76, 85968608.
Bahr, U. & Darai, G. (2001). Analysis and characterization of the complete genome of tupaia (tree shrew) herpesvirus. J Virol 75, 48544870.
Barclay, A. N. (1981). Different reticular elements in rat lymphoid tissue identified by localization of Ia, Thy-1 and MRC OX 2 antigens. Immunology 44, 727736.[Medline]
Barclay, A. N. & Ward, H. A. (1982). Purification and chemical characterisation of membrane glycoproteins from rat thymocytes and brain, recognised by monoclonal antibody MRC OX 2. Eur J Biochem 129, 447458.[Medline]
Barclay, A. N., Clark, M. J. & McCaughan, G. W. (1986). Neuronal/lymphoid membrane glycoprotein MRC OX-2 is a member of the immunoglobulin superfamily with a light-chain-like structure. Biochem Soc Symp 51, 149157.[Medline]
Beisser, P. S., Kaptein, S. J. F., Beuken, E., Bruggeman, C. A. & Vink, C. (1998). The Maastricht strain and England strain of rat cytomegalovirus represent different betaherpesvirus species rather than strains. Virology 246, 341351.[CrossRef][Medline]
Bruggeman, C. A., Meijer, H., Dormans, P. H., Debie, W. M., Grauls, G. E. & van Boven, C. P. (1982). Isolation of a cytomegalovirus-like agent from wild rats. Arch Virol 73, 231241.[CrossRef][Medline]
Brune, W., Messerle, M. & Koszinowski, U. H. (2000). Forward with BACs: new tools for herpesvirus genomics. Trends Genet 16, 254259.[CrossRef][Medline]
Burns, W. H., Barbour, G. M. & Sandford, G. R. (1988). Molecular cloning and mapping of rat cytomegalovirus DNA. Virology 166, 140148.[CrossRef][Medline]
Cameron, C., Hota-Mitchell, S., Chen, L., Barrett, J., Cao, J.-X., Macaulay, C., Willer, D., Evans, D. & McFadden, G. (1999). The complete DNA sequence of myxoma virus. Virology 264, 298318.[CrossRef][Medline]
Cardin, R. D., Abenes, G. B., Stoddart, C. A. & Mocarski, E. S. (1995). Murine cytomegalovirus IE2, an activator of gene expression, is dispensable for growth and latency in mice. Virology 209, 236241.[CrossRef][Medline]
Cha, T.-A., Tom, E., Kemble, G. W., Duke, G. M., Mocarski, E. S. & Spaete, R. R. (1996). Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains. J Virol 70, 7883.[Abstract]
Chee, M. S., Bankier, A. T., Beck, S. & 12 other authors (1990). Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr Top Microbiol Immunol 154, 125169.[Medline]
Chung, Y.-H., Means, R. E., Choi, J.-K., Lee, B.-S. & Jung, J. U. (2002). Kaposi's sarcoma-associated herpesvirus OX2 glycoprotein activates myeloid-lineage cells to induce inflammatory cytokine production. J Virol 76, 46884698.
Clark, M. J., Gagnon, J., Williams, A. F. & Barclay, A. N. (1985). MRC OX-2 antigen: a lymphoid/neuronal membrane glycoprotein with a structure like a single immunoglobulin light chain. EMBO J 4, 113118.[Medline]
Crnkovi
-Mertens, I., Messerle, M., Miloti
, I., Szepan, U., Ku
i
, N., Krmpoti
, A., Jonji
, S. & Koszinowski, U. H. (1998). Virus attenuation after deletion of the cytomegalovirus Fc receptor gene is not due to antibody control. J Virol 72, 13771382.
Davison, A. J. (2002). Evolution of the herpesviruses. Vet Microbiol 86, 6988.[CrossRef][Medline]
Davison, A. J., Dolan, A., Akter, P., Addison, C., Dargan, D. J., Alcendor, D. J., McGeoch, D. J. & Hayward, G. S. (2003). The human cytomegalovirus genome revisited: comparison with the chimpanzee cytomegalovirus genome. J Gen Virol 84, 1728.
Dolan, A., Cunningham, C., Hector, R. D. & 12 other authors (2004). Genetic content of wild-type human cytomegalovirus. J Gen Virol 85, 13011312.
Foster-Cuevas, M., Wright, G. J., Puklavec, M. J., Brown, M. H. & Barclay, A. N. (2004). Human herpesvirus 8 K14 protein mimics CD200 in down-regulating macrophage activation through CD200 receptor. J Virol 78, 76677676.
French, C., Menegazzi, P., Nicholson, L., Macaulay, H., DiLuca, D. & Gompels, U. A. (1999). Novel, nonconsensus cellular splicing regulates expression of a gene encoding a chemokine-like protein that shows high variation and is specific for human herpesvirus 6. Virology 262, 139151.[CrossRef][Medline]
Gompels, U. A., Nicholas, J., Lawrence, G., Jones, M., Thomson, B. J., Martin, M. E. D., Efstathiou, S., Craxton, M. & Macaulay, H. A. (1995). The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209, 2951.[CrossRef][Medline]
Gorczynski, R. M., Cattral, M. S., Chen, Z., Hu, J., Lei, J., Min, W.-P., Yu, G. & Ni, J. (1999). An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J Immunol 163, 16541660.
Haggerty, S. M. & Schleiss, M. R. (2002). A novel CC-chemokine homolog encoded by guinea pig cytomegalovirus. Virus Genes 25, 271279.[Medline]
Hansen, S. G., Strelow, L. I., Franchi, D. C., Anders, D. G. & Wong, S. W. (2003). Complete sequence and genomic analysis of rhesus cytomegalovirus. J Virol 77, 66206636.
Hoek, R. M., Ruuls, S. R., Murphy, C. A. & 9 other authors (2000). Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 290, 17681771.
Kaptein, S. J., van Cleef, K. W., Gruijthuijsen, Y. K., Beuken, E. V., van Buggenhout, L., Beisser, P. S., Stassen, F. R., Bruggeman, C. A. & Vink, C. (2004). The r131 gene of rat cytomegalovirus encodes a proinflammatory CC chemokine homolog which is essential for the production of infectious virus in the salivary glands. Virus Genes 29, 4361.[CrossRef][Medline]
Kilpatrick, D. R. & Rouhandeh, H. (1985). Cloning and physical mapping of Yaba monkey tumor virus DNA. Virology 143, 399406.[CrossRef][Medline]
Lagenaur, L. A., Manning, W. C., Vieira, J., Martens, C. L. & Mocarski, E. S. (1994). Structure and function of the murine cytomegalovirus sgg1 gene: a determinant of viral growth in salivary gland acinar cells. J Virol 68, 77177727.
Lee, H.-J., Essani, K. & Smith, G. L. (2001). The genome sequence of Yaba-like disease virus, a yatapoxvirus. Virology 281, 170192.[CrossRef][Medline]
Lilley, B. N., Ploegh, H. L. & Tirabassi, R. S. (2001). Human cytomegalovirus open reading frame TRL11/IRL11 encodes an immunoglobulin G Fc-binding protein. J Virol 75, 1121811221.
Lüttichau, H. R., Clark-Lewis, I., Jensen, P. Ø., Moser, C., Gerstoft, J. & Schwartz, T. W. (2003). A highly selective CCR2 chemokine agonist encoded by human herpesvirus 6. J Biol Chem 278, 1092810933.
MacDonald, M. R., Li, X.-Y. & Virgin, H. W., IV (1997). Late expression of a
chemokine homolog by murine cytomegalovirus. J Virol 71, 16711678.[Abstract]
MacDonald, M. R., Burney, M. W., Resnick, S. B. & Virgin, H. W., IV (1999). Spliced mRNA encoding the murine cytomegalovirus chemokine homolog predicts a
chemokine of novel structure. J Virol 73, 36823691.
Manning, W. C., Stoddart, C. A., Lagenaur, L. A., Abenes, G. B. & Mocarski, E. S. (1992). Cytomegalovirus determinant of replication in salivary glands. J Virol 66, 37943802.
McMaster, W. R. & Williams, A. F. (1979). Identification of Ia glycoproteins in rat thymus and purification from rat spleen. Eur J Immunol 9, 426433.[Medline]
Ménard, C., Wagner, M., Ruzsics, Z., Holak, K., Brune, W., Campbell, A. E. & Koszinowski, U. H. (2003). Role of murine cytomegalovirus US22 gene family members in replication in macrophages. J Virol 77, 55575570.
Messerle, M., Keil, G. M. & Koszinowski, U. H. (1991). Structure and expression of murine cytomegalovirus immediate-early gene 2. J Virol 65, 16381643.
Murphy, E., Yu, D., Grimwood, J. & 7 other authors (2003). Coding potential of laboratory and clinical strains of human cytomegalovirus. Proc Natl Acad Sci U S A 100, 1497614981.
Nicholas, J. (1996). Determination and analysis of the complete nucleotide sequence of human herpesvirus 7. J Virol 70, 59755989.[Abstract]
Nicholas, J., Ruvolo, V. R., Burns, W. H. & 7 other authors (1997). Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6. Nat Med 3, 287292.[CrossRef][Medline]
Penfold, M., Miao, Z., Wang, Y., Haggerty, S. & Schleiss, M. R. (2003). A macrophage inflammatory protein homolog encoded by guinea pig cytomegalovirus signals via CC chemokine receptor 1. Virology 316, 202212.[Medline]
Priscott, P. K. & Tyrrell, D. A. J. (1982). The isolation and partial characterisation of a cytomegalovirus from the brown rat, Rattus norvegicus. Arch Virol 73, 145160.[CrossRef][Medline]
Ragheb, R., Abrahams, S., Beecroft, R., Hu, J., Ni, J., Ramakrishna, V., Yu, G. & Gorczynski, R. M. (1999). Preparation and functional properties of monoclonal antibodies to human, mouse and rat OX-2. Immunol Lett 68, 311315.[CrossRef][Medline]
Rawlinson, W. D., Farrell, H. E. & Barrell, B. G. (1996). Analysis of the complete DNA sequence of murine cytomegalovirus. J Virol 70, 88338849.[Abstract]
Russo, J. J., Bohenzky, R. A., Chien, M.-C. & 8 other authors (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc Natl Acad Sci U S A 93, 1486214867.
Sandford, G. R. & Burns, W. H. (1996). Rat cytomegalovirus has a unique immediate early gene enhancer. Virology 222, 310317.[CrossRef][Medline]
Sandford, G. R., Ho, K. & Burns, W. H. (1993). Characterization of the major locus of immediate-early genes of rat cytomegalovirus. J Virol 67, 40934103.
Smith, L. M., Tonkin, J. N., Lawson, M. A. & Shellam, G. R. (2004). Isolates of cytomegalovirus (CMV) from the black rat Rattus rattus form a distinct group of rat CMV. J Gen Virol 85, 13131317.
Thäle, R., Lucin, P., Schneider, K., Eggers, M. & Koszinowski, U. H. (1994). Identification and expression of a murine cytomegalovirus early gene coding for an Fc receptor. J Virol 68, 77577765.
Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Kutish, G. F. & Rock, D. L. (2001). Genome of lumpy skin disease virus. J Virol 75, 71227130.
van Cleef, K. W. R., Scaf, W. M. A., Maes, K. & 7 other authors (2004). The rat cytomegalovirus homologue of parvoviral rep genes, r127, encodes a nuclear protein with single- and double-stranded DNA-binding activity that is dispensable for virus replication. J Gen Virol 85, 20012013.
Vieira, J., Farrell, H. E., Rawlinson, W. D. & Mocarski, E. S. (1994). Genes in the HindIII J fragment of the murine cytomegalovirus genome are dispensable for growth in cultured cells: insertion mutagenesis with a lacZ/gpt cassette. J Virol 68, 48374846.
Vink, C., Beuken, E. & Bruggeman, C. A. (2000). Complete DNA sequence of the rat cytomegalovirus genome. J Virol 74, 76567665.
Voigt, S., Sandford, G. R., Ding, L. & Burns, W. H. (2001). Identification and characterization of a spliced C-type lectin-like gene encoded by rat cytomegalovirus. J Virol 75, 603611.
Willer, D. O., McFadden, G. & Evans, D. H. (1999). The complete genome sequence of Shope (rabbit) fibroma virus. Virology 264, 319343.[CrossRef][Medline]
Wright, G. J., Puklavec, M. J., Willis, A. C., Hoek, R. M., Sedgwick, J. D., Brown, M. H. & Barclay, A. N. (2000). Lymphoid/neuronal cell surface OX2 glycoprotein recognizes a novel receptor on macrophages implicated in the control of their function. Immunity 13, 233242.[CrossRef][Medline]
Wright, G. J., Jones, M., Puklavec, M. J., Brown, M. H. & Barclay, A. N. (2001). The unusual distribution of the neuronal/lymphoid cell surface CD200 (OX2) glycoprotein is conserved in humans. Immunology 102, 173179.[CrossRef][Medline]
Received 20 August 2004;
accepted 3 November 2004.
This article has been cited by other articles:
![]() |
V. Wilhelmi, C. O. Simon, J. Podlech, V. Bohm, T. Daubner, S. Emde, D. Strand, A. Renzaho, N. A. W. Lemmermann, C. K. Seckert, et al. Transactivation of Cellular Genes Involved in Nucleotide Metabolism by the Regulatory IE1 Protein of Murine Cytomegalovirus Is Not Critical for Viral Replicative Fitness in Quiescent Cells and Host Tissues J. Virol., October 15, 2008; 82(20): 9900 - 9916. [Abstract] [Full Text] |