|
|
||||||||
1 Canadian Forest Service, Great Lakes Forestry Centre, 1219 Queen Street East, Sault Ste Marie, Ontario, Canada, P6A 2E5
2 Department of Microbiology, University of Guelph, Guelph, Ontario, Canada, N1G 2W1
Correspondence
Basil M. Arif
barif{at}nrcan.gc.ca
| ABSTRACT |
|---|
|
|
|---|
The GenBank/EMBL/DDBJ accession number of the complete genome sequence of CfDEFNPV reported in this paper is AY327402.
| INTRODUCTION |
|---|
|
|
|---|
Other defective baculoviruses that lack the ability to infect their natural hosts by the per os route have been reported. Deletions in the Spodoptera exigua mutilpe nucleopolyhedrovirus (MNPV) genome have been noted following serial passage in insect cell culture resulting in a virus that is non-infective per os (Heldens et al., 1996
). Studies of this defective virus led to the identification of the per os infectivity factor-2 (pif-2) (Pijlman et al., 2003
). Mutualistic interactions similar to that between CfMNPV and CfDEFNPV have been reported between virus genotypes of Spodoptera frugiperda nucleopolyhedroviruses (NPVs) with mixtures containing a complete genotype capable of being transmitted orally and a deletion mutant unable to be transmitted orally, resulting in increased pathogenicity (Lopez-Ferber et al., 2003
).
Efforts are being expended to elucidate the nature of the defect in CfDEFNPV and to understand CfDEFNPV's synergistic effect on CfMNPV. Essential to this purpose was the characterization of CfDEFNPV at the genomic and molecular levels. The sequences of several genes including CfDEFNPV ecdysteroid UDP-glucosyltransferase (egt), late expression factor-1 (lef-1) (Barrett et al., 1995
, 1996
), polyhedrin (GenBank accession no. U78194), p48, p82 and spindlin (Li et al., 1999
, 2000
) have previously been published or released in GenBank; plus CfDEFNPV-4 cathepsin and chitinase (U72030). CfDEFNPV-4 is a plaque purified strain of CfDEFNPV, capable of per os infection in C. fumiferana larvae. In this study, the CfDEFNPV genome was cloned as restriction fragments into plasmid vectors and the inserts sequenced. The complete genome was assembled and analysed and the sequence data compared to that of other baculovirus genomes.
The genomes of 26 baculoviruses are presently in GenBank, 23 from lepidopteran hosts, one dipteran baculovirus Culex nigripalpus NPV (Afonso et al., 2001
) and two hymenopteran baculoviruses, Neodiprion lecontei NPV (Lauzon et al., 2004
) and Neodiprion sertifer NPV (Garcia-Maruniak et al., 2004
). The lepidopteran baculoviruses consist of seven group I NPVs, nine group II NPVs, and with the recent addition of Agrotis segetum granulovirus (NC_005839), seven granuloviruses (GVs). Comparison of the CfDEFNPV genome with other baculovirus genomes may help determine genes essential for survival and those affecting individual variation among baculoviruses and provide insight into the evolutionary history of insect viruses. Analysis of the CfDEFNPV genomic sequence is a preliminary step in identifying its defect, understanding its relationship with CfMNPV and helping in the engineering of either virus for pest management.
| METHODS |
|---|
|
|
|---|
REN analysis and cloning of restriction fragments.
Purified viral DNA from CfDEFNPV was digested with HindIII, EcoRI, XbaI, BamHI and PstI and the generated restriction fragments cloned into pT7T3 18U or pUC19 vectors and the plasmids propagated in Gibco-BRL DH5
competent cells following the manufacturer's instructions. Fragments not cloned by the shotgun method were gel purified by using either the Gibco-BRL GlassMAX spin cartridge system or the phenol freeze method (Benson, 1984
) and cloned into pUC19.
Construction of physical and gene maps.
Initial sequence data were used to align fragments with overlapping open reading frames (ORFs). Confirmation of fragment positioning was carried out by double digestion of cloned DNA fragments with restriction enzymes to generate end and internal fragments to aid in map alignments. Cross-hybridization at high stringency was done to confirm sequence homology between fragments of different genomic digests using probes prepared with the Gibco-BRL Random Primers DNA Labelling system. Sequencing data from overlapping fragments were used to confirm physical mapping and the presence of small, uncloned fragments.
DNA sequencing and computer analysis.
Plasmid templates for sequencing were prepared from HindIII, EcoRI, XbaI, BamHI and PstI cloned DNA fragments by using either Qiagen plasmid midi kits or QIAprep 8 miniprep kits. Sequencing reactions were done using a Thermo Sequenase fluorescent-labelled primer cycle sequencing kit (Amersham Pharmacia) using forward and reverse primers. To fill in gaps, primer walking was done using Cy5-dATP internal labelling with the Amersham Pharmacia Auto Read kit. Overlapping fragments were sequenced to span REN junctions. DNA samples were electrophoresed on a Pharmacia ALF express automatic sequencer or were sequenced at core facilities. DNA sequence data were manually edited and analysed by using MacVector sequence analysis software (version 4.1.4) and DNAStar LASERGENE programs (version 5.0). Both strands were sequenced giving an average four times coverage. Sequence data were submitted to GenBank and database searches performed using the National Centre for Biotechnology Information BLAST searches (Altschul et al., 1990
, 1997
). ORFs encoding more than 50 aa with minimal overlap were accepted as putative genes, with the largest overlapping ORFs generally being selected. A limited number of exceptions were made if small or overlapping ORFs showed baculovirus similarity. Potential ORFs overlapping homologous regions (hrs) and containing hr palindromes were excluded. Protein alignments were done using DNAStar's MEGALIGN CLUSTALW and percentage amino acid identity indicates the percentage of identical residues between complete ORFs. The Simple Modular Architectural Research Tool (SMART) (Schultz et al., 1998
, 2000
) was used to analyse selected ORFs. Tandem Repeat Finder, with default settings (Benson, 1999
), was used to identify tandem repeats. CfDEFNPV hr palindromes were identified by comparing hr regions found in GenBank BLAST searches against themselves with the aid of the MacVector Pustell DNA matrix analysis program and by searching the genome using hr consensus sequences from Autographa californica MNPV (AcMNPV, Ayres et al., 1994
; Possee & Rohrmann, 1997
), Orgyia pseudotsugata MNPV (OpMNPV, Ahrens et al., 1997
; Possee & Rohrmann, 1997
), Bombyx mori NPV (BmNPV, Gomi et al., 1999
), Lymantria dispar MNPV (LdMNPV, Kuzio et al., 1999
), CfMNPV (de Jong et al., 2005
) and Anticarsia gemmatalis MNPV (AgMNPV, Garcia-Maruniak et al., 1996
). Codon usage was determined by using the countcodon program (http://www.kazusa.or.jp/codon/) (Nakamura et al., 2000
). Phylogenetic trees were constructed with DNAStar MEGALIGN CLUSTALW protein alignments of 29 conserved baculovirus protein concatamers using default conditions, phylogenetic analysis using parsimony (PAUP 4.0b10; Swofford, 2003
), maximum-parsimony analysis with heuristic search and stepwise addition option; and were confirmed by bootstrap analysis with heuristic search and 1000 replicates.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
|
|
Other defective viruses that have been reported previously, generally contain clear deletions and their genomes are shorter than their helper viruses. These deletion genomes may have a replicative advantage due to their shorter length (Lopez-Ferber et al., 2003
). CfDEFNPV is unusual in that its genome is larger than its helper virus, CfMNPV, and it does not have a clear deletion. CfDEFNPV contained all 29 genes so far conserved in the fully sequenced baculovirus genomes present in GenBank (Lauzon et al., 2004
) and all 62 ORFs listed as conserved lepidopteran baculovirus genes (Herniou et al., 2003
). Some genes attributed to DNA replication and found in some but not all baculoviruses, including proliferating cell nuclear antigen (pcna), ribonucleotide reductase large subunit (rr1) and small subunit (rr2), and dutpase (Hayakawa et al., 2000
), were not found in CfDEFNPV. Ribonucleotide reductase is involved in the conversion of host cell rNTPs into dNTPs for use in viral DNA synthesis, which may allow the virus to replicate in non-dividing cells where dNTP pathways are inactive (Ahrens et al., 1997
). In vaccinia virus, deletion of ribonucleotide reductase greatly reduces virulence in vivo but has little effect on replication in cell culture (Child et al., 1990
). Lack of a functional dutpase gene is associated with increased mutation frequency in feline immunodeficiency virus (Lerner et al., 1995
) and to a delay in replication in non-dividing cells (Turelli et al., 1996
).
All transcription specific genes reported in other baculoviruses were found, although, Cfdef50 (lef-10) had a 139 bp overlap with Cfdef51 (vp1054). An enhancin homologue was not found, otherwise all genes encoding identified NPV structural proteins were present (Hayakawa et al., 2000
). Enhancins are viral synergistic factors that dramatically enhance the oral infectivity of NPVs (Derksen & Granados, 1988
). Viral enhancing factors (vef) identified in several GVs and type II NPVs, are metalloproteinases that appear to be involved in the degradation of the peritrophic membrane leading to increased viral potency (Wang & Granados, 1997
). A vef with a metalloprotease zinc-binding signature domain has been identified in CfMNPV (de Jong et al., 2005
). Perhaps the presence of the CfMNPV VEF in mixed infections may help CfDEFNPV infect C. fumiferana larvae by the per os route. The presence of a gp64 homologue (Cfdef123) suggested that CfDEFNPV is a group I NPV (Pearson et al., 2000
). An ld130 (ac23) homologue or F protein was also present (Cfdef21). ld130 homologues are thought to be the primordial baculovirus envelope fusion proteins (Pearson et al., 2000
), and are thought to act as functional analogues for gp64 in Group II NPVs (Kuzio et al., 1999
).
Auxiliary genes such as the apoptosis inhibitor p35 (ac135) and conotoxin-like protein genes (ctl-1/ac3, ctl-2/op30) were not found but homologues to iap-1, -2, -3 and -4 were present. iap-3 homologues in Cydia pomonella GV (CpGV, Luque et al., 2001
) and OpMNPV block apoptosis induced by AcMNPV infection (Crook et al., 1993
; Birnbaum et al., 1994
). Cfdef30 (iap-3) appears to function in the same way as cp17/op35 (iap-3) (data not shown). Cfdef99 (iap-4, 114 nt) was significantly shorter than op106 (iap-4, 357 nt). Neonate or late instar S. frugiperda larvae infected with a wild-type AcMNPV or a ctl-1 knockout mutant, showed no differences in mortality, motility or weight gain suggesting ctl-1 is not an essential gene (Eldridge et al., 1992
). AcMNPV has a ctl-1, OpMNPV and LdMNPV have ctl-1 and ctl-2 while CfDEFNPV lacks both.
Other genes identified in the genomes of CfDEFNPV and OpMNPV but not in AcMNPV included homologues to op5/Cfdef2, op9/Cfdef7 (ptp-2), op36/Cfdef31, op37/Cfdef32, op110/Cfdef104, op113/Cfdef108 and op150/Cfdef144. Genes found in CfDEFNPV and AcMNPV but not in OpMNPV included homologues to ac33/Cfdef27 (histidinol-phophatase, hisP), ac69/Cfdef65 (methyl transferase, met) and ac105/Cfdef97 and 98 (he65). A number of genes may have been acquired independently in different viruses, he65, for example, being obtained in at least three ways (Herniou et al., 2001
). ac105 (he65) is 554 aa in length while he65 homologues, bm89 and ha61, are much smaller at 289 and 236 aa, respectively. Cfdef97 (217 aa), corresponded to the 3' end of ac105 and Cfdef98 (318 aa) to the 5' end with both having ATG start sites. An intergenic space of 67 nt was present between the two ORFs that also corresponded to the sequence of ac105. No sequencing error could be found but this possibility exists. The loss of 1 nt might have caused a frame-shift and loss of function for the two partial he65 ORFs, or the CfDEFNPV he65 homologues could have been acquired independently of ac105 and both might be functional. CfMNPV also lacked a full copy of he65, but contained short contiguous sequences, in different reading frames, which displayed similarity to portions of AcMNPV he65 (de Jong et al., 2005
).
Per os infectivity factors
During baculovirus infection, ingested occlusion bodies are dissolved in the alkaline midgut of the host, releasing occlusion-derived virus (ODV). The released virions pass through the peritrophic membrane and fuse to the midgut epithelial cells (Funk et al., 1997
). Three genes have so far been implicated in per os infectivity, including p74 (ac138), pif (ac119) and pif-2 (ac22). Deletion of the C terminus of ac138 (p74) abolishes per os infectivity but does not interfere with virus replication in cell culture (Kuzio et al., 1989
). P74 is a structural polypeptide of the ODV phenotype and is most likely associated with the outside surface of the virion envelope and involved in virus entry into midgut cells (Faulkner et al., 1997
). PIF (ac119), another structural protein of the ODV envelope, may be required between the binding of ODVs to the midgut cells and the beginning of DNA replication of the virus and may interact with P74 (Kikhno et al., 2002
). It is not yet known if a third protein involved in per os infectivity, PIF-2 (ac22), is an ODV-specific structural protein, but it may have co-evolved and been closely associated with PIF (Pijlman et al., 2003
). These genes appear to be well conserved in all baculoviruses even those in non-lepidopteran hosts that replicate only in midgut cells (Afonso et al., 2001
; Garcia-Maruniak et al., 2004
; Lauzon et al., 2004
).
p74 (Cfdef132), pif (Cfdef114) and pif-2 (Cfdef10) were all present in CfDEFNPV. No marked mutations or deletions were noted in Cfdef132 (p74), but since it had two potential translational start sites, it was potentially larger than ac138 (p74). Cfdef132 had a hydrophobic C terminus determined by the KyteDoolittle scale and had several domains with an
-helical structure determined with Chou-Fasman analysis, as in ac138 (Faulkner et al., 1997
; Slack et al., 2001
). PIF homologues generally contain 19 conserved cysteines (Kikhno et al., 2002
). Cfdef114 (PIF) contained all the conserved cysteines but CLUSTALW alignments showed that the last cysteine did not align directly with the last cysteine in other PIF homologues. It is not known if this minor change would alter potential disulfide bond formation and folding of the PIF protein. SMART analysis showed that Cfdef114 contained a signal peptide and a transmembrane domain as in the Spodoptera littoralis NPV M2 PIF protein (Kikhno et al., 2002
). CLUSTALW alignment of Cfdef10 (PIF-2) with other PIF-2 homologues showed the expected 11 conserved cysteines (Pijlman et al., 2003
). SMART analysis indicated a transmembrane domain and a signal peptide, and the KyteDoolittle scale revealed a hydrophobic N terminus, as in other PIF-2 homologues (Pijlman et al., 2003
). An inversion is present in CfDEFNPV relative to other group I NPV genomes, involving Cfdef10 (pif-2) to Cfdef20. It is not known if this would affect the expression of pif-2 in any way. It is also possible that since no significant irregularities were noted with the sequences of the three known per os infectivity factors and since electron microscopy has suggested that the defect in CfDEFNPV infection appears to be at the stage of the basal lamina (data not shown), that another yet unknown gene(s) product could be involved in the lack of per os infectivity in CfDEFNPV.
Baculovirus repeated ORFs
Baculovirus repeated ORFs (bros) exist in several baculoviruses and their expressed proteins may bind nucleic acids (Zemskov et al., 2000
). Members of the bro gene family have been separated into four groups based on the relationship of different bro domains with group I bros having three subgroups (Kuzio et al., 1999
). Four bro homologues were present in CfDEFNPV. Cfdef6 (BRO-a), appeared to be a group I bro and showed high amino acid identity to an AgMNPV BRO (Zanotto et al., 1992
) (81·7 % amino acid identity) followed by ac2 (77·2 %) and ld153 (BRO-n) (77·0 %). Cfdef59 (BRO-b), also appeared to be a group I bro but was closer to the subgroup containing ld161 (BRO-p), bm22 (BRO-a), ld33 (BRO-b) and bm81 (BRO-c). Cfdef101 (BRO-c) was in the group II bro family with close homology to ld32 (BRO-a), ld146 (BRO-l) and ld150 (BRO-m) while Cfdef112 (BRO-d) was closer to op116 (79·8 %) and Eppo111 (74·9 %) than to ac2 (19·5 %).
Other ORFs
A homologue of the v-trex gene found in AgMNPV and CfMNPV (cf114) thought to be involved in virus recombination or UV-light tolerance, was identified in CfDEFNPV (Cfdef119). Cfdef116 also showed similarity to an unknown AgMNPV ORF (Slack et al., 2004
). Two potential ORFs were identified that have not been found in other baculoviruses. Cfdef19 showed no BLASTP matches to GenBank sequences. The other potential unique ORF, Cfdef142, contained a CIDE-N conserved domain (pfam02017). This domain is found in caspase-activated (CAD) nucleases, which induces DNA fragmentation and chromatin condensation during apoptosis, and in the cell death activator proteins CIDE-A and CIDE-B, which are inhibitors of CAD nuclease. The two proteins interact through this domain (InterPro entry IPR003508). This suggested that Cfdef142 might play a role in the apoptotic pathway.
Homologous regions
hrs contain direct repeats and perfect or imperfect palindrome sequences, and are dispersed throughout most but not all baculovirus genomes. The number of hrs range from three in Cryptophlebia leucotreta GV (Lange & Jehle, 2003
) to 17 in Spodoptera litura NPV (Pang et al., 2001
). They have been implicated as origins of DNA replication (Pearson et al., 1992
; Leisy & Rohrmann, 1993
; Kool et al., 1995
; Xie et al., 1995
) and as enhancers of transcription (Guarino & Summers, 1986
; Theilmann & Stewart, 1992
). Major rearrangements, insertions and deletions in OpMNPV relative to AcMNPV have been detected near hrs and it is thought that hrs may be active in inter- or intra-molecular recombination (Ahrens et al., 1997
).
Thirteen hrs were found in CfDEFNPV containing a total of 39 imperfect palindromes (30 bp), with one to five palindromes per region (Fig. 3a
). A direct repeat region containing 2·7 copies of a 28 bp repeated sequence without a palindromic core, was also found between Cfdef144 and 145. The relatively low number of repeats per region is at variance with the higher frequency of repeats per hr in other baculoviruses, with CfMNPV containing 710 repeats per hr (de Jong et al., 2005
). Other examples of potential hrs with a single copy of a repeat unit have been demonstrated and it has been shown that a single repeat-element can support limited plasmid DNA replication in AcMNPV (Leisy et al., 1995
). The CfDEFNPV hr palindrome consensus GTTTTACAAGTACAATCGTACTTGTAAAAC, had the highest identity to the hr consensus sequence from BmNPV (Majima et al., 1993
), AcMNPV (Possee & Rohrmann, 1997
) and the AgMNPV hr4 consensus (Garcia-Maruniak et al., 1996
) (24/30 bases, 80 %) followed by the hr consensus from CfMNPV (de Jong et al., 2005
) (23/30 bases, 76·7 %) and OpMNPV (Possee & Rohrmann, 1997
) (18/30 bases, 60 %) (Fig. 3b
).
|
|
Comparison of CfDEFNPV with other baculoviruses
One would expect CfDEFNPV to share a close relationship to CfMNPV, as both were found in the same host. The CfDEFNPV genome, however, was larger, contained more ORFs and had more hr regions with fewer repeats per region than CfMNPV. CfDEFNPV did not have enhancin, pcna, ctl, an extra p26 homologue or the unique genes found in CfMNPV but had homologues to hisP (ac33), ac85, he65 (ac105), iap-4 (op106), op110 and eppo101 and eppo134 plus two unique genes, all of which are not present in CfMNPV. An inversion relative to CfMNPV was present involving Cfdef10 (pif-2) to Cfdef20. CfDEFNPV egt and lef-1 showed higher amino acid identities to OpMNPV than to CfMNPV (Barrett et al., 1995
, 1996
). The present study confirmed this observation, with 64 CfDEFNPV ORFs showing the same or higher amino acid identity to ORFs from OpMNPV than to those from CfMNPV. The overall mean amino acid identity for shared ORFs, however, was almost identical at 68·5 % with OpMNPV and 68·4 % for CfMNPV. P10 proteins are generally not highly conserved amongst baculoviruses (Van Oers & Vlak, 1997
). P10 proteins in CfDEFNPV and OpMNPV were an exception and shared 88·3 % amino acid identity (Table 2
). By comparison, the CfDEFNPV P10 protein was only 43·9 % identical with the P10 protein of CfMNPV. P10 is a highly expressed, very late baculovirus protein, which forms extensive fibrillar structures in the nucleus and cytoplasm of infected cells (Rohrmann, 1992
; Van Oers & Vlak, 1997
).
In comparing CfDEFNPV with other fully sequenced baculoviruses, the closest mean amino acid identity for shared proteins was to EppoNPV (68·9 %, Table 2
). CfMNPV shares a close identity with OpMNPV and this may be due to the shared ecological niche of their specific insect hosts in conifer trees (Lapointe et al., 2000
). CfDEFNPV and CfMNPV were isolated from the same host so one would expect them to share a close identity whereas EppoNPV was isolated from the light brown apple-moth, E. postvittana, a major pest of a variety of fruit crops in a geographically distinct region (New Zealand) from CfDEFNPV and CfMNPV. E. postvittana, however, like C. fumiferana, is a tortricid host (Hyink et al., 1998
).
More intriguing was the close amino acid identity of CfDEFNPV proteins with individual ORFs from AgMNPV. The EGT of AgMNPV shows 95·9 % amino acid identity with CfDEFNPV EGT (Rodrigues et al., 2001
). This study gave similar results with CfDEFNPV showing 87·8 % mean amino acid identity with the 29 complete AgMNPV ORFs available in GenBank including homologues to orf1, lef-2, polyhedrin, 1629 capsid, protein kinase (Zanotto et al., 1992
), ac78, ac79, gp41, ac81 (Liu & Maruniak, 1999
), egt (Rodrigues et al., 2001
), p26, p10 (Razuck et al., 2002
), ie-1 (AF368905), vlf-1, gp64 (AY123150), DNA polymerase (AY526324), 25k fp (AY532263) and the ORFs in the gp64 locus (Slack et al., 2004
, Table 2
). The main host of AgMNPV, Anticarsia gemmatalis, is a subtropical pest of soybean, far removed from the geographical distribution of C. fumiferana in the forests of North America. A study on the genomic and biological relationship between CfDEFNPV and AgMNPV is being conducted and will be submitted separately. Perhaps the host, and not geographical distribution, is more important in closely related viruses.
Phylogeny of CfDEFNPV
Phylogenetic trees based on the combined sequences of conserved baculovirus genes are more robust than those based on the sequences of individual genes and only a few individual genes give results close to the best combined tree (Herniou et al., 2001
, 2003
). A most parsimonious tree produced with the combined dataset of 29 conserved baculovirus proteins from 25 fully sequenced baculovirus genomes, placed CfDEFNPV as a group I NPV branching off after EppoNPV and before OpMNPV and CfMNPV (Fig. 5
).
|
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahrens, C. H., Russell, R. L. Q., Funk, C. J., Evans, J. T., Harwood, S. H. & Rohrmann, G. F. (1997). The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 229, 381399.[CrossRef][Medline]
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol 215, 403410.[CrossRef][Medline]
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 33893402.
Arif, B. M., Kuzio, J., Faulkner, P. & Doerfler, W. (1984). The genome of Choristoneura fumiferana nuclear polyhedrosis virus: molecular cloning and mapping of the EcoRI, BamHI, SmaI, XbaI and BglII restriction sites. Virus Res 1, 605614.[CrossRef]
Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586605.[CrossRef][Medline]
Barrett, J. W., Krell, P. J. & Arif, B. M. (1995). Characterization, sequencing and phylogeny of the ecdysteroid UDP-glucosyltransferase gene from two distinct nuclear polyhedrosis viruses isolated from Choristoneura fumiferana. J Gen Virol 76, 24472456.
Barrett, J. W., Lauzon, H. A., Mercuri, P. S., Krell, P. J., Sohi, S. S. & Arif, B. M. (1996). The putative LEF-1 proteins from two distinct Choristoneura fumiferana multiple nucleopolyhedroviruses share domain homology to eukaryotic primases. Virus Genes 13, 229237.[CrossRef][Medline]
Benson, S. A. (1984). A rapid procedure for isolation of DNA fragments from agarose gels. Biotechniques 2, 6668.
Benson, G. (1999). Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res 27, 573580.
Birnbaum, M. J., Clem, R. J. & Miller, L. K. (1994). An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs. J Virol 68, 25212528.
Chen, X., IJkel, W. F. J., Tarchini, R. & 8 other authors (2001). The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J Gen Virol 82, 241257.
Chen, X., Zhang, W. J., Wong, J. & 9 other authors (2002). Comparative analysis of the complete genome sequences of Helicoverpa zea and Helicoverpa armigera single-nucleocapsid nucleopolyhedroviruses. J Gen Virol 83, 673684.
Child, S. J., Palumbo, G. J., Buller, R. M. & Hruby, D. E. (1990). Insertional inactivation of the large subunit of ribonucleotide reductase encoded by vaccinia virus is associated with reduced virulence in vivo. Virology 174, 625629.[CrossRef][Medline]
Choi, J. & Guarino, L. A. (1995). The baculovirus transactivator IE1 binds to viral enhancer elements in the absence of insect cell factors. J Virol 69, 45484551.[Abstract]
Crook, N. E., Clem, R. J. & Miller, L. K. (1993). An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif. J Virol 67, 21682174.
de Jong, J. G., Lauzon, H. A. M., Dominy, C., Poloumienko, A., Carstens, E. B., Arif, B. M. & Krell, P. J. (2005). Analysis of the Choristonerua fumiferana nucleopolyhedrovirus genome. J Gen Virol 86, 929943.
Derksen, A. C. G. & Granados, R. R. (1988). Alteration of a lepidopteran peritrophic membrane by baculoviruses and enhancement of viral infectivity. Virology 167, 242250.[CrossRef][Medline]
Eldridge, R. L., Li, Y. & Miller, L. K. (1992). Characterization of a baculovirus gene encoding a small conotoxin-like polypeptide. J Virol 66, 65636571.
Faulkner, P., Kuzio, J., Williams, G. V. & Wilson, J. A. (1997). Analysis of p74, a PDV envelope protein of Autographa californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. J Gen Virol 78, 30913100.[Abstract]
Frank, S. A. (2003). Viral genetics: deadly partnerships. Nature 425, 251252.[Medline]
Funk, C. J., Braunagel, S. C. & Rohrmann, G. F. (1997). Baculovirus structure. In The Baculoviruses, pp. 732. Edited by L. K. Miller. New York: Plenum.
Garcia-Maruniak, A., Pavan, O. H. O. & Maruniak, J. E. (1996). A variable region of Anticarsia gemmatalis nuclear polyhedrosis virus contains tandemly repeated DNA sequences. Virus Res 41, 123132.[CrossRef][Medline]
Garcia-Maruniak, A., Maruniak, J. E., Zanotto, P. M. A., Doumbouya, A. E., Liu, J. C., Merritt, T. M. & Lanoie, J. S. (2004). Sequence analysis of the genome of the Neodiprion sertifer nucleopolyhedrovirus. J Virol 78, 70367051.
Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. J Gen Virol 80, 13231337.[Abstract]
Guarino, L. A. & Summers, M. D. (1986). Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. J Virol 60, 215223.
Harrison, R. L. & Bonning, B. C. (2003). Comparative analysis of the genomes of Rachiplusia ou and Autographa californica multiple nucleopolyhedroviruses. J Gen Virol 84, 18271842.
Hashimoto, Y., Hayakawa, T., Ueno, Y., Fujita, T., Sano, Y. & Matsumoto, T. (2000). Sequence analysis of the Plutella xylostella granulovirus genome. Virology 275, 358372.[CrossRef][Medline]
Hayakawa, T., Ko, R., Okano, K., Seong, S. I., Goto, C. & Maeda, S. (1999). Sequence analysis of the Xestia c-nigrum granulovirus genome. Virology 262, 277297.[CrossRef][Medline]
Hayakawa, T., Rohrmann, G. F. & Hashimoto, Y. (2000). Patterns of genome organization and content in lepidopteran baculoviruses. Virology 278, 112.[CrossRef][Medline]
Heldens, J. G. M., van Strien, E. A., Feldmann, A. M., Kulcsar, P., Munoz, D., Leisy, D. J., Zuidema, D., Goldbach, R. W. & Vlak, J. M. (1996). Spodoptera exigua multicapsid nucleopolyhedrovirus deletion mutants generated in cell culture lack virulence in vivo. J Gen Virol 77, 31273134.
Herniou, E. A., Luque, T., Chen, X., Vlak, J. M., Winstanley, D., Cory, J. S. & O'Reilly, D. R. (2001). Use of whole genome sequence data to infer baculovirus phylogeny. J Virol 75, 81178126.
Herniou, E. A., Olszewski, J. A., Cory, J. S. & O'Reilly, D. R. (2003). The genome sequence and evolution of baculoviruses. Annu Rev Entomol 48, 211234.[CrossRef][Medline]
Hyink, O., Graves, S., Fairbairn, F. M. & Ward, V. K. (1998). Mapping and polyhedrin gene analysis of the Epiphyas postvittana nucleopolyhedrovirus genome. J Gen Virol 79, 28532862.[Abstract]
Hyink, O., Dellow, R. A., Olsen, M. J., Caradoc-Davies, K. M. B., Drake, K., Herniou, E. A., Cory, J. S., O'Reilly, D. R. & Ward, V. K. (2002). Whole genome analysis of the Epiphyas postvittana nucleopolyhedrovirus. J Gen Virol 83, 957971.
IJkel, W. F. J., van Strien, E. A., Heldens, J. G. M., Broer, R., Zuidema, R. W., Goldbach, R. W. & Vlak, J. M. (1999). Sequence and organization of the Spodoptera exigua multicapsid nucleopolyhedrovirus genome. J Gen Virol 80, 32893304.
Kikhno, I., Gutierrez, S., Crozier, L., Crozier, G. & Ferber, M. L. (2002). Characterization of pif, a gene required for the per os infectivity of Spodoptera littoralis nucleopolyhedrovirus. J Gen Virol 83, 30133022.
Kool, M., Ahrens, C. H., Vlak, J. M. & Rohrmann, G. F. (1995). Replication of baculovirus DNA. J Gen Virol 76, 21032118.
Kuzio, J., Jaques, R. & Faulkner, P. (1989). Identification of p74 a gene essential for virulence of baculovirus occlusion bodies. Virology 173, 759763.[CrossRef][Medline]
Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. M. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 1734.[CrossRef][Medline]
Lange, M. & Jehle, J. A. (2003). The genome of the Cryptophlebia leucotrata granulovirus. Virology 317, 220236.[CrossRef][Medline]
Lapointe, R., Back, D. W., Ding, Q. & Carstens, E. B. (2000). Identification and molecular characterization of the Choristoneura fumiferana multicapsid nucleopolyhedrovirus genomic region encoding the regulatory genes pkip, p47, lef-12 and gta. Virology 271, 109121.[CrossRef][Medline]
Lauzon, H. A. M., Lucarotti, C. J., Krell, P. J., Feng, Q., Retnakaran, A. & Arif, B. M. (2004). Sequence and organization of the Neodiprion lecontei nucleopolyhedrovirus genome. J Virol 78, 70237035.
Leisy, D. J. & Rohrmann, G. F. (1993). Characterization of the replication of plasmids containing hr sequences in baculovirus-infected Spodoptera frugiperda cells. Virology 196, 722730.[CrossRef][Medline]
Leisy, D. J., Rasmussen, C., Kim, H. T. & Rohrmann, G. F. (1995). The Autographa californica nuclear polyhedrosis virus homologous region 1a: identical sequences are essential for DNA replication activity and transcriptional enhancer function. Virology 208, 742752.[CrossRef][Medline]
Lerner, D. L., Wagaman, P. C., Phillips, T. R., Prospero-Garcia, O., Henriksen, S. J., Fox, H. S., Bloom, F. E. & Elder, J. H. (1995). Increased mutation frequency of feline immunodeficiency virus lacking functional deoxyuridine-triphospatase. Proc Natl Acad Sci U S A 92, 74807484.
Li, X., Lauzon, H. A., Sohi, S. S., Palli, S. R., Retnakaran, A. & Arif, B. M. (1999). Molecular analysis of the p48 gene of Choristoneura fumiferana multicapsid nucleopolyhedroviruses CfMNPV and CfDEFNPV. J Gen Virol 80, 18331840.[Abstract]
Li, X., Barrett, J., Pang, A., Klose, R. J., Krell, P. J. & Arif, B. M. (2000). Characterization of an overexpressed spindle protein during a baculovirus infection. Virology 268, 5667.[CrossRef][Medline]
Li, L., Donly, C., Li, Q., Willis, L. G., Keddie, B. A., Erlandson, M. A. & Theilmann, D. A. (2002). Identification and genomic analysis of a second species of nucleopolyhedrovirus isolated from Mamestra configurata. Virology 297, 226244.[CrossRef][Medline]
Li, Q., Donly, C., Li, L., Willis, L. G., Theilmann, D. A. & Erlandson, M. A. (2002). Sequence and organization of the Mamestra configurata nucleopolyhedrovirus genome. Virology 294, 106121.[CrossRef][Medline]
Liu, J. C. & Maruniak, J. E. (1999). Molecular characterization of genes in the GP41 region of baculoviruses and phylogenetic analysis based upon GP41 and polyhedrin genes. Virus Res 64, 187196.[CrossRef][Medline]
Lopez-Ferber, M., Simon, O., Williams, T. & Caballero, P. (2003). Defective or effective? Mutualisitc interactions between virus genotypes. Proc R Soc Lond B Biol Sci 270, 22492255.[Medline]
Luque, T., Finch, R., Crook, N., O'Reilly, D. R. & Winstanley, D. (2001). The complete sequence of the Cydia pomonella granulovirus genome. J Gen Virol 82, 25312547.
Majima, K., Kobara, R. & Maeda, S. (1993). Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus. J Virol 67, 75137521.
Nakai, M., Goto, C., Kang, W., Shikata, M., Luque, T. & Kunimi, Y. (2003). Genome sequence and organization of a nucleopolyhedrovirus isolated from the smaller tea tortrix, Adoxophyes honmai. Virology 316, 171183.[CrossRef][Medline]
Nakamura, Y., Gojobori, T. & Ikemura, T. (2000). Codon usage tabulated from the international DNA sequence databases: status for the year 2000. Nucleic Acids Res 28, 292.
O'Reilly, D. R. (1997). Auxiliary genes of baculoviruses. In The Baculoviruses, pp. 267300. Edited by L. K. Miller. New York: Plenum.
O'Reilly, D. R., Miller, L. K. & Luckow, V. A. (1992). Baculovirus Expression Vectors. New York: W. H. Freeman.
Pang, Y., Yu, J., Wang, L. & 7 other authors (2001). Sequence analysis of the Spodoptera litura multicapsid nucleopolyhedrovirus genome. Virology 287, 391404.[CrossRef][Medline]
Pearson, M. N., Bjornson, R. M., Pearson, G. D. & Rohrmann, G. F. (1992). The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257, 13821384.
Pearson, M. N., Groten, C. & Rohrmann, G. F. (2000). Identification of the Lymantria dispar nucleopolyhedrovirus envelope protein provides evidence for a phylogenetic division of the Baculoviridae. J Virol 74, 61266131.
Pijlman, G. P., Pruijssers, A. J. P. & Vlak, J. M. (2003). Identification of pif-2, a third conserved baculovirus gene required for per os infection of insects. J Gen Virol 84, 20412049.
Possee, R. D. & Rohrmann, G. F. (1997). Baculovirus genome organization and evolution. In The Baculoviruses, pp. 109140. Edited by L. K. Miller. New York: Plenum.
Razuck, F. B., Ribeiro, B., Vargas, J. H., Wolff, J. L. & Ribeiro, B. M. (2002). Characterization of the p10 gene region of Anticarsia gemmatalis nucleopolyhedrovirus. Virus Genes 24, 243247.[CrossRef][Medline]
Rodems, S. M. & Friesen, P. D. (1995). Transcriptional enhancer activity of hr5 requires dual palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1. J Virol 69, 53685375.[Abstract]
Rodrigues, J. C., De Souza, M. L., O'Reilly, D., Velloso, L. M., Pinedo, F. J., Razuck, F. B., Ribeiro, B. & Ribeiro, B. M. (2001). Characterization of the ecdysteroid UDP-glucosyltransferase (egt) gene of Anticarsia gemmatalis nucleopolyhedrovirus. Virus Genes 22, 103112.[CrossRef][Medline]
Rohrmann, G. F. (1986). Evolution of occluded viruses. In The Biology of Baculoviruses, pp. 203215. Edited by R. R. Granados & B. A. Frederici. Florida: Boca Raton.
Rohrmann, G. F. (1992). Baculovirus structural proteins. J Gen Virol 73, 749761.
Schachtel, G. A., Bucher, P., Mocarski, E. S., Blaisdell, B. E. & Karlin, S. (1991). Evidence for selective evolution in codon usage in conserved amino acid segments of human alphaherpesvirus proteins. J Mol Evol 33, 483494.[CrossRef][Medline]
Schultz, J., Milpetz, F., Bork, P. & Ponting, C. P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 95, 58575864.
Schultz, J., Copley, R. R., Doerks, T., Ponting, C. P. & Bork, P. (2000). SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res 28, 231234.
Slack, J. M., Dougherty, E. M. & Lawrence, S. D. (2001). A study of the Autographa californica multiple nucleopolyhedrovirus ODV envelope protein p74 using a GFP tag. J Gen Virol 82, 22792287.
Slack, J. M., Ribeiro, B. M. & de Souza, M. L. (2004). The gp64 locus of Anticarsia gemmatalis multicapsid nucleoplyhedrovirus contains a 3' repair exonuclease homologue and lacks v-cath and ChiA genes. J Gen Virol 85, 211219.
Swofford, D. L. (2003). PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4, Sinauer Associates, Sunderland, Massachusetts.
Theilmann, D. A. & Stewart, S. (1992). Tandemly repeated sequence at the 3' end of the IE-2 gene of the baculovirus Orgyia pseudosugata multicapsid nuclear polyhedrosis virus is an enhancer element. Virology 187, 97106.[CrossRef][Medline]
Turelli, P., Petursson, G., Guiguen, F., Mornex, J. F., Vigne, R. & Querat, G. (1996). Replication properties of dUTPase-deficient mutants of caprine and ovine lentiviruses. J Virol 70, 12131217.[Abstract]
Van Oers, M. M. & Vlak, J. M. (1997). The baculovirus 10-kDA protein. J Invertebr Pathol 70, 117.[CrossRef][Medline]
Wang, P. & Granados, R. R. (1997). An intestinal mucin is the target substrate for a baculovirus enhancin. Proc Natl Acad Sci U S A 94, 69776982.
Wormleaton, S., Kuzio, J. & Winstanley, D. (2003). The complete sequence of the Adoxophyes orana granulovirus genome. Virology 311, 350365.[CrossRef][Medline]
Xie, W. D., Arif, B. M., Dobos, P. & Krell, P. J. (1995). Identification and analysis of a putative origin of DNA replication in the Choristoneura fumiferana multinucleocapsid nuclear polyhedrosis virus genome. Virology 209, 409419.[CrossRef][Medline]
Zanotto, P. M., Sampaio, M. J. A., Johnson, D. W., Rocha, T. L. & Maruniak, J. E. (1992). The Anticarsia gemmatalis nuclear polyhedrosis virus polyhedrin gene region: sequence analysis, gene product and structural comparisons. J Gen Virol 73, 10491056.
Zemskov, E. A., Kang, W. & Maeda, S. (2000). Evidence for nucleic acid binding ability and nucleosome association of Bombyx mori nucleopolyhedrovirus BRO proteins. J Virol 74, 67846786.
Received 30 July 2004;
accepted 12 November 2004.
This article has been cited by other articles:
![]() |
L. Wang, T. Z. Salem, D. J. Campbell, C. M. Turney, C. M. S. Kumar, and X.-W. Cheng Characterization of a virion occlusion-defective Autographa californica multiple nucleopolyhedrovirus mutant lacking the p26, p10 and p74 genes J. Gen. Virol., July 1, 2009; 90(7): 1641 - 1648. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. C. Wolff, F. H. Valicente, R. Martins, J. V. d. C. Oliveira, and P. M. d. A. Zanotto Analysis of the genome of Spodoptera frugiperda nucleopolyhedrovirus (SfMNPV-19) and of the high genomic heterogeneity in group II nucleopolyhedroviruses J. Gen. Virol., May 1, 2008; 89(5): 1202 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. d. C. Oliveira, J. L. C. Wolff, A. Garcia-Maruniak, B. M. Ribeiro, M. E. B. de Castro, M. L. de Souza, F. Moscardi, J. E. Maruniak, and P. M. d. A. Zanotto Genome of the most widely used viral biopesticide: Anticarsia gemmatalis multiple nucleopolyhedrovirus. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3233 - 3250. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ikeda, M. Shikata, N. Shirata, S. Chaeychomsri, and M. Kobayashi Gene organization and complete sequence of the Hyphantria cunea nucleopolyhedrovirus genome J. Gen. Virol., September 1, 2006; 87(9): 2549 - 2562. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Escasa, H. A. M. Lauzon, A. C. Mathur, P. J. Krell, and B. M. Arif Sequence analysis of the Choristoneura occidentalis granulovirus genome J. Gen. Virol., July 1, 2006; 87(7): 1917 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. M. Lauzon, A. Garcia-Maruniak, P. M. de A. Zanotto, J. C. Clemente, E. A. Herniou, C. J. Lucarotti, B. M. Arif, and J. E. Maruniak Genomic comparison of Neodiprion sertifer and Neodiprion lecontei nucleopolyhedroviruses and identification of potential hymenopteran baculovirus-specific open reading frames J. Gen. Virol., June 1, 2006; 87(6): 1477 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. van Oers, M. H. C. Abma-Henkens, E. A. Herniou, J. C. W. de Groot, S. Peters, and J. M. Vlak Genome sequence of Chrysodeixis chalcites nucleopolyhedrovirus, a baculovirus with two DNA photolyase genes J. Gen. Virol., July 1, 2005; 86(7): 2069 - 2080. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. de Jong, H. A. M. Lauzon, C. Dominy, A. Poloumienko, E. B. Carstens, B. M. Arif, and P. J. Krell Analysis of the Choristoneura fumiferana nucleopolyhedrovirus genome J. Gen. Virol., April 1, 2005; 86(4): 929 - 943. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |