|
|
||||||||
1 Wageningen University and Research Centre, Animal Sciences Group, Division of Infectious Diseases, 8200 AB Lelystad, The Netherlands
2 Central Institute for Animal Disease Control, PO Box 2004, 8203 AA Lelystad, The Netherlands
Correspondence
Ben P. H. Peeters
ben.peeters{at}wur.nl
| ABSTRACT |
|---|
|
|
|---|
The GenBank/EMBL/DDBJ accession number of the sequence determined in this work is AY741404.
| INTRODUCTION |
|---|
|
|
|---|
NDV strains can be classified as highly virulent (velogenic), intermediate (mesogenic) or non-virulent (lentogenic). This classification is based on the results of the mean death time in chicken eggs (Beard & Hanson, 1984
). The clinical signs of a highly virulent NDV infection in chickens can be extremely different depending on the strain of virus. Virulent strains that cause diarrhoea and frequently haemorrhagic intestinal lesions are called viscerotropic velogenic. Strains that cause respiratory and neurotropic signs are called neurotropic velogenic (Alexander, 1997
).
NDV is an enveloped virus with two membrane proteins: the haemagglutininneuraminidase (HN) protein involved in cell attachment and release, and the fusion (F) protein involved in mediating fusion of the viral envelope with cellular membranes. The F protein is synthesized as a precursor, F0, and is only fusogenic after cleavage into disulfide-linked F1 and F2 polypeptides. However, cleavage is not sufficient for the fusion process. The HN protein is also required for fusion to occur by cooperating with the F protein (Deng et al., 1997
). The consensus sequence of the F protein cleavage site of velogenic and mesogenic strains is 112(R/K)RQ(R/K)RF117. The consensus sequence of the lentogenic F cleavage site is 112(G/E)(K/R)Q(G/E)RL117. The different F protein cleavage sites are the substrates for different types of cellular proteases (Kawahara et al., 1992
; Sakaguchi et al., 1991
). The F protein of lentogenic viruses can be cleaved only by trypsin-like enzymes, as found in the respiratory and intestinal tracts, whereas the F protein of virulent viruses can be cleaved by a host protease(s) found in a wide range of cells and tissues. Consequently, infection with a virulent strain results in fatal systemic infection (Garten et al., 1980
; Nagai et al., 1976
). For this reason, the F protein cleavage site has been postulated as the primary determinant of virulence. However, comparison of the amino acid sequence of the F protein cleavage site with the intracerebral pathogenicity indices (ICPI) for several NDV viruses has shown that significant differences in virulence can exist between strains with the same velogenic consensus sequence. For instance, virulent field strain Herts/33 with the cleavage site 112RRQRRF117 has an ICPI value of 1·88 whereas strains Beaudette C/45 and Komarov with the same sequence showed ICPI values between 1·4 and 1·5 (Collins et al., 1993
). In addition, NDV isolates recovered from many different bird species with the same velogenic F protein cleavage site were found to exhibit different virulence levels in chickens. These NDV isolates were either mesogenic strains that produced mild pathogenesis or velogenic strains causing severe pathogenesis and death (Brown et al., 1999
). Moreover, using reverse genetics techniques, we previously established an infectious clone of the non-virulent LaSota strain (NDFL) and demonstrated that modification of the cleavage site 112GRQGRL117 to 112RRQRRF117 (NDFLtag) increased the ICPI from 0·00 to 1·28 (Peeters et al., 1999
). Although NDFLtag contains exactly the same F protein cleavage site as Herts/33, the ICPI did not reach the level of 1·88, indicating that other factors contribute to virulence. The most likely candidate would be the HN protein, since it is involved in viral entry. Another candidate could be the V protein of NDV. The V protein is the result of an mRNA editing event in which a G residue is inserted within the P gene mRNA (Curran et al., 1998
). This accessory V protein has been shown to act as an interferon antagonist (Park et al., 2003
; Huang et al., 2003
) and is involved in pathogenesis and host-range restriction (Mebatsion et al., 2001
; Park et al., 2003
).
In this study, we generated an infectious clone of the highly virulent strain Herts/33 (FL-Herts). To map virulence factors, sequences from NDFL or NDFLtag were replaced with sequences from FL-Herts and the virulence of the rescued chimeric virus was determined. The results showed that, in addition to the F protein, the HN protein also contributes to virulence. Our results agree with the results of Huang et al. (2004)
, who exchanged the HN genes of the virulent recombinant NDV strain Beaudette and the non-virulent recombinant strain LaSota and showed that the HN protein affected virulence. Furthermore, our experiments showed that the effect of HN on virulence was most prominent after intravenous inoculation and that both the stem region and the globular head of the HN protein seemed to be involved in determining virulence.
| METHODS |
|---|
|
|
|---|
NDV strain Herts/33 (CIDC-Lelystad) was grown in 911-day-old embryonated specific-pathogen-free (SPF) eggs. The recombinant strains NDFL and NDFLtag were derived from the NDV strain LaSota (ATCC VR-699) (Peeters et al., 1999
).
Sequencing and cloning of full-length Herts/33 cDNA.
All standard cloning procedures were performed as described by Sambrook et al. (1989)
, unless otherwise noted. Viral RNA of Herts/33 was isolated using the Trizol procedure as described by the supplier (Invitrogen). To clone the entire Herts/33 genome, overlapping subgenomic cDNA fragments were generated by RT-PCR as described previously (de Leeuw & Peeters, 1999
). The generated cDNA fragments were cloned into pGEM-T (Promega). The resulting plasmids were designated pH1, pH2, pH3, pH4 and pH5 and used for sequence analysis. The NDV-specific sequencing primers were derived from the NDV LaSota strain or from published Herts/33 sequences, or were established during this work.
To construct a full-length cDNA clone of Herts/33, a large dsDNA H35 linker (5'-ACCAAACAGAGAATCCGTGAGTTACGATAAAAGGCGAAGGAGCAATCGAAGTCGTACGGGTAGAAGACTAGTCAAAGAAGCGCGCATAGTTGCTCTTGATTATACTCTCGTCATTCACCAAATCTTTGTTTGGT-3') was obtained. The first 24 nt corresponded to the 3' end and the last 27 nt to the 5' end of NDV LaSota (de Leeuw & Peeters, 1999
). The linker contained a BsiWI site (bold), an SpeI site (underlined) and a BssHII site (italic). The linker was cloned between the StuI and SmaI sites of the transcription plasmid pOLTV5 (Peeters et al., 1999
). The resulting plasmid, with the H35 linker in the correct orientation, was designated pOLTV535NH. To clone the full-length Herts/33 cDNA in pOLTV535NH, the overlapping cDNA fragments H1 and H2, and H3, H4 and H5 were joined at shared restriction sites in pGEM-T. The resulting plasmids were designated pH1_2 and pH3_5, respectively. The SpeIBssHII fragment of pH3_5 and the BsiWISpeI fragment of pH1_2 were sequentially cloned. The resulting plasmid was designated pFL-Herts (Fig. 1
).
|
Cloning and expression of NP, P and L genes.
The NP, P and L genes of Herts/33 were cloned in the eukaryotic expression vector pCIneo (Promega) as described previously (Peeters et al., 1999
). The expression of functional NP, P and L proteins of Herts/33 was tested using the minigenome plasmid pOLTV553 (Peeters et al., 2000
).
Exchanging sequences between the full-length cDNAs of pFL-Herts and pNDFL or pNDFLtag.
Conserved unique restriction sites, present in both full-length constructs, were used for the replacement of sequences of pNDFL with sequences from pFL-Herts. The ApaISpeI fragment of pFL-Herts, which contains the P'HN' genes (nt 22908095) and the StuISpeI fragment of pFL-Herts, which contains the F'HN' genes (nt 46498095) were cloned in pNDFL. The resulting plasmids were designated pNDFL(P'-HN')Herts and pNDFL(F'-HN')Herts, respectively.
Construction of pNDFLtagAF.
Using PCR mutagenesis, the unique restriction sites AscI and FseI were introduced into full-length cDNA of pNDFLtag (nt 4527 and 6347, respectively). To introduce the unique AscI restriction site, PCR fragments were generated with pNDFLtag as template. The following pairs of primers were used: for PCR1(AscI), primers p3587+ (5'-CGGAGATCTTGTTGAGTTGG-3') and pAscI(F) (5'-CCCGGTTGGCGCGCCCCAGGTGC-3'); for PCR2(AscI), pAscI(R) (5'-GCACCTGGGGCGCGCCAACCGGG-3') and p5390 (5'-GTAGAGTTACCTGTATACCC-3'). The two overlapping PCR fragments were joined in a second PCR using primers p3587+ and p5390. The resulting PCR fragment was digested with PmlI and NotI and cloned in pNDFLtag. The resulting plasmid was designated pNDFLtagA. To introduce the unique FseI restriction site, PCR fragments were generated using the following pairs of primers: for PCR1(FseI), primers p4731+ (5'-AAGCTCCTCCCGAATCTGCC-3') and pFseI(R) (5'-CGCAATTGAGGGCCGGCCTCTCT-3'); for PCR2(FseI), pFseI(F) (5'-AGAGAGGCCGGCCCTCAATTGCG-3') and p367 (5'-AGGGACCTCAATACTAGCCAGTTC-3'). The two overlapping PCR fragments were joined in a second PCR using primers p4731+ and p367. The resulting PCR fragment was digested with NotI and SpeI and cloned in pNDFLtagA. The resulting plasmid was designated pNDFLtagAF.
Insertion of FHerts, HNHerts and the HN hybrid genes HNLH and HNHL in pNDFLtagAF.
The F gene of FL-Herts was PCR amplified using the primers FHf(AscI) (5'-TTGGCGCGCCCCAGGTGCAAGATGGGC-3') and FHr(XbaI) (5'-TCATCTGATCTAGAGTATTATTCCC-3'). The resulting PCR fragment was digested with AscI and XbaI (nt 6172) and ligated in the AscI and XbaI sites of pNDFLtagAF. The resulting plasmid was designated pNDFL(F)Herts. The HN gene of FL-Herts was PCR amplified using the primers pFseI(HF) (5'-GGGGAGGCCGGCCCTCAATCGGG-3') and p8106 (5'-AATCTCAACTAGTAAAGGAACGATC-3'). The resulting PCR fragment was digested with FseI and SpeI and ligated in the FseI and SpeI sites of pNDFLtagAF. The resulting plasmid was designated pNDFL(HN)Herts. Hybrid HN genes (HNLH and HNHL) were constructed as described previously (Peeters et al., 2001
). The hybrid HNLH gene contained the stem region of NDFL HN (aa 1143) and the globular head of FL-Herts HN (aa 144561). For this hybrid gene, PCR fragments were generated with the following pairs of primers: for NDFL HN, primers pFseI(F) (5'-AGAGAGGCCGGCCCTCAATTGCG-3') and pHNLHR (5'-GACATCACTAGCGTCATCTACAATAAGTTC-3'); for FL-Herts HN, primers pHNLHF (5'-GAACTTATTGTAGATGACGCTAGTGATGTC-3') and p8106. The two overlapping PCR fragments were joined in a second PCR using primers pFseI(F) and p8106. For the reciprocal hybrid HNHL gene [the stem region of FL-Herts HN (aa 1143) and the globular head of NDFL HN (aa 144577)], PCR fragments were generated with the following pairs of primers: for FL-Herts HN, primers pFseI(HF) and pHNLHR; for NDFL HN, primers pHNLHF and p367. The two overlapping PCR fragments were joined in a second PCR using primers pFseI(HF) and p367. The PCR fragments LH and HL were digested with FseI and SpeI and ligated in FseI and SpeI sites of pNDFLtagAF. The resulting plasmids were designated pNDFLtag(HN)LH and pNDFLtag(HN)HL, respectively.
Rescue of infectious virus.
To rescue viable virus from the various full-length (chimeric) constructs, QM5 cells were infected with FPV-T7 and co-transfected as described previously (Peeters et al., 1999
). One microgram of full-length cDNA, 1·6 µg pCIneoNP, 0·8 µg pCIneoP and 0·8 µg pCIneoL were used for each co-transfection. After 3 days, the culture supernatant was harvested and inoculated into the allantoic cavities of 911-day-old embryonated SPF eggs.
Cloning and expression of FHerts, HNHerts and hybrid HN genes in expression vector pCIneo.
The construction of the plasmids pCIneoFLS and pCIneoHNLS has been described previously (Peeters et al., 2001
). To clone the FHerts gene of pFL-Herts, primers HF5XHOF (5'-GAAGCTCGAGGATCCCGGTTGGCAC-3') and HF3MLUR (5'-TTACACGCGTATTGCTATTGGGGATACC-3') were used for PCR and the resulting DNA fragment was digested with XhoI and MluI and cloned in pCIneo. Expression of the FHerts protein, in the presence of an HN protein, was verified in an immunoperoxidase monolayer assay (IPMA; Wensvoort et al., 1986
) using monoclonal antibody 8E12A8C3 (CIDC Lelystad). To clone the HNHerts gene of pFL-Herts, primers HN5XHOF (5'-TCAYAACTCGAGTTCTACCGCWTCACC-3') and HN3NOTHR (5'-GGCTCGCGGCCGCATTCATTTTGATCC-3') were used for PCR and the resulting DNA fragment was digested with XhoI and NotI and cloned in pCIneo. To clone the hybrid HNLH gene of pNDFLtag(HN)LH, primers HN5XHOF and HN3NOTR (5'-AGCACGCGGCCGCATTCGGTTTGATTC-3') were used for PCR and the resulting DNA fragment was digested with XhoI and NotI and cloned in pCIneo. To clone the hybrid HNHL gene of pNDFLtag(HN)HL, primers HN5MLUF (5'-TCAYAAACGCGTTTCTACCGCWTCACC-3') and HN3NOTR were used for PCR and the resulting DNA fragment was digested with MluI and NotI and cloned in pCIneo. The expression of the (hybrid) HN proteins was verified in an IPMA using monoclonal antibody 5H11 (CIDC Lelystad).
Determination of fusion activity and haemadsorption.
DNA transfections using the FuGENE 6 procedure were carried out as described previously (de Leeuw et al., 2003
). Fusion activity of the NDV FLS and FHerts proteins was determined microscopically 24 and 48 h after co-transfection with the different HN genes by examining syncytium formation in QM5 cells. Before observation, the QM5 cells were washed with PBS and stained for 30 min with Giemsa (Merck; diluted 1 : 30 in water) and washed again with PBS.
Haemadsorption was carried out as described previously (Peeters et al., 2001
). QM5 cells were transfected with pCIneoHNLS, pCIneoHNHerts and the hybrid genes pCIneoHNLH and pCIneoHNHL (1 µg each). Forty-eight hours after transfection, the cells were incubated for 90 min with 1 % chicken red blood cells at 4 °C. The monolayers were then carefully washed three times with cold PBS and the adhesion of erythrocytes to transfected cells was examined microscopically. pCIneo was used as a negative control.
Haemagglutination (HA) assay and pathogenicity tests.
The HA assay and determination of the ICPI in 1-day-old chickens was performed as described previously (14 July, European Community, 1992
). The intravenous pathogenicity index (IVPI) in 6-week-old chickens was performed as described previously (19 May, European Community, 1992
).
| RESULTS |
|---|
|
|
|---|
Rescue of infectious Herts/33 virus from full-length cDNA
The helper plasmids pCIneoNPHerts, pCIneoPHerts and pCIneoLHerts (see Methods) were used to rescue strain Herts/33 from full-length cDNA pFL-Herts. The rescued virus was designated FL-Herts and showed an ICPI of 1·63 (Table 1
), which was higher than that of NDFLtag (ICPI=1·28) but lower than the published value of Herts/33 field strain (ICPI=1·88). The IVPI value for FL-Herts was 2·29 (Table 2
), which was slightly lower than the published IVPI value of 2·64 for the Herts/33 field strain (Collins et al., 1993
).
|
|
|
The rescued virus NDFL(F)Herts contained the F protein of FL-Herts except for the last 10 aa, which were derived from the F protein of NDFL, and showed an ICPI value of 1·31, which was comparable with the ICPI value of NDFLtag (Table 1
). Interestingly, NDFL(F)Herts showed an IVPI value of 0·41, which was much lower than that of FL-Herts and even lower than that of NDFLtag (Table 2
). NDFLtag(HN)Herts, which contained the HN gene of FL-Herts, showed an ICPI value of 1·40 and an IVPI value of 1·83 (Tables 1 and 2![]()
). These results showed that the HN protein is involved in virulence. However, NDFLtag(HN)Herts did not reach the virulence level of the reference FL-Herts strain.
The HN protein is a type II membrane glycoprotein and contains a long stem region supporting the globular head (Lamb & Kolakofsky, 1996
). The hybrid HN genes HNLH and HNHL were generated to investigate whether both the stem region and the globular head contribute to virulence. HNLH consists of the first 143 aa of NDFL and aa 144561 of FL-Herts. Hybrid HNHL consists of the first 143 aa of FL-Herts and aa 143577 of NDFL. Both genes were cloned in pNDFLtagAF (Fig. 2b
). The rescued viruses NDFLtag(HN)LH and NDFLtag(HN)HL showed ICPI values that were comparable to those of NDFLtag and were lower than those of FL-Herts (Table 1
). However, the IVPI values of NDFLtag(HN)LH and NDFLtag(HN)HL were similar to the values of NDFLtag(HN)Herts and much higher than that of NDFLtag (Table 2
). These results showed that both the stem region (aa 1143) and the globular head (aa 144561) of the HN protein of FL-Herts are involved in determining virulence. Based on the IVPI values, the contribution to virulence of the stem region of the HN protein was comparable with the contribution of the entire HN protein.
Effect of the HN proteins on fusion activity of NDV FLS (LaSota) and FHerts
The HN protein is involved in attachment and release and in the promotion of fusion by cooperating with the F protein. To determine the fusion activity of the F protein in combination with the different HN proteins, the fusion activity of NDV FLS and FHerts proteins was determined microscopically 24 and 48 h after transfection by examining syncytium formation in QM5 cells. An interesting observation was that FHerts showed much more syncytium formation than FTag. Syncytium formation induced by FTag was observed at only a few locations in the QM5 monolayer more than 48 h after co-transfection with any of the HN genes (data not shown). In contrast, by 24 h after co-transfection with FHerts, syncytia of QM5 cells were clearly visible. The proteins HNLS and HNLH, after co-transfection with FHerts, showed more syncytium formation than HNHerts and HNHL. In order of rank at 24 h post-transfection, HNLH showed the most syncytia directly followed by HNLS and then HNHerts. HNHL did not shown syncytium formation after 24 h, but did after 48 h (Fig. 3a and b
). This result showed that the stem region of LaSota could increase the fusion activity of the FHerts protein.
|
The transfection efficiencies of FTag, FHerts and the HN genes were verified in an IPMA using monoclonal antibodies 8E12A8C3 (F protein) and 5H11 (HN protein). After 24 h, immunological staining of the expressed F and HN genes did not show any significant differences in the number of positive cells (data not shown). Interestingly, the FHerts protein could only be detected with antibody 8E12A8C3 when the HN protein (either HNLS, HNHerts, HNHL or HNLH) was present (data not shown).
| DISCUSSION |
|---|
|
|
|---|
To map roughly the virulence factors of FL-Herts, we first constructed the chimeric viruses NDFL(P'-HN') and NDFL(F'-HN'). These both showed an ICPI value of 1·56, comparable to the reference FL-Herts strain (Table 1
). These ICPI results suggested that the virulence of FL-Herts was almost completely determined by the sequence located between nt 4649 (StuI) and nt 8094 (SpeI). This sequence contains the F and HN genes plus the non-coding region between them. Thus, the NP, P, M and L genes and their intergenic non-coding regions did not appear to contribute to the difference in virulence between LaSota and Herts. However, based on the IVPI results of FL-Herts (IVPI=2·29) and NDFL(F'-HN') (IVPI=2·58), it could not be excluded that NP, P, M, L or even the V protein are involved in the virulence of NDV. It is important to note that the chimeric virus NDFL(F'-HN') did not contain the complete FL-Herts F and HN genes. The first 35 aa of the F protein and the last 16 aa of the HN protein were derived from NDFL. This means that the first 35 aa of the F protein are not involved in virulence and that the last amino acids from aa 561 to 571 of the HN protein (571 aa is the length of the HN protein of FL-Herts) can be substituted with amino acids from NDFL HN. Even enlargement of the protein with 6 aa from NDFL HN (aa 572577) did not influence the virulence. Similar results were obtained by Römer-Oberdörfer et al. (2003)
, who showed that velogenic recombinant strains with different HN lengths (616, 577 and 571 aa) showed similar ICPI values.
We subsequently determined the contribution of the FHerts and HNHerts proteins. The ICPI value of NDFL(F)Herts clearly showed that the F protein cleavage site was the only virulence determinant on the F protein of FL-Herts. The level of virulence was comparable with NDFLtag, which contained the same cleavage site (Table 1
). In contrast, replacement of the HN protein by HNHerts resulted in a remarkable increase in virulence. This effect of HNHerts on virulence was most prominent after intravenous inoculation (IVPI), which suggested that the HN protein is involved in the tropism of NDV. This result is in agreement with the data of Huang et al. (2004)
, who showed that the amino acid differences between the NDV HN proteins of the Beaudette and LaSota strains determined tropism and virulence. However, the virulence of NDFLtag(HN)Herts (ICPI=1·40; IVPI=1·83) did not reach the virulence levels of NDFL(F'-HN')Herts (ICPI=1·56; IVPI=2·58) and the reference FL-Herts strain (ICPI=1·63; IVPI=2·29). This lower virulence of NDFLtag(HN)Herts could be explained by suboptimal interaction between the LaSota F protein and the Herts HN protein. This could also be the reason why NDFL(F)Herts (IVPI=0·41) showed a lower IVPI value compared with NDFLtag (IVPI=0·76) (Table 2
).
It has been shown that the stem region of HN is responsible for a type-specific functional interaction with the F protein. However, it is unclear whether this interaction triggers fusion or whether the release of the HN protein mediates conformational changes in the F protein leading to fusion (Deng et al., 1997
; Morrison, 2003
). Based on the results of syncytium formation of QM5 cells, fusion activity of FTag was not visible 48 h after co-transfection with any of the HN genes (HNLS, HNHerts, HNLH or HNHL). Thus, the lower virulence of NDFLtag(HN)Herts could not be explained by a difference in fusion activity of FTag in combination with the different HN proteins. However, FHerts clearly showed syncytium formation of QM5 cells with the different HN proteins (Fig. 3
). Thus, the amino acid sequence of the FHerts protein, which is different from FTag, must determine this efficient syncytium formation. Although the transfection efficiency of FTag and FHerts were comparable, detection of FHerts with monoclonal antibody 8E12A8C3 was only possible in the presence of HN (data not shown), which suggested conformational differences between FHerts and FTag. These differences could be responsible for their different fusion activities. Furthermore, the fusion activity of FHerts was higher in combination with HNLS compared with HNHerts. This higher fusion activity of FHerts with HNLS was not due to differences in haemadsorption between HNLS and HNHerts (Fig. 3
). In view of the virulence of NDFL(F)Herts (ICPI=1·31; IVPI=0·41) and NDFL(F'-HN')Herts (ICPI=1·56; IVPI=2·58), the latter suggests that increased fusion activity does not result in higher virulence. This is in agreement with the results of von Messling et al. (2001)
who showed that canine distemper viruses that produced more syncytia were also less virulent. However, co-expression of FHerts and HNHerts also clearly showed syncytia (Fig. 3
) although the virulence of FL-Herts (ICPI=1·63; IVPI=2·29) was very high. This suggests that fusion activity is not directly associated with the virulence of NDV.
An alternative explanation for the lower virulence of NDFLtag(HN)Herts compared with NDFL(F'-HN')Herts and FL-Herts could be that NDFLtag(HN)Herts contains the UTR between F and HN of NDFLtag. In this UTR, the F gene transcription stop signal of NDFL (3'-TTAAGAAAAAA-5') showed 1 nt difference compared with FL-Herts (3'-TTAAGAAAAAG-5'). This nucleotide sequence difference of the F gene end signal or other nucleotide sequence differences between the FHN UTR of NDFL and FL-Herts could result in different amounts of transcripts of the F and HN genes and thus of the F and HN proteins, which could influence the functional interaction between the F and HN proteins on the viral envelope, thereby affecting the virulence of NDV. This is in agreement with the results of Rassa & Parks (1999)
, who showed that the sequence diversity at a simian virus 5 (SV5) gene junction may differentially affect SV5 gene expression.
The globular head of the HN protein mediates attachment of the virus to sialic acid-containing receptors on the surface of the target cell and contains neuraminidase activity for the release of the virions from infected cells (Lamb & Kolakofsky, 1996
). These important molecular determinants could be involved in the virulence of NDV. However, the IVPI of NDFLtag(HN)LH and NDFLtag(HN)HL showed that both the stem region and the globular head of FL-Herts HN were involved in virulence. Interestingly, the stem region of FL-Herts HN in the virus NDFLtag(HN)HL was sufficient to show IVPI values similar to NDFLtag(HN)Herts. Deng et al. (1999)
reported that amino acid sequences from different HN proteins in the F-specific domain in the protein stem could change the interaction between the HN and F protein. Alignment of the amino acid sequences of the HN proteins of FL-Herts and NDFL (data not shown) showed that the stem region is less conserved than the globular head [percentage divergence of the stem region (aa 1143)=13·3 % and globular head (aa 144561)=6·5 %]. A possible explanation for the virulence of NDFLtag(HN)HL is that the interaction between the stem region of the FL-Herts HN protein with the specific domain of the F protein (probably the HR2 domain; Gravel & Morrison, 2003
) could induce a conformational change in the NDFL HN globular head, which improves the binding of the NDFL HN globular head to host-cell receptors and/or could affect the neuraminidase activity. In NDFL(HN)LH, the conformation of the globular head of FL-Herts HN is probably changed by the stem region of NDFL HN in such a way that receptor binding and/or neuraminidase activity are not optimal, resulting in a slightly lower IVPI value. Recently the crystal structure of the globular head (aa 124570) of NDV HN has been published (Crenell et al., 2000
). The crystal structure indeed showed that the globular head of HN appears to be a dynamic molecule that switches from one conformational state to another, resulting in a change of an active site, which is responsible for both receptor binding and neuraminidase activity.
In summary, the F protein cleavage site primarily determines the virulence of NDV. When the F protein contains the cleavage site of a velogenic type, it can be cleaved by host proteases that are available in a wide range of different cells. The ability of NDV to reach these cells probably depends on the activities of the HN protein, which is involved in both attachment and release and which activates the F protein to promote fusion (Morrison, 2003
). In this report, we showed that both the stem region and the globular head of the FL-Herts HN protein were involved in the virulence of NDV. Thus, both the stem region and globular head of HN are probably necessary to exert its biological functions. Future work will focus on the location of the specific amino acids of the HN protein that are responsible for the mechanism by which it determines NDV virulence and on the determination of tropism in chickens of the different recombinant NDV viruses using the natural infection route, i.e. the respiratory tract.
| REFERENCES |
|---|
|
|
|---|
Alexander, D. J. (2000). Newcastle disease and other avian paramyxoviruses. Rev Sci Tech 19, 443462.[Medline]
Alexander, D. J. (2001). Newcastle disease. Br Poult Sci 42, 522.[Medline]
Antin, P. B. & Ordahl, C. P. (1991). Isolation and characterization of an avian myogenic cell line. Dev Biol 143, 111121.[CrossRef][Medline]
Beard, C. W. & Hanson, R. P. (1984). Newcastle disease. In Diseases of Poultry, pp. 452470. Edited by M. S. Hofstad. Iowa: Iowa State University Press.
Britton, P., Green, P., Kottier, S., Mawditt, K. L., Penzes, Z., Cavanagh, D. & Skinner, M. A. (1996). Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. J Gen Virol 77, 963970.
Brown, C., King, D. J. & Seal, B. S. (1999). Pathogenesis of Newcastle disease in chickens experimentally infected with viruses of different virulence. Vet Pathol 36, 125132.[Abstract]
Collins, M. S., Bashiruddin, J. B. & Alexander, D. J. (1993). Deduced amino acid sequences at the fusion protein cleavage site of Newcastle disease viruses showing variation in antigenicity and pathogenicity. Arch Virol 128, 363370.[CrossRef][Medline]
Crennell, S., Takimoto, T., Portner, A. & Taylor, G. (2000). Crystal structure of the multifunctional paramyxovirus hemagglutininneuraminidase. Nat Struct Biol 7, 10681074.[CrossRef][Medline]
Curran, J., Latorre, P. & Kolakofsky, D. (1998). Translational gymnastics on the Sendai virus P/C mRNA. Semin Virol 8, 351357.[CrossRef]
de Leeuw, O. & Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease virus: evidence for the existence of a new genus within the subfamily Paramyxovirinae. J Gen Virol 80, 131136.[Abstract]
de Leeuw, O. S., Hartog, L., Koch, G. & Peeters, B. P. H. (2003). Effect of fusion protein cleavage site mutations on virulence of Newcastle disease virus: non-virulent cleavage site mutants revert to virulence after one passage in chicken brain. J Gen Virol 84, 475484.
Deng, R., Mirza, A. M., Mahon, P. J. & Iorio, R. M. (1997). Functional chimeric HN glycoproteins derived from Newcastle disease virus and human parainfluenza virus-3. Arch Virol 13, S115S130.
Deng, R., Wang, Z., Mahon, P. J., Marinello, M., Mirza, A. & Iorio, R. M. (1999). Mutations in the Newcastle disease virus hemagglutininneuraminidase protein that interfere with its ability to interact with the homologous F protein in the promotion of fusion. Virology 253, 4354.[CrossRef][Medline]
European Community (1992). European Community Council Directive 92/40/EEC (19 May 1992). Brussels: European Community.
European Community (1992). European Community Council Directive 92/66/EEC (14 July 1992). Brussels: European Community.
Garten, W., Berk, W., Nagai, Y., Rott, R. & Klenk, H. D. (1980). Mutational changes of the protease susceptibility of glycoprotein F of Newcastle disease virus: effects on pathogenicity. J Gen Virol 50, 135147.
Gravel, K. A. & Morrison, T. G. (2003). Interacting domains of the HN and F proteins of Newcastle disease virus. J Virol 77, 1104011049.
Huang, Z., Krishnamurthy, S., Panda, A. & Samal, S. K. (2003). Newcastle disease virus V protein is associated with viral pathogenesis and functions as an alpha interferon antagonist. J Virol 77, 86768685.
Huang, Z., Panda, A., Elankumaran, S., Govindarajan, D., Rockemann, D. D. & Samal, S. K. (2004). The hemagglutininneuraminidase protein of Newcastle disease virus determines tropism and virulence. J Virol 78, 41764184.
Kawahara, N., Yang, X. Z., Sakaguchi, T., Kiyotani, K., Nagai, Y. & Yoshida, T. (1992). Distribution and substrate specificity of intracellular proteolytic processing enzyme(s) for paramyxovirus fusion glycoproteins. J Gen Virol 73, 583590.
Krishnamurthy, S. & Samal, S. K. (1998). Nucleotide sequences of the trailer, nucleocapsid protein gene and intergenic regions of Newcastle disease virus strain Beaudette C and completion of the entire genome sequence. J Gen Virol 79, 24192424.[Abstract]
Lamb, R. A. & Kolakofsky, D. (1996). Paramyxoviridae: the viruses and their replication. In Fundamental Virology, pp. 11771204. Edited by B. N. Fields, D. M. Knippe & P. M. Howley. Philadelphia: LippincottRaven.
Mayo, M. A. (2002a). Virus taxonomy Houston 2002. Arch Virol 147, 10711076.[CrossRef][Medline]
Mayo, M. A. (2002b). A summary of taxonomic changes recently approved by ICTV. Arch Virol 147, 16551663.[CrossRef][Medline]
Mebatsion, T., Verstegen, S., de Vaan, L. T. C., Römer-Oberdörfer, A. & Schrier, C. C. (2001). A recombinant Newcastle disease virus with low-level V protein expression is immunogenic and lacks pathogenicity for chicken embryos. J Virol 75, 420428.
Morrison, T. G. (2003). Structure and function of a paramyxovirus fusion protein. Biochim Biophys Acta 1614, 7384.[Medline]
Nagai, Y., Klenk, H. D. & Rott, R. (1976). Proteolytic cleavage of the viral glycoproteins and its significance for the virulence of Newcastle disease virus. Virology 72, 494508.[CrossRef][Medline]
Park, M.-S., Shaw, M. L., Munoz-Jordan, J., Cros, J. F., Nakaya, T., Bouvier, N., Palese, P., Garcia-Sastre, A. & Basler, C. F. (2003). Newcastle disease virus (NDV)-based assay demonstrates interferon-antagonist activity for the NDV V protein and Nipah virus V, W, and C proteins. J Virol 77, 15011511.
Peeters, B. P. H., de Leeuw, O. S., Koch, G. & Gielkens, A. L. (1999). Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence. J Virol 73, 50015009.
Peeters, B. P. H., Gruijthuijsen, Y. K., de Leeuw, O. S. & Gielkens, A. L. J. (2000). Genome replication of Newcastle disease virus: involvement of the rule-of-six. Arch Virol 145, 18291845.[CrossRef][Medline]
Peeters, B. P. H., de Leeuw, O. S., Verstegen, I., Koch, G. & Gielkens, A. L. (2001). Generation of a recombinant chimeric Newcastle disease virus vaccine that allows serological differentiation between vaccinated and infected animals. Vaccine 19, 16161627.[CrossRef][Medline]
Phillips, R. J., Samson, A. C. & Emmerson, P. T. (1998). Nucleotide sequence of the 5'-terminus of Newcastle disease virus and assembly of the complete genomic sequence: agreement with the "rule of six". Arch Virol 143, 19932002.[CrossRef][Medline]
Rassa, J. C. & Parks, G. D. (1999). Highly diverse intergenic regions of the paramyxovirus simian virus 5 cooperate with the gene end U tract in viral transcription termination and can influence reinitiation at a downstream gene. J Virol 73, 39043912.
Römer-Oberdörfer, A., Mundt, E., Mebatsion, T., Buchholz, U. J. & Mettenleiter, T. C. (1999). Generation of recombinant lentogenic Newcastle disease virus from cDNA. J Gen Virol 80, 29872995.
Römer-Oberdörfer, A., Werner, O., Veits, J., Mebatsion, T. & Mettenleiter, T. C. (2003). Contribution of the length of the HN protein and the sequence of the F protein cleavage site to Newcastle disease virus pathogenicity. J Gen Virol 84, 31213129.
Sakaguchi, T., Matsuda, Y., Kiyokage, R., Kawahara, N., Kiyotani, K., Katunuma, N., Nagai, Y. & Yoshida, T. (1991). Identification of endoprotease activity in the trans Golgi membranes of rat liver cells that specifically processes in vitro the fusion glycoprotein precursor of virulent Newcastle disease virus. Virology 184, 504512.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
von Messling, V., Zimmer, G., Herrler, G., Haas, L. & Cattaneo, R. (2001). The hemagglutinin of canine distemper virus determines tropism and cytopathogenicity. J Virol 75, 64186427.
Wensvoort, G., Terpstra, C., Boonstra, J., Bloemraad, M. & van Zaane, D. (1986). Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis. Vet Microbiol 12, 101108.[CrossRef][Medline]
Received 13 December 2004;
accepted 10 February 2005.
This article has been cited by other articles:
![]() |
J. C. F. M. Dortmans, G. Koch, P. J. M. Rottier, and B. P. H. Peeters Virulence of pigeon paramyxovirus type 1 does not always correlate with the cleavability of its fusion protein J. Gen. Virol., November 1, 2009; 90(11): 2746 - 2750. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-T. Tan, H.-Y. Xu, Y.-L. Wang, Z.-M. Qin, L. Sun, W.-J. Liu, and Z.-Z. Cui Molecular Characterization of Three New Virulent Newcastle Disease Virus Variants Isolated in China J. Clin. Microbiol., February 1, 2008; 46(2): 750 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. B. Kibenge, M. J. T. Kibenge, Y. Wang, B. Qian, S. Hariharan, and S. McGeachy Mapping of putative virulence motifs on infectious salmon anemia virus surface glycoprotein genes J. Gen. Virol., November 1, 2007; 88(11): 3100 - 3111. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |