J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 86 (2005), 1851-1860; DOI 10.1099/vir.0.80790-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirasawa-Seo, N.
Right arrow Articles by Matsumoto, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirasawa-Seo, N.
Right arrow Articles by Matsumoto, T.
Agricola
Right arrow Articles by Shirasawa-Seo, N.
Right arrow Articles by Matsumoto, T.
© 2005 Society for General Microbiology

Characteristics of the promoters derived from the single-stranded DNA components of Milk vetch dwarf virus in transgenic tobacco

Naomi Shirasawa-Seo1, Yoshitaka Sano2,3, Shigeo Nakamura1, Taka Murakami4, Shigemi Seo4, Yuko Ohashi4, Yoshifumi Hashimoto2 and Tsuguo Matsumoto2

1 Miyagi Prefectural Agriculture and Horticulture Research Center, Takadate-kawakami, Natori, Miyagi 981-1243, Japan
2 Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585, Japan
3 Laboratory of Plant Pathology, Faculty of Agriculture, Niigata University, Ikarashi, Niigata 950-2181, Japan
4 National Institute of Agro-Biological Sciences, Kannondai, Tsukuba, Ibaraki 305-8602, Japan

Correspondence
Shigeo Nakamura
nakamura-sh894{at}pref.miyagi.jp


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Predicted promoter regions of Milk vetch dwarf virus (MDV) components (C1–C11) were isolated and fused with a {beta}-glucuronidase (GUS) reporter gene and the characteristics of the promoters were examined. In transgenic tobacco calli, promoters of MDV C4 (encoding a cell-cycle link protein), C5 and C7 (both encoding unknown proteins), C6 (encoding a nuclear-shuttle protein) and C8 (encoding a movement protein) generated a stronger level of GUS expression than the Cauliflower mosaic virus 35S RNA promoter (P35S). In leaves of transgenic tobacco plants, the promoters of C5 and C8 conferred a level of GUS activity comparable to that of P35S. Histochemical GUS analysis showed that the promoters of C4–C9, the latter encoding a capsid protein, were active in phloem and meristematic tissue. The promoter of C8 was also active in mesophyll and cortex cell types. A low level of activity was found for the promoters of C11, which encodes a master replication-initiator protein (Rep), and C1, C2, C3 and C10, which encode additional Reps, in both transgenic tobacco calli and plants.

Graphs showing transient GUS expression of MDV-derived promoters in pea and tobacco leaves (Supplementary Fig. S1) and GUS expression by MDV-derived promoters in E. coli and A. tumefaciens (Supplementary Fig. S2) are available as supplementary material in JGV Online.


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Milk vetch dwarf virus (MDV) is a member of the family Nanoviridae (Gronenborn, 2004Down; Vetten et al., 2004Down). The family Nanoviridae consists of two genera (Vetten et al., 2004Down). Whilst Banana bunchy top virus (BBTV; Harding et al., 1991Down) is currently the only member of the genus Babuvirus, the genus Nanovirus includes Faba bean necrotic yellows virus (Katul et al., 1993Down), Subterranean clover stunt virus (SCSV; Chu & Helms, 1988Down) and MDV. Coconut foliar decay virus (CFDV; Randles & Hanold, 1989Down) is an unassigned species in the family. MDV is transmitted by Aphis craccivora in a persistent manner and causes yellowing and dwarfing of several leguminous crops, including Chinese milk vetch (Astragalus sinicus L.), broad bean (Vicia faba L.), pea (Pisum sativum L.) and soybean [Glycine max (L.) Merr.]. Some solanaceous plants have also been reported to be susceptible to MDV (Inoue et al., 1968Down). Particles of MDV were observed in the phloem cells of MDV-infected broad bean leaves (Ohki et al., 1975Down). Eleven circular single-stranded DNA (ssDNA) components have been isolated from the N isolate of MDV (Sano et al., 1998Down; Timchenko et al., 2000Down). Each component is approximately 1 kb in size, potentially encodes one large gene in the virion sense and contains a potential stem–loop (SL) structure in the non-coding region. C11 (DNA-R) encodes the master Rep (M-Rep), which is the replication-initiator protein (Rep) for all other genomic DNAs (Timchenko et al., 2000Down). Based on the sequence similarity between proteins of different nanoviruses, it is supposed that C4 (DNA-C), C6 (DNA-N), C8 (DNA-M) and C9 (DNA-S) encode the cell-cycle link protein (Clink), the nuclear-shuttle protein (NSP), the movement protein (MP) and the capsid protein (CP), respectively (Vetten et al., 2004Down). The functions of the proteins encoded by C5 (DNA-U1) and C7 (DNA-U2) are unknown. C1, C2, C3 and C10 encode Reps, but appear to be satellite-like DNAs.

The promoter activity associated with some members of the family Nanoviridae, BBTV, SCSV and CFDV, has been characterized. In transgenic tobacco and banana plants, the promoters derived from the BBTV C1–C6 intergenic regions generally gave weak, tissue-specific expression patterns restricted to phloem-associated cells and at least one of them was highly expressed in actively dividing, undifferentiated cell types (Dugdale et al., 1998Down, 2000Down). In SCSV, the promoter activity varies between the seven components and appears to be primarily vascular-associated (Surin et al., 1998Down). SCSV C4 (DNA-N) and C7 (DNA-U1) showed substantial activity in transgenic tobacco plants. SCSV C2 and C6, which encode satellite Reps, had almost undetectable activity. SCSV C1 (DNA-M) conferred weak vascular expression, but its activity increased in callus tissue. The promoter associated with the intergenic region of CFDV had weak phloem-specific activity in transgenic tobacco and substantial activity in Escherichia coli (Rohde et al., 1995Down; Hehn & Rohde, 1998Down).

In this study, the activities of predicted promoter sequences derived from MDV C1–C11 have been assessed to understand the control of gene expression in MDV. Bacterial cells and tobacco plants were transformed with chimeric genes consisting of MDV-derived promoters fused to a {beta}-glucuronidase (GUS) reporter gene to examine their expression profiles. The results indicate that expression of the individual components is differentially regulated.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Isolation of MDV-derived promoter sequences.
MDV genomic nucleic acid was purified from MDV-infected pea leaves essentially as described previously (Sano et al., 1998Down). The genomic organization of MDV C1–C11 and the predicted promoter regions are illustrated in Fig. 1(a)Down. Cis-acting elements of the viral promoter sequences were analysed by searching the database PLACE (Higo et al., 1999Down) for a plant cis-element motif. The predicted promoter fragments were isolated by PCR using the primers listed in Table 1Down. Each primer contains a restriction site in the 5' flanking region. The sites are shown with the names of primers in Table 1Down. The products amplified from MDV C1, C2, C3, C8 and C10 were cloned in pBluescriptII SK (Stratagene) following digestion with HindIII and BamHI. Those of MDV C4, C5, C6, C7, C9 and C11 were introduced by digestion with PstI and BamHI. Nucleotide sequences of these fragments were confirmed by using an Applied Biosystems 373A DNA sequencer.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representations of the proposed organization of (a) the circular ssDNA genome of MDV and predicted promoter region and (b) MDV promoter fragments analysed. See text for explanation of cis elements.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Sequences of the primers used in this study

 
Deletions of the MDV C5 and C8 promoter fragments were generated by PCR. C5d1, d2, d3 and d4 were amplified by using the sense primers PT5-D1 (5'-AACTGCAGATAAATATATTATTTTTAATTACTCTGCG-3'), PT5-D2 (5'-AACTGCAGTGACGTCAGCTGACTCC-3'), PT5-D3 (5'-AACTGCAGTAGGGGCGGGGCTTAGTATTACC-3') and PT5-D4 (5'-AACTGCAGGGTTCAGAGTCACGTACG-3'), respectively, which all contain a HindIII site in the 5' flanking region, and the antisense primer C5-PT(–)BamHI (Table 1Up). C8d1, d4 and d5 were amplified by using the sense primers PT8-D1 (5'-GGGAAGCTTGATAATTTATGTTATGATGTTGTTTC-3'), PT8-D4 (5'-GGGAAGCTTCGGGGCGGGGCTTAGTATTACC-3') and PT8-D5 (5'-GGGAAGCTTGATCAGCGGAGTCATCAC-3'), respectively, which all contain a HindIII site in the 5' flanking region, and the antisense primer C8-PT(–)BamHI (Table 1Up). The amplified products were cloned in plasmid pGEM-T (Promega).

GUS reporter-gene construction.
The promoter fragments of C1, C2, C3, C8 and C10 were each excised from pBluescriptII SK by digestion with HindIII and BamHI, whereas those of C4, C5, C6, C7 and C11 were excised by digestion with SalI and BamHI. These promoter fragments were cloned in the binary vector pBI101.3 (Clontech) as transcriptional GUS gene fusions. The resulting chimeric plasmids were named PMC1PMC11 : : GUS, respectively. The plasmid pBI121 (Clontech), referred to as P35S : : GUS in this report and containing the Cauliflower mosaic virus 35S RNA promoter, was included as a positive control. Deletions of the MDV C5 and C8 promoter fragments were excised from the vector pGEM-T by digestion with HindIII and BamHI and cloned into pBI101.3.

Plasmid DNA was extracted from overnight cultures of E. coli JM109 (TOYOBO) by using a Quantum Prep Kit (Bio-Rad) according to the supplier's recommendations. All promoter fusions and the control were introduced into Agrobacterium tumefaciens strain LBA4404 (Ooms et al., 1982Down; Hoekema et al., 1983Down) by direct transformation.

Transformation of tobacco plants.
Tobacco (Nicotiana tabacum cv. Samsun NN) plants were co-cultivated with Agrobacterium by the leaf disc-infection method (Horsch et al., 1985Down) and transformants were selected on MS medium (Murashige & Skoog, 1962Down) supplemented with 100 mg kanamycin l–1 and 500 mg carbenicillin l–1. Regenerated plants were analysed for integration of the promoter : : GUS fusion genes into the plant genome by PCR. For detection of the GUS region, a sense primer sequence from the GUS coding region, 5'-GCAACGTCTGGTATCAGC-3' (corresponding to nt 194–211), and an antisense primer sequence from the nopaline synthase gene terminator region, 5'-TCTAGTAACATAGATGATGACA-3' (corresponding to nt 2097–2079), were used. For the promoter region, each of the primer sets in Table 1Up was used. The reactions were run with an initial denaturation at 94 °C for 1 min, then 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min for 30 cycles, and a final extension at 72 °C for 8 min.

Measurement of GUS activity.
GUS activity was assayed by the method of Kosugi et al. (1990)Down. Calli or leaf discs from transgenic tobacco plants were homogenized in lysis buffer [50 mM sodium phosphate (pH 6·8), 10 mM EDTA, 10 mM 2-mercaptoethanol, 0·1 % Triton X-100 and 0·1 % sarcosyl] in an Eppendorf tube with a glass rod and carborundum (600 mesh; Nakalai Tesque). The homogenate was centrifuged at 10 000 g for 15 min and the supernatant was assayed for GUS activity in the presence of 20 % methanol. Fluorescence levels were determined by using a Hitachi F-2500 spectrometer.

Histochemical analysis.
Leaf discs, longitudinal half-cut stems, including side buds, and intact roots from the transgenic tobacco plants containing each promoter : : GUS construct were subjected to GUS staining. Tissue sections from transgenic tobacco plants were cut at 80–100 µm with a microslicer (model DTK-1000; Dosaka). Histochemical staining for GUS activity was performed at 37 °C as described previously (Ohshima et al., 1990Down) with a modified reaction mixture; 50 mM phosphate buffer (pH 7·0) containing 1 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc), 5 % methanol, 10 µg cycloheximide ml–1 and 1 mM dithiothreitol. The reaction was stopped by the addition of ethanol.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Activity of MDV-derived promoters in tobacco calli and plants
Activities of MDV-derived promoters were assessed in dividing cells. The GUS activity in eight individual, regenerated, kanamycin-resistant calli at 20 days after selection was assayed by a fluorometric quantification method. Fig. 2Down shows levels of GUS activity conferred by each MDV-derived promoter in kanamycin-resistant calli. The levels of GUS activity in calli containing PMC4 : : GUS, PMC5 : : GUS, PMC6 : : GUS, PMC7 : : GUS, PMC8 : : GUS and PMC9 : : GUS were 4·5-, 10·3-, 2·9-, 5·4-, 4·7- and 2·2-fold higher, respectively, than the level of GUS activity generated by P35S. The range of GUS activities conferred by PMC4 : : GUS, PMC5 : : GUS, PMC6 : : GUS, PMC7 : : GUS, PMC8 : : GUS, PMC9 : : GUS and P35S : : GUS were 7·08–26·30, 19·20–52·50, 4·58–25·40, 13·30–39·20, 10·00–37·90, 2·50–12·50 and 2·13–7·63 nmol 4-methyl umbelliferone (4-MU) (mg fresh weight)–1 h–1, respectively. In contrast, low activity was generated by the promoters of DNA-R and additional Rep-encoding DNAs. The range of GUS activities conferred by PMC1 : : GUS, PMC2 : : GUS, PMC3 : : GUS, PMC10 : : GUS and PMC11 : : GUS were 0·083–0·29, 0·21–0·46, 0·17–0·38, 0·33–1·00 and 0·29–0·88 nmol 4-MU (mg fresh weight)–1 h–1, respectively. When the same constructs were delivered to the pea and tobacco leaves according to the protocol for the Biolistic Particle Delivery System (Bio-Rad) and GUS activity was assessed histochemically, transient GUS expression of the promoters of DNA-R and additional Rep-encoding DNAs was found (see Supplementary Fig. S1, available in JGV Online).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Levels of GUS activity conferred by MDV-derived promoters in kanamycin-resistant (KmR) calli. The level of GUS activity in KmR calli containing each promoter : : GUS fusion construct was measured as described in Methods. Means±SD from eight independent experiments are shown. The ratio of the mean value conferred by each promoter to that by P35S is shown at the bottom of the figure. Data were subjected to Tukey's multiple-comparisons procedure. There is a significant difference between values marked c and d at P<0·05 and between values marked with other letters at P<0·01. FW, Fresh weight.

 
Transgenic tobacco plants containing promoter : : GUS constructs were regenerated from kanamycin-resistant calli. Between 20 and 27 independent lines of transgenic tobacco plants were established for each construct and PCR was used to confirm that each plant contained the GUS gene. The level of GUS activity in mature leaves of 1-month-old transgenic lines with PMC4 : : GUS, PMC5 : : GUS and PMC8 : : GUS was comparable to that of P35S : : GUS plants. PMC6 : : GUS and PMC7 : : GUS conferred almost half the level of activity generated by P35S : : GUS. The level of GUS expression provided by PMC9 was low. PMC1 : : GUS, PMC2 : : GUS, PMC3 : : GUS, PMC10 : : GUS and PMC11 : : GUS plants showed little or no expression of GUS (Fig. 3Down).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Levels of GUS activity conferred by MDV-derived promoters in transgenic tobacco leaves. Leaf discs were cut from the fully expanded upper leaves of 1-month-old regenerated transformants. Mean GUS activity, the ratio of mean value conferred by each promoter to that by P35S, and numbers of plants used are shown at the bottom of the figure. Each dot shows the GUS value of an individual transgenic plant. Bar, mean value. Data were subjected to Tukey's multiple-comparisons procedure. There is a significant difference between values marked a and b at P<0·05 and between values marked with other letters at P<0·01.

 
Tissue-specific expression of MDV-derived promoters in tobacco plants
The expression profiles of MDV-derived promoters in tobacco plants were studied further by using histochemical GUS assays. Tissue-specific GUS expression patterns in leaf discs, longitudinally cut stems, including side buds, and intact roots from 20 independent transgenic tobacco lines for each promoter : : GUS construct were examined after overnight GUS staining and are summarized in Table 2Down. PMC1, PMC2, PMC3, PMC10 and PMC11, which are the promoters for the four additional Rep-encoding DNAs and DNA-R, respectively, conferred variable GUS expression in the meristem and the vascular bundle of 1-month-old transgenic tobacco plants. In contrast, PMC4, PMC5, PMC6, PMC7, PMC8 and PMC9 generated intense GUS staining in the shoot apex, the root tip and the vascular bundle of leaves. Intensity of staining in the leaf discs of each promoter : : GUS plant seemed to correlate to the level of quantitative GUS activity (Fig. 3Up). PMC8 : : GUS conferred weaker GUS expression in vascular bundles than PMC5 : : GUS plants, but was expressed universally in most cell types. To study the expression of GUS more precisely, sections of shoot apex and fully expanded leaves containing midribs made from three lines each of 2-month-old PMC1PMC11 : : GUS plants were examined. After staining for 2–8 h, strong GUS activity was observed in the meristem and vascular bundle in the longitudinal section of the shoot apex from PMC4, PMC5, PMC6, PMC8 and PMC9 : : GUS plants. A typical expression pattern is shown in Fig. 4Down[a (i)]. The section of shoot apex from PMC1, PMC2, PMC3, PMC10 and PMC11 : : GUS plants showed no or weak GUS expression in the meristem and vascular bundle of the top leaf after staining for 18–24 h. Fig. 4Down[a(ii)] shows one of the sections from PMC10 : : GUS plants. GUS expression in the cross-sections of midrib from fully expanded leaves from PMC4, PMC5, PMC6, PMC8 and PMC9 : : GUS plants was observed specifically in the phloem. A typical specimen is shown in Fig. 4Down[b(i)]. GUS staining was not detected in the sections of mature leaves from PMC1, PMC2, PMC3, PMC10 or PMC11 : : GUS plants after staining for 24 h in this experiment (data not shown). In PMC4, PMC5, PMC6 and PMC9 : : GUS plants, GUS expression was limited to the vascular system in the leaves and roots [representative examples are shown in Fig. 4bDown(ii, iii)]. In PMC8 : : GUS plants, GUS staining also occurred in the mesophyll of the leaves and cortex of stems and roots [Fig. 4bDown(iv, v)].


View this table:
[in this window]
[in a new window]
 
Table 2. Expression patterns in transgenic tobacco tissues

Summary of the GUS expression patterns observed in 20 independent transgenic lines obtained with each MDV-derived promoter : : GUS fusion construct after overnight staining at 37 °C. ±, Weak or variable expression in this tissue across the 20 transgenic lines examined.

 


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 4. Histochemical GUS analysis of transgenic tobacco plants. (a) Longitudinal sections of shoot apex (100 µm thick). Transgenic tobacco plant containing (i) PMC5 : : GUS stained for 2 h at 37 °C and (ii) PMC10 : : GUS stained for 18 h at 37 °C; bars, 400 µm. (b) (i) Cross-section of midrib from fully expanded leaves (80 µm thick) of 2-month-old regenerated transformants subjected to GUS staining for 2 h at 37 °C; bar, 200 µm. (ii, iv) Cross-sections of fully expanded leaves (80 µm thick) of 2-month-old regenerated transformants subjected to GUS staining for 2 h at 37 °C; bars, 200 µm. (iii, v) Intact roots stained for 2 h; bars, 200 µm. (i, ii, iii) PMC5 : : GUS plants; (iv, v) PMC8 : : GUS plants. mes, Middle mesophyll cells; SV, small veins of leaves.

 
Effects of the deletions of PMC5 and PMC8 in tobacco plants
To identify regions that determine the character of the promoters, deletions of PMC5 and PMC8 were made (Fig. 5aDown) and promoter activities were assessed in transgenic tobacco leaves. However, when leaf discs from all transgenic tobacco lines for each deletion promoter : : GUS construct were examined after overnight GUS staining, they exhibited tissue-specific expression similar to their original promoter (data not shown). Results of quantitative GUS analysis are shown in Fig. 5(b)Down. There is a statistically significant difference in strength between the C5d1 promoter and PMC5 at P<0·01. GUS activity associated with C5d2, C5d3 and C5d4 was comparable to that of PMC5. No significant differences in activity were found between the promoters of C8d1, C8d4, C8d5 and PMC8.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. PMC5 and PMC8 intergenic deletions and their activity in transgenic tobacco leaves. (a) Deletions of PMC5 and PMC8. (b) Levels of relative GUS activity conferred by MDV-derived promoters in transgenic tobacco leaves. Leaf discs were cut from the fully expanded upper leaves of 1-month-old regenerated transformants. Mean GUS activity, ratio of mean value conferred by each promoter to that by PMC5 or PMC8 and numbers of plants used are shown at the bottom of the figure. Each dot shows the GUS value of an individual transgenic plant. Bar, mean value. Data were subjected to Tukey's multiple-comparisons procedure. There is a significant difference between values marked a and b at P<0·05 and between values marked a' and b at P<0·01.

 

   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
This study presents a characterization of promoter activity associated with the intergenic regions of the 11 components of MDV. It has been shown that some predicted promoter fragments of non-Rep-encoding DNAs conferred activity comparable to that of P35S in transgenic tobacco plants and activity stronger than that of P35S in transgenic calli. In contrast, promoters of the Rep-encoding DNAs generated low levels of activity in transgenic tobacco plants.

The low level of promoter activity by Rep-encoding DNAs in transgenic tobacco plants and calli might have been expected, given the previous results for other members of the family Nanoviridae. BBTV C1 (DNA-R) and SCSV C2 and C6, which encode satellite Reps, have been reported to confer negligible activity in assessments of transient and stable expression using tobacco cells and plants (Dugdale et al., 1998Down; Surin et al., 1998Down), whereas BBTV C1 and SCSV C2 have been shown to be able to replicate autonomously (Chu et al., 1995Down; Horser et al., 2001Down). This indicates that the basal activity of Rep promoters is extremely low, but sufficient to express Rep and initiate DNA replication.

The MDV-derived, non-Rep promoters conferred a higher level of GUS expression in calli than in plants, whereas P35S conferred the same level. This is consistent with the reported activities of non-Rep promoters of BBTV and SCSV. Dugdale et al. (1998)Down pointed out the possibility that the CATGACGTCA sequence in BBTV, which contains the ASF1 motif (TGACG; Lam et al., 1989Down; Benfey & Chua, 1990Down) and a hexamer motif characteristic of plant histone promoters (ACGTCA; Mikami et al., 1987Down; Nakayama et al., 1992Down; Morozov et al., 1994Down), contributed to the strong promoter activity in undifferentiated, actively dividing cell types. The TGACGTCA sequence has been reported as a palindromic C box that is recognized by two bZIP proteins with a zinc-finger motif, STF1 and STF2, from soybean apical hypocotyl (Cheong et al., 1998Down). This sequence is found in all MDV-derived non-Rep promoters and MDV-C11 (Fig. 1bUp). However, PMC11 conferred weak promoter activity in transgenic tobacco plants, as well as other additional Reps (Figs 2 and 3UpUp). Furthermore, the deletion of the palindromic C element, as well as the SL domain, in the deletions of PMC5 and PMC8 had no significant effect on promoter activity in transgenic tobacco plants (Fig. 5Up).

Dof proteins are members of a major family of transcription factors unique to plants and have a similar DNA-binding specificity for the sequence AAAG or CTTT (Yanagisawa, 2002Down). Dof proteins have diverse roles in gene expression associated with plant-specific phenomena. A tobacco Dof protein, NTBBF1, is involved in auxin-inducible expression of a plant oncogene, rolB, in apical meristem and vascular tissues (Baumann et al., 1999Down). An investigation of cis elements in the predicted promoter regions of MDV by PLACE showed four to eight Dof domains and zero to four NTBBF1 domains 200 bp upstream of each TATA box in the non-Rep promoters, and two to four Dof domains scattered in the Rep promoters (Fig. 1bUp). There is a possibility that these Dof domains determine the difference in expression profiles between non-Rep and Rep promoters.

Promoters derived from non-Rep-encoding MDV DNAs were active in phloem and meristimatic tissue. Expression of PMC8 was not limited to the phloem and meristem, but was also observed in mesophyll and cortex cell types. Of other nanovirus promoters derived from DNA-M, BBTV C4 did not appear to be confined to the leaf vascular tissues, with visible green fluorescent protein expression in stomata and mesophyll cells (Dugdale et al., 2000Down), and SCSV C1 conferred a weak vascular expression (Surin et al., 1998Down). The factor responsible for the tissue-specific expression conferred by MDV promoters could not be determined in this study.

PMC5 differed in terms of the strength of the activity it conferred in transgenic tobacco plants and calli, despite its similarity to PMC4 and PMC7. PMC5 has a unique 90 bp region downstream of the TATA box. This region contains the CT-rich sequence, TCATCTTCTTCTTTCTCACAAACAAC, near the presumed transcription-initiation site. This sequence resembles the CT-rich sequences in 5'-untranslated leaders of genes for thylakoid proteins, which are essential for transcription (Bolle et al., 1994Down) and may function as a plant-specific regulatory DNA sequence. The result that PMC5 conferred almost no activity in A. tumefaciens (see Supplementary Fig. S2, available in JGV Online) also suggests that these CT-rich sequences function as a plant-specific initiation region.

In the experiment with the deletion of PMC5, C5d1 (495 bp) showed a high level of promoter activity compared to PMC5 (532 bp) (Fig. 5bUp). From this result, a 37 bp region from the 5' end of PMC5 may contain a downregulatory element. Dugdale et al. (1998)Down examined the transient activity in tobacco cells with deletions of BBTV C6 and obtained similar results. However, common sequences were not found in these regions between BBTV and MDV.

PMC9 conferred a relatively low level of activity in transgenic plants, compared with other promoters derived from non-Rep-encoding MDV DNAs. CP will be required in large amounts later in the infection cycle. There is a possibility that other viral proteins, which are generated earlier in the replication of MDV, activate expression of the CP promoter. Studies with the family Geminiviridae, a related ssDNA virus group, have revealed that promoter activity is influenced by the interaction of virus-encoded gene products (Hanley-Bowdoin et al., 2000Down). In Tomato golden mosaic virus, which is a member of the genus Begomovirus, the product of the AL2 gene is necessary for efficient transcription from the CP promoter (Sunter & Bisaro, 1991Down). No information is available concerning which elements are involved in MDV CP expression, yet it is assumed that some regulatory elements may control a transcriptional cascade to warrant an efficiently timed gene expression in the family Nanoviridae.

As the activity levels of MDV non-Rep promoters were higher than that of P35S in transgenic tobacco calli, these promoters would be useful for foreign gene expression in proliferating tissues. The GUS expression levels in individual transgenic plant lines with MDV-derived promoter : : GUS varied greatly (Fig. 3Up). The observed variation in expression is probably due to a positional effect and a different number of integrated copies of the transgenes in transgenic plants (Hobbs et al., 1990Down, 1993Down; Peach & Velten, 1991Down). Nevertheless, PMC8 confers efficient gene expression and may serve as an alternative to P35S, which has been used widely for genetic manipulation (Shirasawa-Seo et al., 2005Down).

As each MDV-derived promoter has unique expression characteristics, further study of MDV-derived promoters will provide valuable understanding of not only the regulatory elements that determine specificity, but also the mechanisms that regulate nanovirus gene expression in host plants.


   ACKNOWLEDGEMENTS
 
The authors are grateful to Dr Masato Ikegami (Tohoku University) for critical reading of the manuscript and Dr Ichiro Mitsuhara (National Institute of Agro-Biological Sciences) for useful advice. This work was supported by a project grant from the Ministry of Agriculture, Forestry and Fisheries, Japan, and PROBRAIN.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Baumann, K., De Paolis, A., Constantino, P. & Gualberti, G. (1999). The DNA binding site of the Dof protein NtBBF1 is essential for tissue-specific and auxin-regulated expression of the rolB oncogene in plants. Plant Cell 11, 323–333.[Abstract/Free Full Text]

Benfey, P. N. & Chua, N.-H. (1990). The cauliflower mosaic virus 35S promoter: combinatorial regulation of transcription in plants. Science 250, 959–966.[Abstract/Free Full Text]

Bolle, C., Sopory, S., Lübberstedt, T., Herrmann, R. G. & Oelmüller, R. (1994). Segments encoding 5'-untranslated leaders of genes for thylakoid proteins contain cis-elements essential for transcription. Plant J 6, 513–523.[CrossRef][Medline]

Cheong, Y. H., Yoo, C. M., Park, J. M., Ryu, G. R., Goekjian, V. H., Nagao, R. T., Key, J. L., Cho, M. J. & Hong, J. C. (1998). STF1 is a novel TGACG-binding factor with a zinc-finger motif and a bZIP domain which heterodimerizes with GBF proteins. Plant J 15, 199–209.[CrossRef][Medline]

Chu, P. W. G. & Helms, K. (1988). Novel virus-like particles containing circular single-stranded DNAs associated with subterranean clover stunt disease. Virology 167, 38–49.[CrossRef][Medline]

Chu, P. W. G., Boevink, P., Surin, B., Larkin, P., Keese, P. & Waterhouse, P. (1995). Non geminated single-stranded DNA plant viruses. In Pathogenesis and Host Specificity in Plant Diseases, vol. III, pp. 311–341. Edited by R. P. Singh, U. S. Singh & K. Kohmoto. Oxford: Pergamon Press.

Dugdale, B., Beetham, P. R., Becker, D. K., Harding, R. M. & Dale, J. L. (1998). Promoter activity associated with the intergenic regions of banana bunchy top virus DNA-1 to -6 in transgenic tobacco and banana cells. J Gen Virol 79, 2301–2311.[Abstract]

Dugdale, B., Becker, D. K., Beetham, P. R., Harding, R. M. & Dale, J. L. (2000). Promoters derived from banana bunchy top virus DNA-1 to -5 direct vascular-associated expression in transgenic banana (Musa spp.). Plant Cell Rep 19, 810–814.[CrossRef]

Gronenborn, B. (2004). Nanoviruses: genome organisation and protein function. Vet Microbiol 98, 103–109.[CrossRef][Medline]

Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S. & Robertson, D. (2000). Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Crit Rev Biochem Mol Biol 35, 105–140.[Medline]

Harding, R. M., Burns, T. M. & Dale, J. L. (1991). Virus-like particles associated with banana bunchy top disease contain small single-stranded DNA. J Gen Virol 72, 225–230.[Abstract/Free Full Text]

Hehn, A. & Rohde, W. (1998). Characterization of cis-acting elements affecting strength and phloem specificity of the coconut foliar decay virus promoter. J Gen Virol 79, 1495–1499.[Abstract]

Higo, K., Ugawa, Y., Iwamoto, M. & Korenaga, T. (1999). Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res 27, 297–300.[Abstract/Free Full Text]

Hobbs, S. L. A., Kpodar, P. & DeLong, C. M. O. (1990). The effect of T-DNA copy number, position and methylation on reporter gene expression in tobacco transformants. Plant Mol Biol 15, 851–864.[CrossRef][Medline]

Hobbs, S. L. A., Warkentin, T. D. & DeLong, C. M. O. (1993). Transgene copy number can be positively or negatively associated with transgene expression. Plant Mol Biol 21, 17–26.[CrossRef][Medline]

Hoekema, A., Hirsch, P. R., Hooykaas, P. J. J. & Schilperoort, R. A. (1983). A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303, 179–180.[CrossRef]

Horsch, R. B., Fry, J. E., Hoffman, N. L., Eichholtz, D., Rogers, S. G. & Fraley, R. T. (1985). A simple and general method for transferring genes into plants. Science 227, 1229–1231.[Abstract/Free Full Text]

Horser, C. L., Harding, R. M. & Dale, J. L. (2001). Banana bunchy top nanovirus DNA-1 encodes the ‘master’ replication initiation protein. J Gen Virol 82, 459–464.[Abstract/Free Full Text]

Inouye, T., Inouye, N. & Mitsuhata, K. (1968). Yellow dwarf of pea and broad bean caused by milk vetch dwarf virus. Ann Phytopathol Soc Jpn 34, 28–35 (in Japanese).

Katul, L., Vetten, H. J., Maiss, E., Makkouk, K. M., Lesemann, D.-E. & Casper, R. (1993). Characterisation and serology of virus-like particles associated with faba bean necrotic yellows. Ann Appl Biol 123, 629–647.

Kosugi, S., Ohashi, Y., Nakajima, K. & Arai, Y. (1990). An improved assay for {beta}-glucuronidase in transformed cells: methanol almost completely suppresses a putative endogenous {beta}-glucuronidase activity. Plant Sci 70, 133–140.[CrossRef]

Lam, E., Benfey, P. N., Gilmartin, P. M., Fang, R.-X. & Chua, N.-H. (1989). Site-specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proc Natl Acad Sci U S A 86, 7890–7894.[Abstract/Free Full Text]

Mikami, K., Tabata, T., Kawata, T., Nakayama, T. & Iwabuchi, M. (1987). Nuclear protein(s) binding to the conserved DNA hexameric sequence postulated to regulate transcription of wheat histone genes. FEBS Lett 223, 273–278.[CrossRef][Medline]

Morozov, S. Ya., Merits, A. & Chernov, B. K. (1994). Computer search of transcription control sequences in small plant virus DNA reveals a sequence highly homologous to the enhancer element of histone promoters. DNA Seq 4, 395–397.[Medline]

Murashige, T. & Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15, 473–497.[CrossRef]

Nakayama, T., Sakamoto, A., Yang, P., Minami, M., Fujimoto, Y., Ito, T. & Iwabuchi, M. (1992). Highly conserved hexamer, octamer and nonamer motifs are positive cis-regulatory elements of the wheat histone H3 gene. FEBS Lett 300, 167–170.[CrossRef][Medline]

Ohki, S. T., Doi, Y. & Yora, K. (1975). Small spherical virus particles found in broad bean plants infected with milk vetch dwarf virus. Ann Phytopathol Soc Jpn 41, 508–510 (in Japanese).

Ohshima, M., Itoh, H., Matsuoka, M., Murakami, T. & Ohashi, Y. (1990). Analysis of stress-induced or salicylic acid-induced expression of the pathogenesis-related 1a protein gene in transgenic tobacco. Plant Cell 2, 95–106.[Abstract/Free Full Text]

Ooms, G., Hooykaas, P. J., Van Veen, R. J., Van Beelen, P., Regensburg-Tuink, T. J. & Schilperoort, R. A. (1982). Octopine Ti-plasmid deletion mutants of Agrobacterium tumefaciens with emphasis on the right side of the T-region. Plasmid 7, 15–29.[CrossRef][Medline]

Peach, C. & Velten, J. (1991). Transgene expression variability (position effect) of CAT and GUS reporter genes driven by linked divergent T-DNA promoters. Plant Mol Biol 17, 49–60.[CrossRef][Medline]

Randles, J. W. & Hanold, D. (1989). Coconut foliar decay virus particles are 20-nm icosahedra. Intervirology 30, 177–180.[Medline]

Rohde, W., Becker, D. & Randles, J. W. (1995). The promoter of coconut foliar decay-associated circular single-stranded DNA directs phloem-specific reporter gene expression in transgenic tobacco. Plant Mol Biol 27, 623–628.[CrossRef][Medline]

Sano, Y., Wada, M., Hashimoto, Y., Matsumoto, T. & Kojima, M. (1998). Sequences of ten circular ssDNA components associated with the milk vetch dwarf virus genome. J Gen Virol 79, 3111–3118.[Abstract]

Shirasawa-Seo, N., Sano, Y., Nakamura, S. & 8 other authors (2005). The promoter of Milk vetch dwarf virus component 8 confers effective gene expression in both dicot and monocot plants. Plant Cell Rep (in press).

Sunter, G. & Bisaro, D. M. (1991). Transactivation in a geminivirus: AL2 gene product is needed for coat protein expression. Virology 180, 416–419.[CrossRef][Medline]

Surin, B., Boevink, P., Keese, P., Chu, P., Larkin, P., Llewellyn, D., Kahn, R., Ellacott, G. & Waterhouse, P. (1998). A suite of promoters and terminators for plant biotechnology. In Proceedings of the Fourth Asia-Pacific Conference on Agricultural Bio/Technology, abstract pp. 121–122. Canberra: UTC Publishing.

Timchenko, T., Katul, L., Sano, Y., de Kouchkovsky, F., Vetten, H. J. & Gronenborn, B. (2000). The master Rep concept in nanovirus replication: identification of missing genome components and potential for natural genetic reassortment. Virology 274, 189–195.[CrossRef][Medline]

Vetten, H. J., Chu, P. W. G., Dale, J. L. & 7 other authors (2004). Nanoviridae. In Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Viruses, pp. 343–352. Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger & L. A. Ball. London: Elsevier/Academic Press.

Yanagisawa, S. (2002). The Dof family of plant transcription factors. Trends Plant Sci 7, 555–560.[CrossRef][Medline]

Received 29 November 2004; accepted 8 March 2005.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
I. Grigoras, T. Timchenko, and B. Gronenborn
Transcripts encoding the nanovirus master replication initiator proteins are terminally redundant
J. Gen. Virol., February 1, 2008; 89(2): 583 - 593.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Lageix, O. Catrice, J.-M. Deragon, B. Gronenborn, T. Pelissier, and B. C. Ramirez
The Nanovirus-Encoded Clink Protein Affects Plant Cell Cycle Regulation through Interaction with the Retinoblastoma-Related Protein
J. Virol., April 15, 2007; 81(8): 4177 - 4185.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Timchenko, L. Katul, M. Aronson, J. C. Vega-Arreguin, B. C. Ramirez, H. J. Vetten, and B. Gronenborn
Infectivity of nanovirus DNAs: induction of disease by cloned genome components of Faba bean necrotic yellows virus
J. Gen. Virol., June 1, 2006; 87(6): 1735 - 1743.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirasawa-Seo, N.
Right arrow Articles by Matsumoto, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirasawa-Seo, N.
Right arrow Articles by Matsumoto, T.
Agricola
Right arrow Articles by Shirasawa-Seo, N.
Right arrow Articles by Matsumoto, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS