J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 87 (2006), 715-722; DOI 10.1099/vir.0.81488-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, S.
Right arrow Articles by Beachy, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, S.
Right arrow Articles by Beachy, R. N.
Agricola
Right arrow Articles by Dai, S.
Right arrow Articles by Beachy, R. N.
© 2006 Society for General Microbiology

Essential role of the Box II cis element and cognate host factors in regulating the promoter of Rice tungro bacilliform virus

Shunhong Dai{dagger}, Zhihong Zhang{dagger}, Jennifer Bick and Roger N. Beachy

The Donald Danforth Plant Science Center, 975 North Warson Road, St Louis, MO 63132, USA

Correspondence
Roger N. Beachy
RnBeachy{at}danforthcenter.org


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Rice tungro bacilliform virus (RTBV) is a double-stranded DNA virus with a single, tissue-specific promoter that is expressed primarily in phloem tissues. Rice transcription factors RF2a and RF2b bind to Box II, a cis element adjacent to the TATA box, and control gene expression from the promoter. Mutations were made in the promoter to delete or mutate Box II and the mutated promoters were fused to a reporter gene; the chimeric genes were expressed in transient BY-2 protoplast assays and in transgenic Arabidopsis plants. The results of these studies showed that Box II is essential to the activity of the RTBV promoter. A chimeric beta-glucuronidase (GUS) reporter gene containing the Box II sequence and a minimal promoter derived from the Cauliflower mosaic virus 35S promoter were co-transfected into protoplasts with gene constructs that encoded RF2a or RF2b. The reporter gene produced threefold higher GUS activity when co-transfected with RF2a, and 11-fold higher activity when co-transfected with RF2b, than in the absence of added transcription factors. Moreover, chimeric reporter genes were activated by approximately threefold following induction of expression of the RF2a gene in transgenic Arabidopsis plants. The work presented here and earlier findings show that Box II and its interactions with cognate rice transcription factors, including RF2a and RF2b, are essential to the activity of the RTBV promoter and are probably involved in expression of the RTBV genome during virus replication.

{dagger}These authors contributed equally to this work. Back


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Rice tungro disease (RTD) is a significant threat to rice production in South-East Asia (Hull, 1996Down). RTD is caused by two plant viruses, namely Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV) (Hibino et al., 1978Down; Hull, 1996Down). Whilst RTSV is required for disease transmission, RTBV is the primary causative agent of RTD (Hull, 1996Down). RTBV is a plant pararetrovirus with a genome of circular, double-stranded DNA (Qu et al., 1991Down) and belongs to the genus ‘Rice tungro bacilliform-like viruses' of the family Caulimoviridae (Mayo & Pringle, 1998Down). The 8 kbp RTBV genome consists of four open reading frames (ORFs) and a single transcriptional promoter that is located within the intergenic region between ORF IV and ORF I (Bhattacharyya-Pakrasi et al., 1993Down; Qu et al., 1991Down). The RTBV promoter is expressed predominantly in phloem tissues in transgenic rice and tobacco (Bhattacharyya-Pakrasi et al., 1993Down; Petruccelli et al., 2001Down; Yin & Beachy, 1995Down). Promoter activity in the epidermis and other cell types has also been observed in transgenic rice when sequences downstream of the transcription start site were included in the analysis (Klöti et al., 1999Down). Tissue specificity of the promoter correlates somewhat with the tissue-specific accumulation of RTBV particles in infected plants (Bhattacharyya-Pakrasi et al., 1993Down; Cruz & Koganezawa, 1991Down; Saito et al., 1986Down; Yin & Beachy, 1995Down).

The E fragment of the RTBV promoter, as described in earlier studies (Yin & Beachy, 1995Down), includes nt –164 to +45 relative to the transcription start site; this fragment (hereafter referred to as the ‘E promoter’) retains significant activity and tissue specificity of expression in transgenic rice and tobacco plants (Bhattacharyya-Pakrasi et al., 1993Down; Petruccelli et al., 2001Down; Yin & Beachy, 1995Down). In addition to the TATA box (nt –31 to –25), the E promoter contains four cis elements identified through footprint analysis and electrophoretic mobility-shift assays (Yin & Beachy, 1995Down; Yin et al., 1997aDown). The cis elements include a GATA motif (nt –143 to –135), an AS1-like (ASL) box (nt –98 to –79), Box II (nt –53 to –39) and Box I (nt –2 to +8). The roles of each motif in regulating the activity of the promoter have been partially characterized (Yin & Beachy, 1995Down; Yin et al., 1997aDown). Similarly, four cis elements within the E promoter, namely the vascular bundle expression (VBE) element (nt –169 to –100), the activator element (AE) (nt –70 to –35), a TATA box (–35 to +1) and the downstream promoter sequence (DPS), which includes dps-a (nt +1 to +35), dps-b (nt +20 to +55) and dps1 (nt +50 to +90), were subsequently defined (He et al., 2000Down, 2001Down, 2002Down). The GATA motif, Box II and Box I are coincident with the VBE, AE and DPS elements, respectively. Box II is a unique cis element located immediately 5' of the TATA box; sequences similar to those in Box II have been identified among other vascular tissue-specific promoters that are expressed in plants (Yin et al., 1997aDown).

The genes that encode rice basic leucine zipper (bZIP) transcription factors RF2a and RF2b are expressed predominantly in vascular tissues, the tissues in which RTBV replication occurs and where the RTBV promoter is expressed (Bhattacharyya-Pakrasi et al., 1993Down; Cruz & Koganezawa, 1991Down; Dai et al., 2004Down; Saito et al., 1986Down; Yin & Beachy, 1995Down). RF2a and RF2b interact with Box II (Dai et al., 2004Down; Yin et al., 1997bDown) and activate transcription from the E promoter (Dai et al., 2003Down, 2004Down; Petruccelli et al., 2001Down; Yin et al., 1997bDown). In transgenic plants that overexpress RF2a or RF2b constitutively, the expression pattern of the RTBV promoter was altered from vascular tissue-specific to constitutive (Dai et al., 2004Down; Petruccelli et al., 2001Down). Downregulating the expression level of RF2a and RF2b in transgenic rice plants by expressing antisense genes of RF2a and RF2b causes phenotypes that in part resemble RTD symptoms (Dai et al., 2004Down; Yin et al., 1997bDown). These data suggest that RF2a and RF2b regulate expression of the RTBV promoter during infection. The purpose of the present study was to characterize further the role of Box II and its interaction with transcription factors RF2a and RF2b in regulating expression of the RTBV promoter and to gain a better understanding of replication of RTBV.

In this report, data from transient tobacco BY-2 protoplast assays and transgenic Arabidopsis plants indicated that Box II, or the Box II portion of AE, is essential for the activity of the RTBV promoter. Furthermore, we demonstrated that chimeric promoters comprising Box II fused to minimal promoters derived from Cauliflower mosaic virus (CaMV) 35S promoter could be activated by RF2a and RF2b. We also showed that chimeric promoters could be activated by induction of RF2a using the ecdysone receptor-based, chemical-inducible gene-expression system. The work published here and our earlier findings show that Box II and its interactions with cognate rice transcription factors such as RF2a and RF2b are essential for expression of the RTBV promoter and potentially for virus replication.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Plasmid construction
Plasmids for tobacco BY-2 protoplast transfection.
The promoters used in this study included the E promoter (nt –164 to +45) and deletions of the promoter that were generated via PCR amplification from the chimeric gene pE : GUS (Yin & Beachy, 1995Down). For mutagenesis, we used the beta-glucuronidase (GUS) 3' primer with complementary sequence located in the uid A (GUS gene)-encoding sequence and one of three 5' primers (RTBV-100 5', RTBV-68 5' or RTBV-32 5') with a HindIII site and sequences up to designated positions at –100, –68 and –32 of the E fragment (see primer list below) (Yin & Beachy, 1995Down; Yin et al., 1997aDown). Promoters with mutations in the Box II cis element, namely Box IIm1 and Box IIm2 (described previously by Yin et al., 1997aDown; see Fig. 1Down for sequence information), or deletion of Box II were produced by fusion PCR with pE : GUS as template. PCR products that produced the deletion or other mutations of the E promoter were inserted into pE : GUS via HindIII/NcoI restriction sites to replace the E promoter, resulting in p–100 : GUS, p–68 : GUS, p–32 : GUS, pE(BIIm1) : GUS, pE(BIIm2) : GUS and pE({Delta}BII) : GUS, respectively.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Box II is essential for the activity of the E promoter in BY-2 protoplasts. (a) Diagram of 5' deletions of the E promoter, point mutations of Box II and Box II deletions in the E promoter region. Each promoter fragment was ligated to the uidA reporter gene and the nopaline synthase (Nos) 3' terminator sequence. Asterisks indicate the positions of point mutations. (b) Sequence information for Box II and the Box IIm1 (BIIm1) and Box IIm2 (BIIm2) mutants and their relative positions in the E promoter (Yin & Beachy, 1995Down). (c) Relative GUS activity of gene constructs following transfection of BY-2 protoplasts. GUS activity from each construct was compared with that of p–32 : GUS, which was assigned a value of 1. Each column represents the mean±SD of three independent experiments, with three repeats per experiment. All results were normalized against the internal-control plasmid p35S : GFP.

 
To construct plasmids with the uid A-coding sequence driven by CaMV 35S minimal promoters, PCR products were amplified from p35S : GUS (Petruccelli et al., 2001Down) by using specific primer sets, namely GUS 3' primer (Yin & Beachy, 1995Down) and primers CaMV-38 5' and CaMV-48 5', which contained a HindIII site and truncated mutants of the CaMV 35S promoter to nt –38 or –48, respectively. PCR products were inserted into pE : GUS (Yin & Beachy, 1995Down) to replace the E promoter via HindIII/NcoI restriction sites and resulted in pSm–38 : GUS and pSm–48 : GUS. Similarly, to construct plasmids with a GUS gene driven by chimeric promoters that contained Box II (Yin et al., 1997aDown) or AE (He et al., 2000Down) and CaMV 35S minimal promoters, primers BII-Sm–38 5', BII-Sm–48 5' and AE-Sm–32 with a HindIII site, including Box II or AE sequences and the 5' end of sequences from the CaMV 35S promoter up to –38, –48 or –32, respectively, were used in combination with GUS 3' primer in PCR with p35S : GUS as template (Petruccelli et al., 2001Down). PCR products with Box II fused to the minimal promoters of the 35S promoter were inserted into pE : GUS (Yin & Beachy, 1995Down) to replace the E promoter via HindIII/NcoI sites and resulted in plasmids pBIISm–38 : GUS, pBIISm–48 : GUS and pAESm–38 : GUS, respectively.

Plasmids for Arabidopsis transformation.
To construct binary vectors for Agrobacterium-mediated transformation, the E : GUS, –100 : GUS, –68 : GUS, –32 : GUS, E(BIIm1) : GUS and E(BIIm2) : GUS fusion genes were released from pE : GUS, p–100 : GUS, p–68 : GUS, p–32 : GUS, pE(BIIm1) : GUS and pE(BIIm2) : GUS plasmids by using HindIII/KpnI and cloned into the binary vector pCambia1300 (a gift from CAMBIA, Australia) by using the same set of restriction enzymes. The resulting plasmids were designated pCE : GUS, pC–100 : GUS, pC–68 : GUS, pC–32 : GUS, pCE(BIIm1) : GUS and pCE(BIIm2) : GUS, respectively.

To construct plasmids with a gene encoding RF2a that can be induced by methoxyfenozide, the coding sequence of RF2a was released from p35S : RF2a (Petruccelli et al., 2001Down) by using EcoRI (blunt)/BamHI (blunt). The resulting fragment was inserted into p5G35Sm : Luc (Padidam et al., 2003Down) to replace the luciferase gene. This gene is controlled by a chimeric promoter comprising five repeats of the Gal4 DNA-binding site and a 35S minimal promoter through ligation at the NcoI (blunt)/XbaI (blunt) site; this resulted in plasmid p5G35Sm : RF2a. 5G35Sm : RF2a was released from p5G35Sm : RF2a by using SalI/BamHI and cloned into pSL301 (Invitrogen) through the same set of restriction enzymes to yield intermediate vector pSL-5G35Sm : RF2a. DNA fragments encoding E : GUS, Sm–38 : GUS, BIISm–38 : GUS and AESm–32 : GUS were released from pE : GUS, pSm–38 : GUS, pBIISm–38 : GUS and pAESm–32 : GUS, respectively, through BamHI and HindIII (blunt) restriction sites. These DNA fragments were inserted into the intermediate vector pSL-5G35Sm : RF2a through BamHI and NdeI (blunt) and resulted in plasmids pSL-E : GUS/5G35Sm : RF2a, pSL-Sm–38 : GUS/5G35Sm : RF2a, pSL-BIISm–38 : GUS/5G35Sm : RF2a and pSL-AESm–32 : GUS/5G35Sm : RF2a, respectively.

The pCambia1300-based binary plasmid pC-5GRbm : E5/CsVMV : VGE, which carries the 5GRbm : E5 gene and the chimeric receptor VGE (V, VP16; G, Gal4 DNA-binding site; E, ligand-binding domain of the ecdysone receptor) driven by the promoter of Cassava vein mosaic virus (CsVMV) (Padidam et al., 2003Down) was used to construct the plasmids for inducible expression of RF2a and the GUS reporter gene. DNA fragments encoding E : GUS/5G35Sm : RF2a, Sm–38 : GUS/5G35Sm : RF2a, BIISm–38 : GUS/5G35Sm : RF2a and AESm–32 : GUS/5G35Sm : RF2a were released from pSL-E : GUS/5G35Sm : RF2a, pSL-Sm–38 : GUS/5G35Sm : RF2a, pSL-BIISm–38 : GUS/5G35Sm : RF2a and pSL-AESm–32 : GUS/5G35Sm : RF2a by digestion of the plasmid DNAs with HindIII (blunt). These DNA fragments were inserted into pC-5GRbm : E5/CsVMV : VGE through the SalI (blunt) site to replace 5GRbm : E5 and yielded plasmids pC-E : GUS/2aVGE, pC-Sm–38 : GUS/2aVGE, pC-BIISm–38 : GUS/2aVGE and pC-AESm–38 : GUS/2aVGE (see Fig. 4aDown).


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Activation of chimeric genes comprising the E promoter or chimeric promoters containing Box II by induction of RF2a in transgenic Arabidopsis plants. (a) Diagram of binary gene constructs for Agrobacterium-mediated transformation. E, E promoter of RTBV; 5G35Sm, five repeats of the Gal4 DNA-binding site (5G) in fusion with the minimal promoter of the CaMV 35S promoter (Sm); VGE, chimeric receptor comprising the VP16 transcription activation domain (V), the Gal4 DNA-binding domain (G) and the ecdysone receptor ligand-binding domain (E) (Padidam et al., 2003Down); Box II, cis element in the E promoter of RTBV; AE, cis element located in the E promoter of RTBV, which includes Box II (He et al., 2000Down). (b) Western blot analysis of transgenic Arabidopsis plants with or without induction of RF2a expression. Leaf samples from transgenic lines with pC-E : GUS/2aVGE or pC-E : GUS were collected prior to the application of methoxyfenozide (–) or 1 week after treatment (+). Forty micrograms of protein isolated from each sample was fractionated by SDS-PAGE (12 % gel) and immunoblottedagainst anti-RF2a antibody. An arrow indicates the position of RF2a (upper panel). To monitor loading, the membrane was stained with Ponceau S (Sigma) prior to immunoblotanalysis (lower panel). (c) Enhancement of GUS activity of reporter genes in transgenic Arabidopsis plants followinginduction of RF2a expression. The GUS activity of treated (open bars) or untreated (solid bars) samples was quantified. In the left panel, the GUS activity of each sample was compared with that of E : GUS with no induction; in the right panel, the GUS activity of each sample was compared with that of pC-SM–38 : GUS/2aVGE. Each bar represents the mean±SD of three repeats, each comprising nine pooled plants. The GUS activity in transgenic plants with E : GUS (left panel) was approximately 12-fold higher than that in uninduced transgenic plants with BIISm–38 : GUS/2aVGE (right panel).

 
Primers.
The primers used for the above experiments were: GUS 3', GATTTCACGGGTTGGGGTTTCTA; RTBV–100 5', ATCAAAGCTTTAGCATCTTTACTTTAGCAT; RTBV–68 5', ATCAAAGCTTAAGAGTGTATAATGACCA; RTBV–32 5', ATCAAAGCTTGTATATAAGGAGCACCAGAGTA; CaMV–38 5', TGATCAAAGCTTCTTCCTCTATATAAGGAAGTT CaMV–48 5', TGATCAAAGCTTTCGCAAGACCCTTCCTC; BII-Sm–38 5', TGATCAAAGCTTCCAGTGTGCCCCTGGCTTCCTCTATATAAGGAAGTT; BII-Sm–48 5', TGATCAAAGCTTCCAGTGTGCCCCTGGTCGCAAGACCCTTCCTC; AE-Sm–32 5', CAAAGCTTGTAAGAGTGTGTAATGACCAGTGTGCCCCTGGACTCCAGTATATAAGGAAGTTCA.

Transfection of tobacco BY-2 protoplasts.
Protoplast transfection was conducted as described previously (Dai et al., 2003Down). Approximately 106 protoplasts were transfected by electroporation with 20 µg effector DNA, 15 µg herring-sperm DNA, 2·5 µg reporter gene DNA and 15 µg pCat-GFP DNA (Dai et al., 2003Down). In samples with reporter gene alone, the total amount of DNA was adjusted by adding 20 µg herring-sperm carrier DNA.

Arabidopsis transformation.
pCE : GUS, pC–100 : GUS, pC–68 : GUS, pC–32 : GUS, pCE(BIIm1) : GUS, pCE(BIIm2) : GUS, pC-Sm–38 : GUS/2aVGE, pC-BIISm–38 : GUS/2aVGE and pC-AESm–38 : GUS/2aVGE were introduced into Agrobacterium tumefaciens GV3101 and used to transform Arabidopsis thaliana Col-0 via an Agrobacterium-mediated flower-dip method (Clough & Bent, 1998Down). T1 generation transgenic plants were selected from seeds collected from the primary transformants on MS medium (Murashige & Skoog, 1962Down) plus 50 mg hygromycin B l–1 and 100 mg carbenicillin l–1. Arabidopsis plants were maintained in a growth room at 22 °C with a 16 h light/8 h dark cycle.

Induction of Arabidopsis gene expression.
Transgenic plants harbouring pC-Sm–38 : GUS/2aVGE, pC-BIISm–38 : GUS/2aVGE and pC-AESm–32 : GUS/2aVGE were selected and transplanted into soil. Intrepid 2F (Dow AgroSciences) was diluted to a working concentration of 62·5 µm methoxyfenozide and applied through a single soil drench to the plants 2 weeks after transplanting. Two samples were collected from each plant, one prior to the induction of the expression of RF2a and another at 1 week after the induction. Each treatment was repeated three times with nine plants pooled as one repeat.

Western blot analysis.
Leaf samples from each transgenic Arabidopsis line, which carried either pC-E : GUS/2aVGE or pC-E : GUS, were collected, one prior to the application of methoxyfenozide and one 1 week after the application of inducer. Forty micrograms of protein isolated from each leaf sample was resolved by SDS-PAGE (12 % gel). Immunoblot analysis was carried out as described previously (Dai et al., 2003Down) using antibody against RF2a. The membrane was stained with Ponceau S (Sigma) prior to immunoblot analysis.

Quantitative analysis of GUS activity and green fluorescent protein (GFP).
Protein samples from protoplasts and plants were prepared by using protein-extraction buffer (Jefferson et al., 1987Down) and quantified by using a DC Protein Assay kit (Bio-Rad). GUS activity was measured as described previously using 4-methylumbelliferyl-beta-D-glucuronide as substrate (Jefferson et al., 1987Down). GFP was measured with a Gemini fluorescence spectrophotometer (Molecular Devices). The excitation and emission wavelengths were set at 460 and 510 nm, respectively. Similar extracts from non-transgenic plants were used as the ‘blank’ in these assays.


   RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Box II DNA cis element is essential for RTBV promoter activity in BY-2 cells
Previous reports have indicated that the RTBV promoter is expressed predominantly in phloem tissues in transgenic tobacco, rice and Arabidopsis plants; promoter activity was also observed in epidermal cells and other cell types in transgenic rice when a large fragment of DNA sequence of the virus downstream of the transcription start site was included (Klöti et al., 1999Down). The E fragment of the RTBV promoter, comprising nt –164 to +45 relative to the start site of transcription, retains vascular tissue-specific expression similar to a DNA fragment that included sequences from –731 to +45 (Bhattacharyya-Pakrasi et al., 1993Down; Yin & Beachy, 1995Down; Yin et al., 1997aDown). The E promoter is also active in Orychophragmus violaceus (dicot) and tobacco BY-2 protoplasts (Chen et al., 1994Down; Dai et al., 2003Down, 2004Down). The activity of the E promoter in BY-2 protoplasts was approximately 40 % of the activity of the enhanced CaMV 35S promoter, a strong constitutive promoter (data not shown). Transient assays were conducted in BY-2 protoplasts to determine the role of the Box II cis element in activity of the E promoter.

To establish the function of Box II in the E promoter, we truncated the promoter from the 5' end to remove the GATA motif, the ASL box and Box II. These 5'-end deletion mutants were fused to the uidA coding sequence in constructs p–100 : GUS, p–68 : GUS and p–32 : GUS (Fig. 1aUp). These constructs and the E : GUS reporter gene (Dai et al., 2004Down) were introduced into BY-2 protoplasts via electroporation in transient assays. The results shown in Fig. 1(c)Up indicated that the Box II sequence was important for promoter activity in this assay. The promoter activity remained unchanged in p–68 : GUS compared with the E : GUS construct, whereas promoter activity dropped to basal level when Box II was removed (p–32 : GUS). This result is in agreement with results from rice protoplasts reported by He et al. (2000)Down.

Mutations were made to either alter or delete the Box II element in the E promoter. Mutated promoters were ligated to the uidA coding sequence to create pE(BIIm1) : GUS, pE(BIIm2) : GUS and pE({Delta}BII) : GUS [see Fig. 1(b)Up for sequence information]. Plasmids pE(BIIm1) : GUS and pE(BIIm2) : GUS were reported previously to have little or no activity in rice-leaf sheath tissues bombarded with plasmid DNA (Yin et al., 1997aDown). The activity of each of the mutated promoters in constructs from which Box II had been either deleted or mutated dropped to basal level in comparison with the E promoter (Fig. 1cUp), indicating that Box II is essential for promoter activity. As the promoter is active in BY-2 cells, we concluded that endogenous transcription factor(s) in BY-2 cells interact with Box II, but not mutants of Box II, to maintain expression of the reporter gene (Fig. 1cUp). A transcription factor (repression of shoot growth or RSG) with high sequence identity to RF2a has been identified from BY-2 cells (Fukazawa et al., 2000Down).

It was noted that, although RF2a and RF2b showed higher binding affinities to Box IIm1 than to native Box II in in vitro assays (Dai et al., 2004Down; Yin et al., 1997bDown), the mutation did not enhance promoter activity in the protoplast assays. He et al. (2001)Down reported that the RTBV promoter is subject to the regulation of DNA methylation. A possible explanation of the results obtained in protoplast transient assays is that, by mutating the CCCC sequence in Box II to GCGC in Box IIm1, we coincidently introduced methylation site(s) that may potentially be methylated in vivo. Another possible explanation is that efficient transcription relies on dynamic interactions between transcription factors to the promoter rather than tight binding.

Box II is essential for expression of the E promoter in transgenic Arabidopsis plants
The E : GUS gene is expressed in vascular tissues in transgenic Arabidopsis, rice and tobacco plants (Petruccelli et al., 2001Down; Yin & Beachy, 1995Down). Arabidopsis was chosen to characterize further the role of Box II in expression of the E promoter. Gene constructs that included deletions and mutations of the E promoter were introduced by Agrobacterium-mediated transformation as described in Methods. More than 30 independent transgenic lines were developed for most constructs and GUS activity was analysed in plants of the T1 generation of each line (Fig. 2Down). As shown in Fig. 2Down, the data from transgenic plants agreed, in general, with the data from the transient assays (Fig. 1Up) and showed that Box II is essential for expression of the E promoter in transgenic plants. Promoter activity dropped significantly, but was not abolished, when Box II was removed (compare pC–68 : GUS with pC–32 : GUS) or mutated [compare pCE : GUS with pCE(BIIm1) : GUS and pCE(BIIm2) : GUS].


Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Activity of promoters with mutations or 5' deletions in Box II of the E promoter in transgenic Arabidopsis plants. The GUS activity (per unit soluble protein) from leaf samples of 3-week-old Arabidopsis plants from each independent transgenic line was presented as one point in each column. The total number of transgenic lines assayed for each construct (n) is shown. RU, Relative units.

 
RF2a and RF2b activate transcription from chimeric promoters that contain Box II
As described above, Box II is essential for the activity of the E promoter. Rice bZIP host factors RF2a and RF2b interact with the promoter through this cis element and activate transcription from the E promoter (Dai et al., 2004Down; Yin et al., 1997bDown). We wished to determine whether RF2a and RF2b could activate chimeric promoters that contain Box II. He et al. (2000)Down reported that the space between Box II and TATA is important; we made similar observations in other studies (Z. Zhang, S. Dai & R. N. Beachy, unpublished data). To maintain the same relative position and orientation between Box II and TATA in the chimeric promoter, Box II was fused to the 5' end of the core promoter sequence from the CaMV 35S promoter at either nt –38 or nt –48, generating reporter constructs pBIISm–38 : GUS and pBIISm–48 : GUS (Fig. 3Downa). These reporter genes were co-transfected independently into BY-2 cells with pCs : RF2a or pCs : RF2b (Dai et al., 2004Down). As shown in Fig. 3(b)Down, RF2a and RF2b activated transcription from both chimeric promoters, whereas RF2a had no effect on control plasmids that lacked Box II [pE({Delta}BII) : GUS] and the minimal promoter of CaMV (pSm–48 : GUS) (Fig. 3cDown). Similarly, the vector-control plasmid (pCs) showed no effect on expression of the reporter genes (Fig. 3bDown). As in the case of a reporter gene driven by the E promoter (Dai et al., 2004Down), RF2b showed stronger activity than RF2a in activating transcription from the chimeric promoters.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Transcription factors RF2a and RF2b activate transcription from Box II containing chimeric promoters with the Box II cis element in BY-2 protoplasts. (a) Diagram of reporter- and effector-gene constructs. Chimeric promoters with Box II fused to the minimal promoter of CaMV 35S promoter sequences are referred to as BIISm–38 and BIISm–48. BoxII, Box II of the E promoter of RTBV; Sm–38, –38 to +8 of CaMV 35S promoter; Sm–48, –48 to +8 of CaMV 35S promoter; CsVMV, CsVMV promoter; Nos, nopaline synthase (Nos) 3' terminator sequence. pE({Delta}BII) : GUS is a deletion mutant of the E promoter in which the Box II cis element was removed. (b)Relative GUS activity of reporter genes in BY-2 protoplasts co-transfected with RF2a or RF2b. The data presented were compared with the pBIISm–38 : GUS gene co-transfected with the pCs plasmid (assigned a value of 1). Each bar represents the mean±SD of three independent co-transfection experiments with three repeats of each experiment. All results were normalized against the internal control p35S : GFP prior to further analysis. (c) RF2a has no effect on reporter genes without the Box II cis element. Reporter constructs with a mutated E promoter in which the Box II was removed [E({Delta}BII) : GUS] or the CaMV 35S minimal promoter alone (to position –48) were notaffected by co-transfection with RF2a. The data presented in this panel were compared with those of pE : GUS without effector (assigned a value of 1). Each bar represents the mean±SD of three independent experiments with three repeats of each experiment. All results were normalized against the internal control, p35S : GFP, prior to further analysis.

 
To evaluate further the role of interactions between Box II and the transcription factors in regulating gene expression, additional studies were carried out in transgenic Arabidopsis plants. For these studies, genes were constructed in which expression of RF2a was under the control of an inducible promoter that contained five repeats of the Gal4 DNA-binding site and the 35S minimal promoter (5G35Sm). This promoter is silent unless the VGE receptor protein activates its expression (Fig. 4Upb). The VGE chimeric receptor was placed under the control of the CsVMV promoter; in the presence of methoxyfenozide, VGE binds the Gal4 DNA-binding site to induce expression of RF2a, which in turn binds to Box II and regulates expression of the target gene. Genes encoding RF2a and VGE were cloned into binary vectors together with the reporter gene BIISm–38 : GUS to yield pC-BIISm–38 : GUS/2aVGE (Fig. 4aUp). In this construct, the minimal promoter was taken to nt –38 of the CaMV promoter. Similarly, AE, as defined by He et al. (2000)Down, was fused to the CaMV 35S minimal promoter to drive a GUS gene (AESm–32 : GUS). To eliminate any potential effects that might be caused by the relative position of the TATA box as reported by He et al. (2000)Down, a minimal promoter of CaMV to nt –32 was used in the chimeric promoter to keep the correct orientation between AE and TATA. The relative orientation between Box II and TATA was also taken into consideration when chimeric promoters were constructed with Box II. The reporter gene AESm–32 : GUS was cloned into vectors with the inducible RF2a gene (pC-AESm–32 : GUS/2aVGE) (Fig. 4aUp). Positive- and negative-control constructs included pC-E : GUS, pC-E : GUS/2aVGE and pC-Sm–38 : GUS/2aVGE (Fig. 4aUp). More than 40 independent transgenic Arabidopsis lines were developed for each construct. Expression of RF2a following induction was monitored by Western blot analysis. As an example, induction of the expression of RF2a in transgenic lines with pC-E : GUS/2aVGE is shown in Fig. 4(b)Up.

Results of studies of representative lines of each construct are shown in Fig. 4(c)Up. As shown in the left panel, induction of RF2a enhanced expression of the E : GUS gene as anticipated based on results obtained when RF2a was expressed constitutively in transgenic tobacco plants (Petruccelli et al., 2001Down). GUS activity in plants that harboured E : GUS only were not affected by the application of methoxyfenozide. As shown in the right panel of Fig. 4(c)Up, induction of RF2a activated expression from BIISm–38 and AESm–32 chimeric promoters (pC-BIISm–38 : GUS/2aVGE and pC-AESm–32 : GUS/2aVGE), whilst induction of RF2a did not affect the CaMV 35S minimal promoter without Box II (pC-Sm–38 : GUS/2aVGE). Note that absolute GUS activity in transgenic plants in which the E : GUS gene was activated by RF2a was much higher than in transgenic plants in which the chimeric promoter was activated by RF2a (the expression of E : GUS was approximately 12-fold higher than expression of BIISm–38). Thus, the data are presented in two different panels.

Conclusions
Understanding transcriptional regulation of the RTBV promoter is important for studies of RTBV replication and RTD. Data from transient assays and stable transgenic plants have shown that the activity and tissue specificity of the RTBV promoter require Box II, a cis element proximal to the 5' end of the TATA box (Petruccelli et al., 2001Down; Yin & Beachy, 1995Down). Multiple nuclear protein-binding complexes are formed on the RTBV promoter, including complexes formed on the ASL sequence (nt –98 to –79) and on Box II (nt –53 to –39), both of which are within the E promoter (Yin & Beachy, 1995Down; Yin et al., 1997aDown). He et al. (2000)Down identified a single AE (nt –70 to –40) within the region nt –100 to –32 of the E promoter. Rice transcription factors RF2a and RF2b interacted with the promoter via Box II and functioned as strong activators to stimulate the expression of the E promoter in cell types in which the promoter is not normally expressed.

It is important to clarify the role of AE and Box II in contributing to the activity of the RTBV promoter. The results presented in this paper indicate that Box II, which is included in AE, plays an essential role in the E promoter and is a prerequisite for correct functioning of the promoter (Figs 1 and 2UpUp). The reported differences in the activity of Box II and AE may be a result of using different nuclear proteins and DNA complexes as the starting material for footprint analyses (He et al., 2000Down; Yin & Beachy, 1995Down; Yin et al., 1997aDown). Studies of the P97 promoter of human papillomavirus type 16 identified several functional cis elements that were adjacent to or overlapped the YY1-binding site by different groups (Dong & Pfister, 1999Down; O'Connor et al., 1996Down). We suggest the possibility that AE is a combination of two or more elements, including Box II. Our studies confirm that Box II and its interaction with rice transcription factors such as RF2a and RF2b are essential for promoter activity. Furthermore, we suggest that this interaction is essential for expression of the RTBV promoter during virus replication and may contribute to the severity of RTD.


   ACKNOWLEDGEMENTS
 
We thank Drs Y. Yin and S. Petruccelli for their input in the project. We thank Dr M. Padidam (RheoGene Company) for providing the inducible gene-expression system for this study. We thank Dr Y. Liu for critical reading of the manuscript. This research is supported by DOE grant DE-FG02–99ER20355 to R. N. B. and a grant from the Rohm & Haas Company.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Bhattacharyya-Pakrasi, M., Peng, J., Elmer, J. S. & 7 other authors (1993). Specificity of a promoter from the rice tungro bacilliform virus for expression in phloem tissues. Plant J 4, 71–79.[CrossRef][Medline]

Chen, G., Müller, M., Potrykus, I., Hohn, T. & Fütterer, J. (1994). Rice tungro bacilliform virus: transcription and translation in protoplasts. Virology 204, 91–100.[CrossRef][Medline]

Clough, S. J. & Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735–743.[CrossRef][Medline]

Cruz, F. C. S. & Koganezawa, H. (1991). Presence of rice tungro bacilliform virus (RTBV) in xylem cells of tungro-infected rice. Int Rice Res Newsl 16, 14.

Dai, S., Petruccelli, S., Ordiz, M. I., Zhang, Z., Chen, S. & Beachy, R. N. (2003). Functional analysis of RF2a, a rice transcription factor. J Biol Chem 278, 36396–36402.[Abstract/Free Full Text]

Dai, S., Zhang, Z., Chen, S. & Beachy, R. N. (2004). RF2b, a rice bZIP transcription activator, interacts with RF2a and is involved in symptom development of rice tungro disease. Proc Natl Acad Sci U S A 101, 687–692.[Abstract/Free Full Text]

Dong, X.-P. & Pfister, H. (1999). Overlapping YY1- and aberrant SP1-binding sites proximal to the early promoter of human papillomavirus type 16. J Gen Virol 80, 2097–2101.[Abstract/Free Full Text]

Fukazawa, J., Sakai, T., Ishida, S., Yamaguchi, I., Kamiya, Y. & Takahashi, Y. (2000). Repression of shoot growth, a bZIP transcriptional activator, regulates cell elongation by controlling the level of gibberellins. Plant Cell 12, 901–915.[Abstract/Free Full Text]

He, X., Hohn, T. & Fütterer, J. (2000). Transcriptional activation of the rice tungro bacilliform virus gene is critically dependent on an activator element located immediately upstream of the TATA box. J Biol Chem 275, 11799–11808.[Abstract/Free Full Text]

He, X., Fütterer, J. & Hohn, T. (2001). Sequence-specific and methylation-dependent and -independent binding of rice nuclear proteins to a rice tungro bacilliform virus vascular bundle expression element. J Biol Chem 276, 2644–2651.[Abstract/Free Full Text]

He, X., Fütterer, J. & Hohn, T. (2002). Contribution of downstream promoter elements to transcriptional regulation of the rice tungro bacilliform virus promoter. Nucleic Acids Res 30, 497–506.[Abstract/Free Full Text]

Hibino, H., Roechan, M. & Sudarisman, S. (1978). Association of two types of virus particles with Penyakit Habang (tungro disease) of rice in Indonesia. Phytopathology 68, 1412–1416.

Hull, R. (1996). Molecular biology of rice tungro viruses. Annu Rev Phytopathol 34, 275–297.[CrossRef][Medline]

Jefferson, R. A., Kavanagh, T. A. & Bevan, M. W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6, 3901–3907.[Medline]

Klöti, A., Henrich, C., Bieri, S. & 8 other authors (1999). Upstream and downstream sequence elements determine the specificity of the rice tungro bacilliform virus promoter and influence RNA production after transcription initiation. Plant Mol Biol 40, 249–266.[CrossRef][Medline]

Mayo, M. A. & Pringle, C. R. (1998). Virus taxonomy –1997. J Gen Virol 79, 649–657.[Medline]

Murashige, T. & Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15, 473–497.[CrossRef]

O'Connor, M. J., Tan, S.-H., Tan, C.-H. & Bernard, H.-U. (1996). YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity. J Virol 70, 6529–6539.[Abstract/Free Full Text]

Padidam, M., Gore, M., Lu, D. L. & Smirnova, O. (2003). Chemical-inducible, ecdysone receptor-based gene expression system for plants. Transgenic Res 12, 101–109.[CrossRef][Medline]

Petruccelli, S., Dai, S., Carcamo, R., Yin, Y., Chen, S. & Beachy, R. N. (2001). Transcription factor RF2a alters expression of the rice tungro bacilliform virus promoter in transgenic tobacco plants. Proc Natl Acad Sci U S A 98, 7635–7640.[Abstract/Free Full Text]

Qu, R., Bhattacharyya, M., Laco, G. S. & 7 other authors (1991). Characterization of the genome of rice tungro bacilliform virus: comparison with Commelina yellow mottle virus and caulimoviruses. Virology 185, 354–364.[CrossRef][Medline]

Saito, Y., Hibino, H., Omura, T. & Inoue, H. (1986). Virus diseases of rice: rice tungro disease. In Virus Diseases of Rice and Legumes in the Tropics, pp. 3–13. Edited by T. Kajiwara & K. Konno. Tsukuba, Japan: Tropic Agriculture Research Center, Minister of Agriculture, Forestry and Fisheries.

Yin, Y. & Beachy, R. N. (1995). The regulatory regions of the rice tungro bacilliform virus promoter and interacting nuclear factors in rice (Oryza sativa L.). Plant J 7, 969–980.[CrossRef][Medline]

Yin, Y., Chen, L. & Beachy, R. (1997a). Promoter elements required for phloem-specific gene expression from the RTBV promoter in rice. Plant J 12, 1179–1188.[CrossRef][Medline]

Yin, Y., Zhu, Q., Dai, S., Lamb, C. & Beachy, R. N. (1997b). RF2a, a bZIP transcriptional activator of the phloem-specific rice tungro bacilliform virus promoter, functions in vascular development. EMBO J 16, 5247–5259.[CrossRef][Medline]

Received 2 September 2005; accepted 16 November 2005.


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Dai, X. Wei, A. A. Alfonso, L. Pei, U. G. Duque, Z. Zhang, G. M. Babb, and R. N. Beachy
Transgenic rice plants that overexpress transcription factors RF2a and RF2b are tolerant to rice tungro virus replication and disease
PNAS, December 30, 2008; 105(52): 21012 - 21016.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, S.
Right arrow Articles by Beachy, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, S.
Right arrow Articles by Beachy, R. N.
Agricola
Right arrow Articles by Dai, S.
Right arrow Articles by Beachy, R. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS