|
|
||||||||
University of Nebraska Medical Center, Omaha, NE, USA
Correspondence
Steven D. Carson
scarson{at}unmc.edu
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
| METHODS |
|---|
|
|
|---|
Generation of virus genome and virus stocks.
A reporter tag, S-Tag, was cloned into the open reading frame of CVB3/28 (Tracy et al., 2002
) to allow ready detection of infected cells. S-Tag is a 15 aa sequence with high affinity for the RNase S protein that can be used for purification and detection of proteins to which it is fused (Raines et al., 2000
). The infectious CVB3 cDNA genome encoding S-Tag was generated by using a subcloned fragment of an infectious genome of CVB3 containing a polylinker sequence in the region between the VP1- and 2Apro-encoding sequences (Chapman et al., 2000
; Hofling et al., 2000
). The polylinker was flanked by sequences encoding the VP1/2Apro cleavage site in which the 3' sequence was altered to have 70 % nucleotide sequence identity with the upstream site (Chapman et al., 2000
; Hofling et al., 2000
). Overlapping oligonucleotides (STAGPCR1, 5'-CGCGTGATCAAGGAGGCGGTAAAGAAACCGCAGCCGCTAAATTC; STAGPCR2, 5'-CGGCAGATCTCCGCTGTCCATGTGCTGGCGTTCGAATTTAGCGGCTGCG) encoding the peptide tag were filled in, and cloned into the BamHI site of the polylinker by using encoded BamHI and BglII sites. The subclone was then ligated into the full-length infectious cDNA genome of CVB3/28, using BglII and XbaI sites unique in that genome.
To generate progeny chimeric CVB3-S-Tag virions, 2 µg pCVB3-PL2-S-Tag DNA was transfected into 106 monolayer HeLa cells by using an Effectene transfection reagent kit (Qiagen) according to the manufacturer's protocol. Three days post-transfection, cultures were frozen and thawed three times and cleared of cell debris by centrifugation (4500 g for 30 min). Lysate was used to infect 2x107 HeLa cells, which were then incubated until all cells were lysed (virus passage 2). This cell lysate was cleared of cell debris as before. Passages of CVB3-S-Tag were performed similarly, with infected cells incubated at 37 °C for 72 h or until >95 % of cells showed cytopathic effect (CPE), followed by freeze–thaw lysis and centrifugation as described above. Titre was determined as TCID50 on HeLa monolayers (Tracy et al., 1992
) and aliquots were stored at –74 °C. The same process was used to generate stocks of the parental CVB3/28 and CVB3/0 viruses from infectious cDNA cloned in a plasmid (Tracy et al., 2002
; Tu et al., 1995
). CVB3/0 and CVB3/28 differ at a single nucleotide position (nt 234), a site affecting cardiovirulence, but not replication in cell cultures of permissive cells.
To generate green fluorescent protein (GFP)-expressing virus (CVB-GFP), a subclone of pCVB3/28 (Tracy et al., 2002
), pBSPL3, with a polylinker sequence in the region between the initiation codon and the capsid-encoding region, was generated with a sequence encoding the VP1/2Apro cleavage site after the polylinker. PL3Overlap1 and 2 (5'-GAGCTATTATATATCTCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTG; 5'-GTTAACCTAGGATCCGAGACGGAGTTTTGCGCGCCCATTTTGCTGTATTCAACTTAACAATGAATTGTAATGTTTTAACC) were annealed and filled in with Vent polymerase (New England Biolabs). This product was amplified with PL3PCR1 (5'-GGATTGGCCATCCGGTGACCAATAGAGCTATTATATATCTCTTTGTTGG) and PL3PCR2 (5'-GATACTTGAGCTCCGGTGTTAGTCATAGTTGTAATCCTGCAGGTTAACCTAGGATCCGAGACGGAGTTTTG).
The SacI and BstEII fragment of this product was ligated into the BstEII and SacI sites of a subclone of CVB3/28 (pBSCVB3NotXho) containing nt 1–2011. To generate a cDNA genome encoding the GFP sequence in the open reading frame, the GFP sequence was amplified from nt 292 to 1005 of pEGFP (Zolotukhin et al., 1996
) using primers encoding BamHI and PstI sites (GFPFOR, 5'-GCAGTCTCGGATCCTGTGAGCAAGGGCGAGGAG; GFPREV, 5'-GTAGTCCTGCAGCTCTTGTACAGCTCGTCCATGCC). The BamHI–PstI fragment was ligated into the pBSPL3 polylinker BamHI and SbfI sites. The NotI–XhoI fragment of the subclone was then ligated into the full-length infectious cDNA genome of CVB3/28 (Tracy et al., 2002
) by using these sites.
To generate CVB3 virus encoding this protein tag, 2 µg pCVB3-PL3-GFP was transfected into HeLa cells and progeny virus was harvested as described above for CVB3-S-Tag.
S protein detection and stability.
HeLa cell monolayers on glass slides were inoculated with CVB3-S-Tag at an m.o.i. of 25, then incubated at 37 °C for 6 h. Slides were rinsed in PBS, fixed in cold 1 : 1 acetone : methanol for 15 min, rinsed in PBS and incubated in a 1 : 2000 dilution of S protein–horseradish peroxidase (HRP) conjugate (EMD Biosciences, Inc.) and rinsed with PBS. The reaction product was visualized by using Hanker Yates reagent (Polysciences). Slides were counterstained lightly with Mayer's haematoxylin. For Western blots of infected HeLa cells at 4 and 8 h post-inoculation (p.i.), culture medium was removed and cells were lysed in 2x Laemmli buffer (Laemmli, 1970
) containing 2-mercaptoethanol, and processed as described previously (Chapman et al., 2000
), using S protein–HRP to probe for S-Tag. To assay the maintenance of the S-Tag-encoding sequence in the CVB3 genome, CVB3-S-Tag was passaged serially 10 times in HeLa monolayers and viral RNA was assayed for the presence of insert by RT-PCR using flanking primers (ID9 and ID10; Chapman et al., 2000
). No deletion was seen in 10 passages of the virus, indicating a very high degree of stability for this insert.
Flow cytometry.
For detection of CVB-expressed S-Tag, RD, RD-HCAR or HeLa cells, with or without CVB3, were collected by brief incubation in PBS containing 5 % trypsin and 20 µM EDTA. The cells were washed once by centrifugation (3500 r.p.m. for 2 min in a Dade Immunofuge II) with PBS containing 0.1 % NaN3 and 5 % BSA (PBS/NaN3/BSA), resuspended in 1 ml PBS/NaN3/BSA, counted and aliquotted at 0.5x106 into 5 ml plastic test tubes. The cells were then stained with S protein–fluorescein isothiocyanate (FITC) (Novagen/EMD Biosciences) using permeabilization reagents from Caltag Laboratories according to the manufacturer's specifications. S protein–FITC was utilized at a 1 : 2000 dilution during the permeabilization step. Cells were washed and resuspended in 0.5 ml PBS for analysis. Cells cultured in the absence of CVB were utilized as a negative control for S-Tag binding.
CAR was detected by using the Rmcb monoclonal antibody (mAb) (Hsu et al., 1988
). RD and HeLa cells were detached from the plastic by incubation in PBS containing 20 µM EDTA for 20 min at 4 °C, followed by gentle vortexing to release the cells. The cells were washed once by centrifugation (3500 r.p.m. for 2 min in a Dade Immunofuge II) with PBS/NaN3/BSA, resuspended in 1 ml PBS/NaN3/BSA, counted and aliquotted at 0.2x106 into 5 ml plastic test tubes in 200 µl PBS/NaN3/BSA. Cells were incubated with or without 5 µg Rmcb antibody for 30 min at 25 °C. The cells were washed once with 1 ml PBS/NaN3/BSA and then incubated with 200 µl goat anti-mouse FITC F(ab')2 (Sigma-Aldrich) at a 1 : 500 dilution in PBS/NaN3/BSA for 30 min at 25 °C. The cells were washed and resuspended in 0.5 ml PBS for analysis. Cells prepared in the absence of primary antibody were utilized as a negative control for Rmcb binding.
Flow cytometry was performed by using a Beckman Coulter FC500 flow cytometer run with Beckman Coulter CXP software. The negative-control cells were utilized to assign photomultiplier and amplifier settings so that negative-control cell fluorescence was situated in the first decade of the four-decade fluorescence scale. Percentage positivity for the S-Tag- or Rmcb-positive cells was determined by subtraction of the percentage of negative-control cells using a linear gate on the FITC fluorescence axis. Approximately 10 000 cell events were counted for each sample.
Western blot detection of CAR.
Octylglucoside cell lysates were prepared as described previously (Carson et al., 1999
). Proteins were separated by electrophoresis on 10–15 % polyacrylamide gels (Laemmli, 1970
) and transferred to Immobilon-P membranes (Millipore) for 1 h at 12 V. Membranes were blocked with 6 % (w/v) powdered milk in 0.05 M Tris, 0.1 M NaCl, pH 7.6, with 0.1 % Tween 20. CAR was detected by using mAb E1.2D3 (Carson et al., 1999
) and HRP-conjugated bovine anti-mouse immunoglobulins (Santa Cruz). Blots were developed with Femtoglow ECL reagent (Michigan Diagnostics). Exposed films were photographed with a Canon 10D digital camera and processed in Adobe Photoshop.
RT-PCR.
Viral genomes were assayed for the presence of the S-Tag sequence by using primers flanking the inserted polylinker (ID9 and ID10) (Chapman et al., 2000
). Viral genomic RNA from chimeric virus stocks from each passage was isolated by using Trizol LS reagent (Invitrogen) according to the manufacturer's instructions. cDNA was transcribed from total cellular RNA with SuperScript II reverse transcriptase (Invitrogen) and primer ID10 essentially as described previously (Chapman et al., 2000
), followed by PCR amplification with Taq polymerase (Promega) with both primers. cDNA from insert-containing genomes generates a 574 bp fragment, and revertants to wild-type (passage of CVB3 viruses with inserts at this site causes recombination, deleting both insert and polylinker; Hofling et al., 2000
) generate a 344 bp fragment.
Determination of CAR RNA copy number by quantitative RT-PCR.
T7 RNA polymerase (positive-sense) transcripts were synthesized from a NotI-digested plasmid containing nt 119–899 (numbering as in GenBank accession no. NM_001338) of human CAR cDNA cloned in the pTracer plasmid (Invitrogen). Transcripts were treated with RNase-free DNase I (Ambion), collected by ethanol precipitation and quantified spectrophotometrically. RNA was prepared from monolayers by using a mini RNA isolation II kit (Zymo Research Corporation). An aliquot of the cells was used for enumeration. cDNA was synthesized from RNA annealed to HMCAR1 (5'-ACCTGAAGGCTTAACAAGAA, reverse complement of nt 528–547) in 20 µl reactions containing 1 U ImProm-II reverse transcriptase (Promega) and 1 U RNasin (Promega) in ImProm-II buffer supplemented with 3 mM MgCl2 and 0.5 mM dNTPs for 1 h at 42 °C. Real-time quantitative PCR was performed essentially as described previously (Kim et al., 2005
) using cDNA reactions diluted fivefold with water so that 10 % of a reverse transcription reaction volume was used with HMCAR1 and HMCAR2 (5'-AGTCCCGAAGACCAGGGACC, nt 254–273) at 0.125 OD260 units ml–1 in DyNAmo SYBR green qPCR mix (Finnzyme) according to the manufacturer's instructions. Cycling times were as follows: one cycle at 95 °C for 15 min; 45 cycles at 95 °C for 20 s, 55 °C for 20 s and 72 °C for 20 s; and a final extension at 72 °C for 10 min. To generate a standard curve, quantitative PCRs were carried out with cDNA from defined quantities of T7 transcripts of CAR plasmid by using an Opticon 2 DNA engine (MJ Research). The equation of the standard curve is y=–0.2795x+9.523 (where y is the log of the number of RNA molecules and x is the critical threshold cycle, Ct). CAR Ct was determined for each cellular RNA sample and numbers of CAR RNA molecules were determined based on the standard curve.
| RESULTS |
|---|
|
|
|---|
|
|
|
Considering the detection of CAR in RD cells and the absence of overt CVB CPE, it was important to assess the cellular distribution of replicating CVB. Although it is possible to use viral antigens to follow infection by immunochemical methods (e.g. Schmidtke et al., 2000
; Shieh & Bergelson, 2002
), CVB3 engineered to express S-Tag provided a direct method to detect virus replication with a single reagent (e.g. FITC-labelled S protein). We used S-Tag-expressing CVB3 and flow cytometry to compare the infection of HeLa, RD-HCAR and RD cells over time. As cells can round up and be released from the monolayer during mitosis or in the early stages of viral CPE, floating and adherent cells were combined and analysed for S-Tag expressed by replicating CVB. At 13 h p.i., S-Tag was detected in >30 % of the HeLa cells. This is consistent with previous reports of cell-cycle influences on receptor availability and viral replication (Feuer et al., 2002
; Seidman et al., 2001
). S-Tag was also detected in >30 % of RD-HCAR cells at 13 h p.i. (Fig. 4a
), suggesting similar kinetics for virus-dependent S-Tag expression, even though CAR in these cells was expressed under the control of the cytomegalovirus promoter. Remarkably, S-Tag was detected in 4 % of the RD cells at 13 h p.i. (Fig. 4c
). As anticipated from results in Fig. 1
, at 24 h p.i., few HeLa cells remained adherent and too few intact floating cells were available for analysis. S-Tag was detected in nearly 50 % of the RD-HCAR cells that remained intact (Fig. 4b
). S-Tag was detected in 6 % of the RD cells, most of which remained adherent at 24 h p.i. (Fig. 4d
). At 48 h p.i., S-Tag was detected in 11 % of the RD cells (not shown). There is no argument that 4 % is different from 11 % in this experiment (i.e. the range is 4–11 % of RD cells infected over 48 h and the mean is 7 %). In one experiment (K.-S. Kim & S. D. Carson, unpublished data), levels of CAR mRNA did not differ in RD cells compared with RD cells that had been incubated with CVB for 24 h, indicating that exposure to virus did not induce CAR transcription.
|
In one experiment, medium from RD cells cultured in 25 cm2 flasks, with and without CVB, was sampled and assayed for lactate dehydrogenase. At 24 and 48 h after inoculation (2x108 CVB3/28), medium contained 484 and 740 IU ml–1, respectively. Samples from uninfected RD cultures contained LDH at 299 and 294 IU ml–1. This result indicates that, as with RD cells engineered to express CAR (Cunningham et al., 2003
), CVB-infected wild-type RD cells are also lysed, although the RD monolayer was confluent when sampled at 48 h.
To confirm that CVB was infecting the RD cells via CAR, HeLa and RD cells were inoculated with CVB after addition of the anti-CAR mAb Rmcb, which inhibits CAR-mediated infection (Hsu et al., 1988
), or mAb E1.2D3, which binds CAR on Western blots but does not block infection (Carson et al., 1999
), and compared with cells inoculated with virus without antibody (Fig. 5
). At 20 h p.i., the 70 % of untreated HeLa cells that were infected by CVB3-S-Tag (Fig. 5a
) was reduced to nearly 7 % by Rmcb (Fig. 5b
). S-Tag was not detected in any RD cells when Rmcb was present (Fig. 5e
), compared with in 4 % of cells infected in in the absence of Rmcb (Fig. 5d
). As expected, the control mAb had no notable effect on infection of either cell line (Fig. 5c, f
). These results were reproduced qualitatively by using CVB3-GFP (Fig. 5
, insets). RD infection by CVB3-S-Tag or CVB-GFP was clearly mediated by binding of virus to CAR, to which Rmcb provided an effective blockade.
|
| DISCUSSION |
|---|
|
|
|---|
Various studies have failed to detect CAR in RD cells. Tomko et al. (1997)
detected no CAR on Northern blots; Cunningham et al. (2003)
failed to detect CAR in RD cells by Western blot, yet reported CVB3 replication similar to that shown in Fig. 1(b)
. Polacek et al. (2005)
selected a strain of CVB2 (which does not bind DAF) for growth in RD cells but, using flow cytometry, they also failed to detect CAR in RD cells. Indeed, passage of multiple CVB serotypes in RD cells, as well as persistent RD infection by CVB5, were reported many years ago (Argo et al., 1992
; Reagan et al., 1984
) and studies of clinical samples have reported CVB replication in RD cells (e.g. 4–11 % of CVB1–6 isolates caused CPE in RD cells; She et al., 2006
). How these infections are initiated in the apparent absence of CAR has remained inadequately explained, although the alternative-receptor rationale is convenient.
Serial passage of CVB in RD cells can result in selection for a DAF-binding CVB strain that replicates in RD cultures with CPE (Bergelson et al., 1995
, 1997
; Reagan et al., 1984
). Bergelson et al. (1997)
suggested that receptor binding can vary among CVB isolates, and may evolve within infected tissues or cultured cells. This raises the possibility that each CVB inoculum may contain viruses with a spectrum of capacities for binding alternative receptors, including DAF, and which experience selection for receptor usage most successful with the current host. This is quite feasible, as quasispecies mutant swarms are diverse by definition (Domingo et al., 2006
). If chance brings together a viral strain that can bind a receptor different from that of the dominant quasispecies population, this could lead both to successful infection and propagation of a potentially newly adapted viral strain. Even though the derivation of DAF-binding CVB strains validates the argument, the event selecting for use of alternative receptors must be rare, as the RD monolayers survived, often reaching confluence in competition with multiple CVB replication cycles and high viral yields (e.g. Fig. 1
).
Our results show that the perceived absence of CAR in RD cells is due to prior use of insufficiently sensitive methods. Compared with HeLa and other highly permissive cells, RD cell cultures can be considered to be relatively, but not absolutely, CAR-deficient. As Rmcb blocked S-Tag and GFP expression in the RD cultures inoculated with tagged CVB, it must be the CAR-positive RD cells that are permissive to at least the initial CVB infection. Expression of CAR in RD cells passed at 3–5 day intervals before reaching confluence, rather than at high density (Shafren et al., 1997
), is low and difficult to detect (e.g. Fig. 3
; Cunningham et al., 2003
; Polacek et al., 2005
). The RT-PCR presents a quantitative measure of the level of CAR mRNA per cell at a fixed time point. By assuming transcription of only a single CAR mRNA molecule per cell, at most 1 in 400 RD cells could have been translating new CAR protein. Flow cytometry detected CVB-expressed S-Tag in 7 % of RD cells on average at 13, 24 and 48 h after inoculation.
CAR expression must be transient in most of the RD cells. Assuming that CVB infects cells as they present CAR, and that infected cells detected at previous time points had been lysed and were not resampled, CAR-dependent infection of 7 % of RD cells, in which CAR mRNA is expressed by no more than 0.25 %, requires that cells expressing CAR protein exceed those expressing CAR mRNA by at least 28-fold. This could be accomplished if the CAR protein persists 28 times longer than the mRNA is expressed. Trypsin-treated HeLa cells remove cleaved CAR within about 15 h of trypsin treatment (Carson, 2000
) and glycosylated CAR has been observed after 24 h tunicamycin treatment of CAR-expressing COS cells (Excoffon et al., 2007
), showing that CAR protein may be turned over very slowly. Assuming a comparable rate of CAR removal for RD cells (e.g. 15–30 h), CAR mRNA expression for 30–60 min in 0.25 % of the cells could provide a population in which about 7 % of cells expressed CAR protein in a steady state. The number of CAR-expressing RD cells may vary among experiments, influenced by cell density (Shafren et al., 1997
) or by as-yet-undiscovered environmental factors. It appears that RD cells throughout the culture may up- and downregulate CAR expression continuously.
From these results, it is clear that the reported failure to detect CAR does not preclude low-level expression, especially for cell lines and tissues that have been shown to replicate CVB or adenoviruses that utilize CAR. In culture systems, despite extremely low levels of CAR, high titres of virus may accumulate and remain available to infect the cells as they transiently express CAR. Mutant viruses should also accumulate, while the majority of the cells in the culture remain uninfected and viable. This presents an opportune environment for in vitro selection of viruses able to exploit alternative receptors and to outcompete the CVB waiting for the next CAR to be offered.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bergelson, J. M., Mohanty, J. G., Crowell, R. L., St John, N. F., Lublin, D. M. & Finberg, R. W. (1995). Coxsackievirus B3 adapted to growth in RD cells binds to decay accelerating factor (CD55). J Virol 69, 1903–1906.
Bergelson, J. M., Modlin, J. F., Wieland-Alter, W., Cunningham, J. A., Crowell, R. L. & Finberg, R. W. (1997). Clinical coxsackievirus B isolates differ from laboratory strains in their interaction with two cell surface receptors. J Infect Dis 175, 697–700.[Medline]
Carson, S. D. (2000). Limited proteolysis of the coxsackievirus and adenovirus receptor (CAR) on HeLa cells exposed to trypsin. FEBS Lett 484, 149–152.[CrossRef][Medline]
Carson, S. D. (2004). Coxsackievirus and adenovirus receptor (CAR) is modified and shed in membrane vesicles. Biochemistry 43, 8136–8142.[CrossRef][Medline]
Carson, S. D., Hobbs, J. T., Tracy, S. M. & Chapman, N. M. (1999). Expression of the coxsackievirus and adenovirus receptor in cultured human umbilical vein endothelial cells: regulation in response to cell density. J Virol 73, 7077–7079.
Chapman, N. M., Kim, K. S., Tracy, S., Jackson, J., Hofling, K., Leser, J. S., Malone, J. & Kolbeck, P. (2000). Coxsackievirus expression of the murine secretory protein interleukin-4 induces increased synthesis of immunoglobulin G1 in mice. J Virol 74, 7952–7962.
Cunningham, K. A., Chapman, N. M. & Carson, S. D. (2003). Caspase-3 activation and ERK phosphorylation during CVB3 infection of cells: influence of the coxsackievirus and adenovirus receptor and engineered variants. Virus Res 92, 179–186.[CrossRef][Medline]
Domingo, E., Martin, V., Perales, C., Grande-Perez, A., Garcia-Arriaza, J. & Arias, A. (2006). Viruses as quasispecies: biological implications. Curr Top Microbiol Immunol 299, 51–82.[Medline]
Excoffon, K. J. D. A., Gansemer, N., Traver, G. & Zabner, J. (2007). Functional effects of coxsackievirus and adenovirus receptor glycosylation on homophilic adhesion and adenoviral infection. J Virol 81, 5573–5578.
Feuer, R., Mena, I., Pagarigan, R., Slifka, M. K. & Whitton, J. L. (2002). Cell cycle status affects coxsackievirus replication, persistence, and reactivation in vitro. J Virol 76, 4430–4440.
Hofling, K., Tracy, S., Chapman, N., Kim, K. S. & Leser, J. S. (2000). Expression of an antigenic adenovirus epitope in a group B coxsackievirus. J Virol 74, 4570–4578.
Hsu, K. H., Lonberg-Holm, K., Alstein, B. & Crowell, R. L. (1988). A monoclonal antibody specific for the cellular receptor for the group B coxsackieviruses. J Virol 62, 1647–1652.
Kim, K. S., Tracy, S., Tapprich, W., Bailey, J., Lee, C. K., Kim, K., Barry, W. H. & Chapman, N. M. (2005). 5'-Terminal deletions occur in coxsackievirus B3 during replication in murine hearts and cardiac myocyte cultures and correlate with encapsidation of negative-strand viral RNA. J Virol 79, 7024–7041.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685.[CrossRef][Medline]
Polacek, C., Ekstrom, J.-O., Lundgren, A. & Lindberg, A. M. (2005). Cytolytic replication of coxsackievirus B2 in CAR-deficient rhabdomyosarcoma cells. Virus Res 113, 107–115.[CrossRef][Medline]
Raines, R. T., McCormick, M., Van Oosbree, T. R. & Mierendorf, R. C. (2000). The S.Tag fusion system for protein purification. Methods Enzymol 326, 362–376.[CrossRef][Medline]
Reagan, K. J., Goldberg, B. & Crowell, R. L. (1984). Altered receptor specificity of coxsackievirus B3 after growth in rhabdomyosarcoma cells. J Virol 49, 635–640.
Schmidtke, M., Selinka, H.-C., Heim, A., Jahn, B., Tonew, M., Kandolf, R., Stelzner, A. & Zell, R. (2000). Attachment of coxsackievirus B3 variants to various cell lines: mapping of phenotypic differences in capsid protein VP1. Virology 275, 77–88.[CrossRef][Medline]
Seidman, M. A., Hogan, S. M., Wendland, R. L., Worgall, S., Crystal, R. G. & Leopold, P. L. (2001). Variation in adenovirus receptor expression and adenovirus vector-mediated transgene expression at defined stages of the cell cycle. Mol Ther 4, 13–21.[CrossRef][Medline]
Shafren, D. R., Williams, D. T. & Barry, R. D. (1997). A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells. J Virol 71, 9844–9848.
She, R. C., Crist, G., Billetdeaux, E., Langer, J. & Petti, C. A. (2006). Comparison of multiple shell vial cell lines for isolation of enteroviruses: a national perspective. J Clin Virol 37, 151–155.[CrossRef][Medline]
Shieh, J. T. C. & Bergelson, J. M. (2002). Interaction with decay-accelerating factor facilitates coxsackievirus B infection of polarized epithelial cells. J Virol 76, 9474–9480.
Tomko, R. P., Xu, R. & Philipson, L. (1997). HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc Natl Acad Sci U S A 94, 3352–3356.
Tracy, S., Chapman, N. M. & Tu, Z. (1992). Coxsackievirus B3 from an infectious cDNA copy of the genome is cardiovirulent in mice. Arch Virol 122, 399–409.[CrossRef][Medline]
Tracy, S., Drescher, K. M., Chapman, N. M., Kim, K. S., Carson, S. D., Pirruccello, S., Lane, P. H., Romero, J. R. & Leser, J. S. (2002). Toward testing the hypothesis that group B coxsackieviruses (CVB) trigger insulin-dependent diabetes: inoculating nonobese diabetic mice with CVB markedly lowers diabetes incidence. J Virol 76, 12097–12111.
Tu, Z., Chapman, N. M., Hufnagel, G., Tracy, S., Romero, J. R., Barry, W. H., Zhao, L., Curry, K. & Shapiro, B. (1995). The cardiovirulent phenotype of coxsackievirus B3 is determined at a single site in the 5' nontranslated region. J Virol 69, 4607–4618.
Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J. & Muzyczka, N. (1996). A 'humanized' green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J Virol 70, 4646–4654.
Received 13 November 2006;
accepted 23 July 2007.
This article has been cited by other articles:
![]() |
O. Heikkila, P. Susi, G. Stanway, and T. Hyypia Integrin {alpha}V{beta}6 is a high-affinity receptor for coxsackievirus A9 J. Gen. Virol., January 1, 2009; 90(1): 197 - 204. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |