| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 CSIRO Livestock Industries, Australian Animal Health Laboratory, East Geelong, Victoria 3220, Australia
2 Northern Territory Department of Primary Industries, Fisheries and Mines, Berrimah Veterinary Laboratories, Berrimah, Northern Territory 0801, Australia
Correspondence
Chris Cowled
chris.cowled{at}csiro.au
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
The GenBank/EMBL/DDBJ accession numbers for the novel sequences reported in this article are EF591620 and EF591621.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Viruses previously unknown in Australia, such as bluetongue virus (BTV) serotypes 3, 9, 15, 16 and 23 (Gard et al., 1985, 1987a, b), have emerged on several occasions. These introductions are thought to be from countries located to the north and west of Australia, possibly by the prevailing winds during the monsoon season carrying infected insects to the Australian mainland (St George, 1992). The emergence of new viruses or introduction of exotic viruses poses a threat to animal health in Australia, and arbovirus activity is monitored by using a system of sentinel cattle herds known as the National Arbovirus Monitoring Program (NAMP, 2006). NAMP's critical role in BTV monitoring has led to the adoption of virus-isolation protocols biased towards members of the genus Orbivirus.
The genus Orbivirus is one of 12 genera of the family Reoviridae, which includes 21 recognized species and 11 proposed species that are distributed worldwide (Mertens et al., 2004). Several species are known to cause serious disease in animals, and orbivirus infections associated with human disease have been documented (Libiková et al., 1978). Known vectors of orbiviruses include Culicoides midges, mosquitoes, phlebotomine sandflies and ticks (Roy, 2007). Orbivirus genomes consist of 10 segments of double-stranded RNA (S1–S10, largest to smallest), encased within a protein shell called the core, which is covered by a second protein layer called the outer capsid. The seven structural and three non-structural proteins are frequently referred to as VP1–VP7 and NS1–NS3, respectively, based on their order of migration on SDS-PAGE gels or as predicted from sequence data. VP2 and VP3 are reversed in some species as a result of this.
The outer capsid is made up of major outer capsid protein (VP2 or VP3), which is exposed on the virion surface and determines receptor specificity and cell entry, and minor outer capsid protein (VP5). The core layer consists of major subcore protein (VP2 or VP3, also known as T2), which binds genomic RNA and plays a role in T=2 symmetry, and core surface protein (VP7). The three proteins present at low levels inside the core are RNA-dependent RNA polymerase (VP1), capping enzyme (VP4) and helicase (VP6). The non-structural proteins are tubule protein (NS1), inclusion body protein (NS2) and virus release protein (NS3, NS3A) (Mertens et al., 2004).
As described, T2 can be assigned as VP2 or VP3 in different species, depending on whether it is encoded on the second-largest RNA segment, S2, or the third largest, S3. Orbiviruses in which T2 is VP2 cluster separately in phylogenetic analysis from those in which T2 is VP3 (Attoui et al., 2005). The coding strands of all 10 genomic RNA segments are 5'-capped and methylated and all segments have conserved terminal sequences believed to be crucial for genome replication and packaging (Rao et al., 1983; Roy, 2007). Direct evidence of this is lacking for orbiviruses, but has been reported for other members of the family Reoviridae. For example, a recombinant gene segment can be incorporated into the genome of reoviruses, but only if it contains 96 nt from the 5' end and 98 nt from the 3' end of the wild-type segment (Roner & Steele, 2007). Studies of rotavirus in cell-free systems have identified elements within the highly conserved terminal sequences essential for effective negative-strand RNA synthesis in vitro (Wentz et al., 1996).
The T2 gene is highly conserved and is typically used for phylogenetic comparison of different species within the genus Orbivirus. Attoui et al. (2001) suggested a cut-off point of 91 % similarity in the amino acid sequence of T2 for species determination. Conversely, the least-conserved gene encodes the dominant outer capsid protein, which has been used for phylogenetic analysis of variation within a species (Potgieter et al., 2003; Maan et al., 2007).
During the 1990s, viruses began to emerge through NAMP that could not be identified by conventional serology and, by 2006, almost one-third of all viruses isolated in the Northern Territory were unable to be identified. One of these isolates (DPP4440) was isolated from a healthy cow in May 1998 at around the time that these viruses first started to appear, and was believed to be a novel Australian virus. We have confirmed this by genetic sequencing and epidemiological studies, and suggest the name Middle Point orbivirus (MPOV).
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Electron microscopy.
Infected BSR cells were scraped from the culture surface and pelleted in a bench centrifuge (2000 g) prior to being fixed with 2.5 % (v/v) glutaraldehyde in 0.1 M sodium phosphate buffer (pH 7.2) adjusted to 300 mOsmol kg–1 with sucrose (approx. 4 %) for 1 h. Cell pellets were then washed in the same buffer (3x20 min) and post-fixed (1 h) in 1 % (w/v) osmium tetroxide in the same buffer, then rinsed (3x5 min) in MilliQ water. Pellets were dehydrated in a graded series of ethanol (70, 95 and 100 %, 20 min each), followed by 20 min in absolute dry ethanol. Samples were then infiltrated with and embedded in Spurr's resin and polymerized at 65 °C overnight. Ultrathin (75–95 nm thick) sections were collected onto 200-mesh parlodion-coated copper grids, contrasted with uranyl acetate (saturated solution in 50 % ethanol) and Reynolds lead citrate, pH 12 (0.08 M lead nitrate, 0.12 M sodium citrate), and examined in a Hitachi H7000 transmission electron microscope at 75 kV.
RNA extraction.
Total RNA was purified from tissue-culture supernatant (TCSN) harvested at late-stage CPE. Supernatants were decanted from flasks and centrifuged at 300 g for 10 min at 4 °C to pellet cell debris. Clarified supernatants were centrifuged at 100 000 g for 90 min at 4 °C to pellet virions. RNA was then extracted by using an RNeasy mini kit (Qiagen) following the manufacturer's instructions and quantified by using a GeneQuant II DNA/RNA calculator (Pharmacia).
PCR-Select suppression subtractive hybridization (PCR-Select).
Total MPOV RNA from TCSN (the ‘tester’) was analysed by using a PCR-Select cDNA subtraction kit (Clontech) following the manufacturer's instructions, but with changes as detailed below. For the ‘driver’, we used total RNA from BTV 1 (Australia) cultivated in BSR cells. Briefly, RNA from both tester and driver samples was converted into double-stranded cDNA and digested with RsaI. Tester cDNA was divided into two portions and each portion was 5'-labelled with one of two oligonucleotide adaptors. In the first of two hybridization steps, a large excess of unlabelled driver was mixed with each of the two labelled tester populations. The mixtures were then heat-denatured and allowed to anneal. In the second hybridization, the two primary hybridization products were combined (without further denaturation) and allowed to anneal overnight in the presence of more denatured driver. In the resulting mixture, only those sequence fragments unique to the tester produced double-stranded cDNA hybrids with different adaptors at each end. The overhanging ends were then filled in and followed by two rounds of PCR amplification with Advantage II DNA polymerase (Clontech) to generate a cDNA library highly enriched with fragments of the MPOV genome (Diatchenko et al., 1996).
The cDNA-synthesis procedure was modified for double-stranded tester and driver RNA as follows: 2 µg RNA was combined with 0.5 µl random-hexamer oligonucleotide (1.5 µg ml–1; GeneWorks) and 0.5 µl formamide in a total volume of 5 µl. This mixture was denatured at 100 °C for 1 min in a heat block, chilled rapidly on ice and then used in a 10 µl reverse transcription reaction, following the PCR-Select kit instructions.
Cloning.
The enriched cDNA library generated by cDNA subtraction was treated with DNA polymerase I–Klenow large fragment (New England Biolabs) to generate blunt ends and then ligated into the PCR-Blunt-II-TOPO vector and electroporated into OneShot TOP-10 Escherichia coli by using a Zero-Blunt-II-TOPO PCR cloning kit (Invitrogen). Transformants were grown on Luria–Bertani (LB) agar plates supplemented with 50 µg kanamycin ml–1 (Gibco). Colonies were picked at random and grown overnight in 5 ml cultures for plasmid DNA isolation using a Qiagen spin miniprep kit.
5'–3' ligation RACE (rapid amplification of cDNA ends).
5'–3' ligation RACE was carried out following the method of Mandl et al. (1991). Briefly, tobacco acid pyrophosphatase (Epicentre Biotechnologies) was used to remove the 5'-cap structure from 2 µg RNA, and T4 RNA ligase (New England Biolabs) was used to circularize the RNA. The reaction was carried out overnight at 4 °C, then phenol/chloroform-extracted and ethanol-precipitated. Circular RNA was resuspended in 2 µl RNase-free H2O, combined with 1 µl formamide, denatured at 100 °C for 1 min in a heat block and then chilled on ice. The denatured RNA was then used in a 20 µl reverse transcription reaction containing 200 units Stratascript reverse transcriptase (Stratagene) and 20 units RNase inhibitor (Invitrogen). This was followed by two rounds of PCR, using nested primers designed by using sequence obtained through the PCR-Select cDNA subtraction method. Secondary PCR products were cloned and sequenced with a vector-specific primer.
Sequencing and sequence analysis.
PCR products and plasmids were sequenced by using ABI BigDye Terminator sequencing reagents and an ABI Prism DNA sequencer (Perkin Elmer). Sequencing primers were obtained from GeneWorks. DNA sequences were trimmed and assembled by using SeqMan (version 7; Lasergene, DNASTAR). Sequences were identified by using the online BLAST search engine (http://www.ncbi.nlm.nih.gov/BLAST/). PCR primers and sequencing primers were designed by using Clone Manager (version 8; SciEd Software). Multiple sequence alignments were created by using CLUSTAL W (Thompson et al., 1994) and a phylogenetic tree was prepared by using the distance-matrix and neighbour-joining method in PHYLIP software BioManager by ANGIS (http://www.angis.org.au) and TreeView (Page, 1996). Amino acid sequences were analysed by using PredictProtein (http://www.predictprotein.org/) (Rost et al., 2004).
Real-time PCR.
Real-time PCR was carried out on a Corbett Rotorgene 6000 real-time PCR machine, using a SYBR green One-Step RT-PCR kit (Invitrogen), targeting a 151 bp region of the conserved T2 gene sequence (segment 2, bp 987–1137). HPLC-purified virus-specific primers were obtained from GeneWorks (forward primer, AATGCGGCCTTAGGATTTCC; reverse primer, TTCGAACATCCGCCATGAC) and used at a final concentration of 250 nM each. A mastermix containing enzymes, SYBR green reagent and primers was prepared on ice. For each sample, total RNA was extracted from 100 µl infected TCSN by using a Qiagen RNeasy mini kit and eluted in 30 µl H2O. RNA (5 µl) was denatured at 100 °C for 1 min in a heat block, then combined with 15 µl mastermix on ice. Cycling parameters were 50 °C for 3 min, 95 °C for 5 min, 40 cycles of 95 °C for 15 s, followed by 60 °C for 30 s. Melt-curve analysis was performed, including a 90 s pre-melt step at 37 °C.
Virus-neutralization test (VNT).
Serum samples were initially diluted 1 : 4 in cell-culture medium. Aliquots (50 µl) of diluted serum were placed into duplicate wells of 96-well flat-bottom tissue-culture plates and combined with 50 µl virus pre-titrated to contain 100 TCID50 or culture medium only (serum control). Plates were then incubated at 37 °C and 5 % CO2 for 1 h. BSR cell suspension (100 µl) containing 2x105 cells ml–1 was added to every well and plates were returned to the incubator. Back-titration of the pre-titrated virus was performed on a control plate and the test was read when the control plate read 100 TCID50 (at 5 days post-infection). Positive sera were titrated in duplicate using serial 2-fold dilutions and titres were defined as the reciprocal of the highest dilution causing complete inhibition of CPE.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Virus particles of 64±4 nm (n=16) in diameter were observed in the cytoplasm and extracellular spaces. Within the cytoplasm, viruses were observed as individual particles associated with prominent, semi-electron-dense inclusion bodies (VIBs) (Fig. 1a). The VIBs varied in size, were of irregular appearance and density and had a matrix that was both fibrillar and granular. Viruses were associated along the periphery and within the matrix. Within the cytoplasm, individual viruses were not associated with vesicles or any membrane systems. Viruses appeared as double-shelled particles with electron-dense cores (24±3 nm, n=12) and, in some profiles, revealed an icosahedral symmetry (Figs 1a, b). Low numbers of putative viral tubules (20±2 nm in diameter, n=6) were observed in randomly arranged bundles in the cytoplasm (Fig. 1d).
|
). Fragments ranged in size from approximately 100 to 1500 bp in length. BLAST searches on these fragments showed high similarity to the recently described Yunnan orbivirus (YUOV) (Attoui et al., 2005). The most- and least-conserved genes (encoding T2 and major outer capsid protein, respectively) were then sequenced fully. Gaps between fragments were filled in by PCR, and the 5'–3' ligation method of Mandl et al. (1991) was used to obtain the end sequences. The entire sequence of both gene segments was confirmed by PCR, with a minimum of 2-fold coverage in both directions.
|
). One large open reading frame (ORF) of 2820 bases, encoding a protein of 940 aa, was identified in the coding strand. Two additional ORFs, 131 and 104 aa in length, were observed in the complementary strand of MPOV segment 2; however, neither of these is present in YUOV and no additional features were found to suggest functional roles. At the amino acid level, MPOV T2 is 99 % identical to YUOV T2, with just 17 substitutions; however, a hypervariable region was observed, containing seven substitutions within a 16 aa stretch near the N terminus (aa 27–42) (Fig. 4). MPOV T2 has a predicted molecular mass of 107 kDa and contains 10 cysteine residues; however, none of these are predicted to participate in disulphide bonding (as determined by bioinformatic analysis using PredictProtein). A phylogenetic tree based on the amino acid sequence of T2 places MPOV alongside YUOV in a cluster that includes Peruvian horse sickness virus, Corriparta virus, the tick-borne Broadhaven virus and Wongorr virus (Fig. 5).
|
|
|
). MPOV segment 3 contains a single ORF, encoding a protein of 873 aa with a predicted molecular mass of 101 kDa. At the amino acid level, MPOV dominant outer capsid protein is 78 % identical to that of YUOV and they are more similar towards the ends than in the middle (Fig. 6). MPOV dominant outer capsid protein contains 14 cysteine residues, all of which are predicted to engage in disulphide bonding. Seven cysteine residues are conserved between the dominant outer capsid proteins of MPOV and YUOV (which has two fewer cysteines). PredictProtein was used to identify 39 potential post-translational modification sites, 17 of which were conserved between MPOV and YUOV. These are N-glycosylation sites (positions 197 and 308), cAMP- and cGMP-dependent protein kinase phosphorylation sites (positions 79 and 859), protein kinase C phosphorylation sites (positions 50, 71, 78, 161, 814 and 823), casein kinase II phosphorylation sites (positions 48, 78, 89, 555 and 821), a tyrosine kinase phosphorylation site (position 372) and an N-myristoylation site (position 58).
|
). Kozak consensus sequences for strong eukaryotic translation, (A/G)XXAUGG, flank the initiation codons (underlined) of both genes, as indicated in Fig. 3(c) (Kozak, 1997). The partial sequences obtained for other gene segments aligned with their homologous counterparts in YUOV, with amino acid identities ranging from 91 % (NS1) to 98 % (VP4).
Virus identification by real-time PCR
Real-time PCR was used to screen unidentified viruses isolated from cattle in the Northern Territory of Australia between 1994 and 2006. In total, 152 separate isolates of MPOV were identified, which included 112 from 2006. This represented almost one in three viruses isolated through the Northern Territory sentinel programme in 2006, and >95 % of the unidentified viruses for that year. Two isolates collected in 1994 were identified as MPOV, making them the earliest examples to date. MPOV has been isolated from cattle located at Beatrice Hill farm (1994–2006), Darwin (2000), Katherine (2003), Douglas Daly (2000) and Tennant Creek (2001) (Fig. 7). Fifteen of 23 cattle infected with MPOV in 2006 were viraemic for 6 weeks or more, up to a maximum of 15 weeks in one animal.
|
). Traces of activity were detected in early January (summer wet season), but the first significant titre was not observed until March. Two animals had neutralizing titres by April, four by May and, by the beginning of June (winter dry season), most of the herd were producing antibodies, although all of the measured titres were considered to be low. Animals 5 and 21 each appeared to have two antibody-response peaks; however, in both cases, the peaks are at the borderline of sensitivity for this assay, and we do not interpret this as these animals being infected twice.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Based on the criteria of Attoui et al. (2001), MPOV should be classified as a novel genotype of the YUOV species. Whether it is a distinct serotype remains to be determined, but this seems likely, due to the unique amino acid sequence of the outer capsid protein. The availability of sequence data from these two closely related viruses opens a window of opportunity to study the biology of both in greater detail than would be possible with either sequence alone. MPOV appears to have emerged recently in this country and the serological evidence presented here suggests that the frequency of infection has increased over the last decade. We believe that this justifies further investigation of MPOV, even though it has not been associated with clinical disease.
To our knowledge, this is the first time that the PCR-Select cDNA subtraction hybridization technique has been applied successfully to a double-stranded RNA virus. The success of this approach shows that a large amount of sequence data can be generated quickly from a very basic preparation of RNA, without the need for complex virus-purification methods. The 5'–3' ligation method of Mandl et al. (1991) was effective in generating up to 1000 bases of terminal sequence of a gene segment and obtaining both 5'- and 3'-end sequences simultaneously.
The coexistence of suitable vector and host species at the same location is essential for the completion of arbovirus infection cycles and determines the potential range of virus distribution. Domestic cattle are bred in most parts of Australia, although MPOV has so far only been detected in the Brahmin breed. The arthropod vector(s) of MPOV has not yet been identified, but as its close relative YUOV was isolated from Culex tritaeniorhynchus mosquitoes (Attoui et al., 2005), it seems reasonable to anticipate a mosquito species performing this role for MPOV.
The ultrastructural characteristics of MPOV are consistent with those described for viruses belonging to the family Reoviridae, genus Orbivirus (Mertens et al., 2004). The diameter of the tubules observed in MPOV-infected cells (20 nm) was similar to that described for Wongorr virus (18–20 nm) and much narrower than those described for BTV (68 nm), epizootic hemorrhagic disease virus (54 nm) or Broadhaven virus (60 nm) (Gould & Hyatt, 1994; Nuttall et al., 1981).
The hypervariable region observed in the alignment of MPOV and YUOV T2 sequences has not been reported for any other orbivirus. Genome packaging and assembly of the segmented double-stranded RNA viruses in general have been explained inadequately and, for the genus Orbivirus, it is clear that T2 is critically involved, as it binds directly to the genomic RNA segments and forms the core structure in which they are packaged. The alignment of T2 sequences from all sequenced orbivirus species reveals that the T2 proteins of MPOV and YUOV have particularly long 5' ends and that the hypervariable region lies beyond the 5' ends of the other species. Sequence hypervariability can be explained either by strong selection pressure to mutate or by weak selection pressure to be conserved. The fact that most of the changes are conservative (e.g. K
R) indicates a selection pressure to maintain the general physical properties of the region.
The real-time PCR assay that was used targeted a highly conserved region of the T2 gene. This was done deliberately so that viruses with sequence variations from the prototype MPOV (outside the PCR target region) could also be detected. Consequently, it is possible that the 152 viruses identified as MPOV may include variants and this possibility is under investigation.
Overall, the characterization of MPOV has revealed a virus new to Northern Australia, widespread in domestic cattle and related closely to a mosquito-borne virus from China. MPOV apparently emerged here during the 1990s and induces antibody responses in host animals. The development of a rapid diagnostic test has already made possible the identification of over 150 previously unidentified viral isolates, and can now be used for the routine identification of future isolates.
|
ACKNOWLEDGEMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Attoui, H., Mohd Jaafar, F., Belhouchet, M., Aldrovandi, N., Tao, S., Chen, B., Liang, G., Tesh, R. B., de Micco, P. & de Lamballerie, X. (2005). Yunnan orbivirus, a new orbivirus species isolated from Culex tritaeniorhynchus mosquitoes in China. J Gen Virol 86, 3409–3417.
Diatchenko, L., Lau, Y. F., Campbell, A. P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N. & other authors (1996). Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A 93, 6025–6030.
Gard, G. P., Shorthose, J. E., Cybinski, D. H. & Zakrzewski, H. (1985). The isolation from cattle of 2 bluetongue viruses new to Australia. Aust Vet J 62, 203[Medline]
Gard, G. P., Shorthose, J. E., Weir, R. P. & Erasmus, B. J. (1987a). The isolation of a bluetongue serotype new to Australia. Aust Vet J 64, 87–88.[Medline]
Gard, G. P., Weir, R. P., Melville, L. F. & Lunt, R. A. (1987b). The isolation of bluetongue virus types 3 and 16 from northern Australia. Aust Vet J 64, 388[Medline]
Gould, A. R. & Hyatt, A. D. (1994). The orbivirus genus. Diversity, structure, replication and phylogenetic relationships. Comp Immunol Microbiol Infect Dis 17, 163–188.[Medline]
Kozak, M. (1997). Recognition of AUG and alternative initiator codons is augmented by G in position +4 but is not generally affected by the nucleotides in positions +5 and +6. EMBO J 16, 2482–2492.[CrossRef][Medline]
Libiková, H., Heinz, F., Ujházyová, D. & Stünzner, D. (1978). Orbiviruses of the Kemerovo complex and neurological diseases. Med Microbiol Immunol 166, 255–263.[CrossRef][Medline]
Maan, S., Maan, N. S., Samuel, A. R., Rao, S., Attoui, H. & Mertens, P. P. (2007). Analysis and phylogenetic comparisons of full-length VP2 genes of the 24 bluetongue virus serotypes. J Gen Virol 88, 621–630.
Mandl, C. W., Heinz, F. X., Puchhammer-Stockl, E. & Kunz, C. (1991). Sequencing the termini of capped viral RNA by 5'-3' ligation and PCR. Biotechniques 10, 484–486.[Medline]
Mertens, P. P. C., Maan, S., Samuel, A. & Attoui, H. (2004). Genus Orbivirus. In Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Viruses, pp. 466–483. Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger & L. A. Ball. London: Elsevier/Academic Press.
NAMP (2006). National Arbovirus Monitoring Program Annual Report 2005–2006. Deakin, Australia: Animal Health Australia. http://www.animalhealthaustralia.com.au/fms/Animal%20Health%20Australia/ADSP/NAMP0506.pdf
Nuttall, P. A., Carey, D., Reid, H. W. & Harrap, K. A. (1981). Orbiviruses and bunyaviruses from a seabird colony in Scotland. J Gen Virol 57, 127–137.
Page, R. D. (1996). TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12, 357–358.
Potgieter, A. C., Cloete, M., Pretorius, P. J. & van Dijk, A. A. (2003). A first full outer capsid protein sequence data-set in the Orbivirus genus (family Reoviridae): cloning, sequencing, expression and analysis of a complete set of full-length outer capsid VP2 genes of the nine African horsesickness virus serotypes. J Gen Virol 84, 1317–1326.
Rao, C. D., Kiuchi, A. & Roy, P. (1983). Homologous terminal sequences of the genome double-stranded RNAs of bluetongue virus. J Virol 46, 378–383.
Roner, M. R. & Steele, B. G. (2007). Localizing the reovirus packaging signals using an engineered m1 and s2 ssRNA. Virology 358, 89–97.[CrossRef][Medline]
Rost, B., Yachdav, G. & Liu, J. (2004). The PredictProtein server. Nucleic Acids Res 32, W321–W326
Roy, P. (2007). Orbiviruses. In Fields Virology, 5th edn, vol. 2, pp. 1975–1997. Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman & S. E. Straus. Philadelphia, PA: Lippincott Williams & Wilkins.
St George, T. D. (1992). Veterinary arboviruses – across Wallace's line. Arbovirus Research in Australia: Proceedings of the Sixth Symposium, Brisbane, Australia, paper 2.6, pp. 279–282.
Standfast, H. A., Dyce, A. L., St George, T. D., Muller, M. J., Doherty, R. L., Carley, J. G. & Filippich, C. (1984). Isolation of arboviruses from insects collected at Beatrice Hill, Northern Territory of Australia, 1974–1976. Aust J Biol Sci 37, 351–366.[Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.
Wentz, M. J., Patton, J. T. & Ramig, R. F. (1996). The 3'-terminal consensus sequence of rotavirus mRNA is the minimal promoter of negative-strand RNA synthesis. J Virol 70, 7833–7841.[Abstract]
Received 12 June 2007;
accepted 26 July 2007.
This article has been cited by other articles:
|
|
 |
|
  C. Cowled, G. Palacios, L. Melville, R. Weir, S. Walsh, S. Davis, A. Gubala, W. I. Lipkin, T. Briese, and D. Boyle Genetic and epidemiological characterization of Stretch Lagoon orbivirus, a novel orbivirus isolated from Culex and Aedes mosquitoes in northern Australia J. Gen. Virol., June 1, 2009; 90(6): 1433 - 1439. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
