|
|
||||||||
1 Department of Medical Biochemistry and Immunology, Henry Wellcome Research Institute, Cardiff University, Heath Park, Cardiff CF14 4XN, UK
2 Cancer Research UK Institute for Cancer Studies, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK
Correspondence
Paul Brennan
brennanP{at}cf.ac.uk
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
-herpesvirus that infects >90 % of the world's adult population. Although the effects are asymptomatic in most cases, due to the presence of circulating cytotoxic T lymphocytes (Rickinson & Moss, 1997
One of the main characteristics of EBV is its ability to establish viral latency. Three types of latency have been described, each of which displays a different subset of EBV latent genes. In type I latency, which is seen in EBV-associated Burkitt's lymphoma, only one viral protein, EBNA-1, is expressed. In type II latency, which is seen in Hodgkin's lymphoma and nasopharyngeal carcinoma, EBNA-1 and three viral latent membrane proteins (LMPs), LMP1, LMP2A and LMP2B, are expressed. In type III latency, which is seen in PTLD, nine viral proteins are expressed (EBNA-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-LP, LMP1, LMP2A and LMP2B) (Rickinson & Kieff, 1996
).
EBV is capable of transforming and immortalizing primary B lymphocytes into lymphoblastoid cell lines (LCLs). LCLs display type III latency and thus act as a cellular model for PTLD (Rickinson & Kieff, 1996
). Among the nine viral proteins that are expressed in type III latency, LMP1 is essential to the immortalization process (Kaye et al., 1993
; Kilger et al., 1998
). LMP1 mimics a constitutively activated CD40 receptor (Gires et al., 1997
) and contains two specialized C-terminal domains (CTAR1 and CTAR2) that trigger cellular signalling (Eliopoulos & Young, 2001
). Signal transducer and activator of transcription 1 (STAT1) expression has been shown to be induced by LMP1 and is known to be mediated by the co-operation of these two C-terminal domains (Richardson et al., 2003
; Zhang et al., 2004
).
STAT1 is a transcription factor that was originally discovered as a target of interferon (IFN) activation. It belongs to a family of latent transcription factors that become activated in response to extracellular ligands such as the cytokine IFN-
. Activation involves a phosphorylation cascade that enables STATs to dimerize, translocate to the nucleus and activate gene transcription at gamma-activated sequence (GAS) and IFN-stimulated response elements located in the promoters of IFN-responsive genes (Darnell et al., 1994
). The key post-translational modification involved is tyrosine phosphorylation at residue 701, although other modifications that can regulate STAT activity exist. These include serine phosphorylation at residue 727, which has been shown to be important for STAT1 transactivation (Decker & Kovarik, 2000
), arginine methylation (Mowen et al., 2001
) and lysine acetylation (Kramer et al., 2006
).
Constitutive activation of STAT1 is observed in many cancers, including acute myeloid leukaemia and EBV-associated malignancies (Fagard et al., 2002
; Nepomuceno et al., 2002
; Rickinson & Kieff, 1996
; Weber-Nordt et al., 1996
). However, in EBV-immortalized LCLs, the post-translational modifications of the STAT1 DNA-binding complex remain controversial. Some studies have shown that STAT1 is not constitutively tyrosine-phosphorylated in LCLs, but is capable of being tyrosine-phosphorylated in response to IFN-
(Dupuis et al., 2001
; Zhang et al., 2004
). However, other studies disagree with this and have reported that STAT1 is constitutively tyrosine-phosphorylated in LCLs, and a mechanism has even been described involving an indirect autocrine loop of IFN secretion (Fagard et al., 2002
; Najjar et al., 2005
; Nepomuceno et al., 2002
). As STATs are capable of regulating the expression of apoptotic and cell-cycle proteins such as Bcl-XL and cyclin D1 (Bowman et al., 2000
), the role of STAT1 in the progression of EBV-associated malignancy may be vital. This is highlighted by recent evidence suggesting that STAT1 acts as a tumour promoter rather than a tumour suppressor in the development of leukaemia (Kovacic et al., 2006
). Therefore, the regulation of STAT1 by specific post-translational modifications may provide a key insight into its activity in EBV-associated malignancy.
This study was initiated to investigate the post-translational modifications of STAT1 in EBV-immortalized LCLs. We have shown that STAT1 is only tyrosine-phosphorylated following stimulation with IFN-
, but is capable of binding DNA. This effect is driven specifically by the oncogene LMP1. STAT1 was found to be constitutively serine-phosphorylated, but lacked detectable lysine acetylation. This modification is regulated by two distinct pathways, PI3K and MEK, and appears to repress the DNA binding of STAT1 following IFN-
stimulation.
| METHODS |
|---|
|
|
|---|
Generation of nuclear extracts.
Nuclear extracts were prepared by using a method described previously (Brennan & O'Neill, 1996
). Following application of any stimuli or inhibitors, 1x107 cells were first washed in 1 ml hypotonic buffer [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl] and centrifuged at 13 000 r.p.m. for 1 min (Heraeus Biofuge). Cells were then lysed in 100 µl hypotonic buffer supplemented with 1 mM PMSF, 1 : 100 dilutions of phosphatase inhibitor cocktails I and II (Sigma; P-2850 and P-5726, respectively) and 0.1 % Nonidet P40 detergent and placed on ice for 5 min. Following centrifugation (13 000 r.p.m., 5 min, 4 °C; Heraeus Biofuge), the supernatant was retrieved, representing a cytosolic extract. Nuclear extracts were prepared by incubating the remaining pellet for 15 min in 50 µl high-salt buffer [20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 25 % glycerol] supplemented with 1 mM PMSF and 1 : 100 dilutions of phosphatase inhibitor cocktails I and II immediately prior to use. Following centrifugation (13 000 r.p.m., 5 min, 4 °C; Heraeus Biofuge), the supernatant was collected, representing the nuclear extract. For extracts prepared specifically for application in an electrophoretic mobility-shift assay (EMSA), 50 µl storage buffer [10 mM HEPES (pH 7.9), 50 mM KCl, 0.2 mM EDTA, 20 % glycerol] was also added to the nuclear extract. All extracts were then stored at 20 °C.
Generation of total cell lysates, SDS-PAGE and Western blotting.
Cells were counted on a haemocytometer and resuspended in 50 µl 1x PBS per 106 cells. An equal volume of 2x gel sample buffer (GSB) [0.1 M Tris/HCl (pH 6.8), 0.2 M dithiothreitol (DTT), 4 % SDS, 20 % glycerol, 0.1 % bromophenol blue] was then added. Cells were sonicated by using a W0385 sonicator (Heatsystems-Ultrasonics Inc.) and, following sonication, samples were heated at 100 °C for 5 min. Proteins were then separated by SDS-PAGE and transferred onto PVDF membranes (Amersham Biosciences) for immunoblotting using a previously described alkaline phosphatase chemiluminescent detection protocol (Rowe & Jones, 2001
). Antibodies to phospho-STAT1 (Y701) (sc-7988-R), phospho-STAT1 (S727) (sc-16570-R), pan-STAT1 (sc-346) and phospho-ERK1/2 (Y204) (sc-7383) ERK1/2 (sc-93) were from Santa Cruz Biotechnology and were used at a concentration of 0.2 µg ml1. Antibodies to phospho-S6 (S235/236) (#2211) and pan-S6 (#2212) were from Cell Signaling Technology and were used at a 1 : 1000 dilution of the stock supplied. The antibody to acetyl-lysine (#06-933) was from Upstate Technology and was used as a 1 : 1000 dilution of the stock supplied. The antibody to actin (A-2066) was from Sigma and was used as a 1 : 1000 dilution of the stock supplied. The primary antibody to LMP1 (CS1-4) has been described previously (Rowe et al., 1987
) and was used as a 1 : 1000 dilution.
DNA-affinity precipitation.
Nuclear extracts were generated as described above and diluted to 1 ml with salt-free buffer [50 mM Tris/HCl (pH 8), 0.25 mM EDTA, 10 mM NaF, 10 % glycerol, 0.5 mM PMSF, 10 µl phosphatase inhibitor cocktails I and II ml1, 5 mM DTT, 1 mM NaVO4]. By using an adapted version of the method of Beadling et al. (1996)
, streptavidin-conjugated agarose beads (30 µl of 1 : 1 slurry) and biotinylated double-stranded GRR oligonucleotide (1 µg) were added to the nuclear extract, which was rotated for 1 h at 4 °C. The mixture was centrifuged at 6000 r.p.m. for 5 min (Heraeus Biofuge) and the supernatant was removed. The beads were then washed three times in a wash buffer [50 mM Tris/HCl (pH 8), 0.25 mM EDTA, 10 mM NaF, 10 % glycerol, 0.5 mM PMSF, 40 mM NaCl, 5 mM DTT] and the proteins were eluted from the beads by the addition of 2x GSB. Eluted proteins were then separated by SDS-PAGE, transferred onto PVDF membranes and analysed by using specific antibodies. The GRR oligonucleotide (GTATTTCCCAGAAAAGGAAC) corresponds to a STAT consensus sequence derived from the Fc
R1-GAS.
EMSA.
Nuclear extracts of 2x107 cells were generated and quantified by using the Bradford method. Using a previously described method (Brennan & O'Neill, 1996
), 10 µg nuclear extract was incubated with either 2 ng 32P-radiolabelled GRR oligonucleotide, mutant GRR (mGRR) (GTATGTCCCAGAGAAGGAAC) or SIE oligonucleotide (GTGCATTTCCCGTAAATCTTGTCTACA) (sc-2535; Santa Cruz Biotechnology), generated by T4 polynucleotide labelling. For supershift assays, the nuclear extracts were pre-incubated for 30 min with 2 µg antibody to STAT1 from Santa Cruz Biotechnology (sc-592 X) and BD Transduction Laboratories (610119). For cold competitor assays, the nuclear extracts were pre-incubated for 30 min with 100 ng cold GRR oligonucleotide. The binding reaction was performed in binding buffer [10 mM Tris/HCl (pH 7.5), 1 mM EDTA, 100 mM NaCl, 4 % glycerol, 0.1 mg BSA ml1, 5 mM DTT] with the addition of 2 ng poly(dIdC) (Amersham Biosciences) for 30 min at room temperature prior to separation of proteinDNA complexes by using a native 4 % polyacrylamide gel.
Immunoprecipitation.
Nuclear extracts were generated as described above and diluted to 1 ml with salt-free buffer [50 mM Tris/HCl (pH 8.0), 0.25 mM EDTA, 10 mM NaF, 10 % glycerol, 0.5 mM PMSF, 10 µl phosphatase inhibitor cocktails I and II ml1, 5 mM DTT, 1 mM NaVO4]. Forty microlitres (1 : 1 slurry) of pre-washed STAT1 antibody (sc-346; Santa Cruz Biotechnology)- or ATF-3 antibody (sc-188; Santa Cruz Biotechnology)-bound Sepharoseprotein G beads was added to the nuclear extract and rotated at 4 °C for 120 min. The antibody-conjugated beads were collected by centrifugation (6000 r.p.m., 34 s, 4 °C; Heraeus Biofuge) and washed two times in cold lysis buffer [50 mM HEPES (pH 7.9), 2 mM EDTA, 250 mM NaCl, 0.1 % Nonidet P40 detergent] and two times in cold PBS. Antibody-bound proteins were eluted by the addition of 25 µl PBS and 25 µl 2x GSB and heating at 100 °C for 5 min.
Plasmids.
The GRR (5)-luc reporter construct, containing five copies of the STAT consensus sequence derived from the Fc
R1-GAS upstream of a firefly luciferase gene, has been described previously (Beadling et al., 1996
; Richardson et al., 2003
). The phRL-SV40 reporter contains a synthetic Renilla luciferase gene downstream of a T7 promoter and was obtained from Promega (E-6261).
Transient transfection and luciferase reporter assay.
Cells (1x107) were transiently transfected by electroporation using a Bio-Rad Gene Pulser II electroporator at 270 V and 950 µF at room temperature in 500 µl RPMI 1640 medium. Following transfection, cells were seeded in 3.5 ml fresh RPMI 1640 medium and incubated for 20 h at 37 °C in a 5 % CO2 humidified incubator. To assay luciferase activity from the reporter constructs, cells were washed in chilled PBS and lysed in 100 µl 1x passive lysis buffer provided within the Promega Dual Luciferase reporter assay kit (E-1910). Lysates were clarified by centrifugation (13 000 r.p.m., 1 min; Heraeus Biofuge) and 50 µl of supernatant was then assayed for firefly and Renilla luciferase levels in a 96-well plate by using reagents supplied with the kit. Light release was integrated for 10 s and measured by using a FLUOstar OPTIMA luminometer.
Inducing expression of LMP1 in the DG75 tTA LMP1 cell line.
The stable transfectant DG75 tTA LMP1 was maintained under drug selection with 1 µg tetracycline ml1 until required. Prior to an experiment, cells were washed five times in RPMI 1640 medium and were recultured in the presence or absence of 1 µg tetracycline ml1 for a period of 72 or 96 h. Total cell lysates and nuclear extracts were generated as described above.
| RESULTS |
|---|
|
|
|---|
stimulation, but is capable of binding DNA
for 30 min. Total cell lysates were analysed by SDS-PAGE and Western blotting using specific antibodies. Fig. 1(a)
was STAT1 tyrosine-phosphorylated, as has been reported previously (Dupuis et al., 2001
|
-stimulated cells by using DNA-affinity precipitation. DNA-bound proteins were analysed by SDS-PAGE and Western blotting using specific antibodies to tyrosine-phosphorylated and pan-STAT1 (Fig. 1b
stimulation, whereas in the IARC-171 LCL, it was seen in both untreated and IFN-
-stimulated cells.
To confirm this constitutive binding, we investigated STAT1 DNA binding in the same cell lines by EMSA. Cells were either untreated or stimulated with IFN-
, and 10 µg nuclear extract was incubated with 2 ng 32P-radiolabelled GRR probe or SIE oligonucleotide probe, representing a consensus sequence for the binding of Sis-inducible factor (Sadowski et al., 1993
). ProteinDNA complexes were then separated by using a native 4 % polyacrylamide gel and visualized by autoradiography (Fig. 1c
). ProteinDNA complexes are seen on both probes in the IFN-
-stimulated BL41 and BL41+B95.8 cell lines. In the IARC-171 LCL, these complexes are seen in both untreated and IFN-
-stimulated cells, an observation that is consistent with the data in Fig. 1(b)
. This suggested that, in LCLs, STAT1 can bind DNA in the absence of detectable tyrosine phosphorylation. This observation was consistent with previously published data that demonstrated LMP1-induced STAT1 DNA binding (Richardson et al., 2003
).
STAT1 forms a distinct DNA-binding complex
To elucidate the identity of the proteinDNA complexes in IARC-171 LCLs that can be observed in Fig. 1(c)
, a STAT1 antibody (sc-592 X) was pre-incubated with nuclear extracts of both untreated and IFN-
-stimulated IARC-171 LCL cells before 32P-radiolabelled GRR or SIE probe was added (Fig. 2a
). Although no reduction in electrophoretic mobility was observed following pre-incubation with the STAT1 antibody, a reduction in the intensity of the proteinDNA complexes was seen. This indicated that the antibody was preventing a full proteinDNA interaction and thus identified STAT1 as a component of the DNA-bound protein with both probes. The specificity of this complex was ascertained through incubation of a mutant 32P-radiolabelled GRR probe and through competitive binding with an excess of cold GRR competitor probe (Fig. 2b
). In order to confirm fully that the proteinDNA complex contained STAT1, untreated and IFN-
-stimulated IARC-171 LCL cells were pre-incubated with a different STAT1 antibody (610199; BD Transduction Laboratories) before 32P-radiolabelled GRR probe was added (Fig. 2c
). The supershift seen with the STAT1 antibody reiterated its presence in the DNA-binding complex.
|
From these data, we conclude that EBV-immortalized LCLs contain a constitutive STAT1 DNA-binding complex, unphosphorylated at tyrosine 701, that can probably stimulate transcriptional activation.
LMP1 induces STAT1 protein expression, nuclear translocation and DNA binding without triggering tyrosine phosphorylation
LMP1 has been shown to be responsible for inducing STAT1 expression and transcriptional activity in EBV-infected B lymphocytes (Richardson et al., 2003
; Zhang et al., 2004
). Given that we observed constitutive STAT1 DNA binding in the absence of tyrosine phosphorylation, we investigated whether this effect was LMP1-specific. In order to study the impact of LMP1 in a cellular context, we sought use of a stable transfectant of an EBV-negative Burkitt's lymphoma cell line in which LMP1 expression is controlled by a tetracycline-regulated LMP1 expression vector (Floettmann et al., 1996
). This cell line, DG75 tTA LMP1, allows LMP1 to be induced in an EBV-negative B-cell system through removal of tetracycline. To show successful induction of LMP1, total cell lysates were generated of cells cultured in the presence or absence of tetracycline for 72 or 96 h. The lysates were analysed by SDS-PAGE and Western blotting using specific antibodies to LMP1. Fig. 3(a)
shows the presence of LMP1 in the cells that were cultured in the absence of tetracycline for 72 or 96 h, but not in those cultured with tetracycline. IARC-171 was used as a positive control for LMP1 expression and actin was used as a loading control. To see whether LMP1 induces STAT1 expression, nuclear translocation and tyrosine phosphorylation, nuclear extracts were generated of DG75 tTA LMP1 cells cultured in the presence or absence of tetracycline for 72 or 96 h. These cells were also either stimulated with IFN-
or left untreated. Nuclear extract (10 µg) was then analysed by SDS-PAGE and Western blotting using specific antibodies. Fig. 3(b)
shows that LMP1 induces STAT1 nuclear expression, but does not trigger tyrosine phosphorylation. Only after IFN stimulation was tyrosine phosphorylation observed. This shows that LMP1 elevates STAT1 expression in LCLs, but does not induce tyrosine phosphorylation. The impact of LMP1 on STAT1 DNA binding in LCLs was investigated by using an EMSA (Fig. 3c
). DG75 tTA LMP1 cells were cultured in the presence or absence of tetracycline for 72 or 96 h and were either incubated with IFN-
or left unstimulated. Nuclear extract (10 µg) was incubated with 2 ng 32P-radiolabelled GRR probe, and any proteinDNA complexes formed were then separated by using a native 4 % polyacrylamide gel and visualized by autoradiography. Fig. 3(c)
displays the emergence of a constitutive STAT1 DNA-binding complex in DG75 tTA LMP1 cells in the absence of tetracycline after 96 h. This observation was seen in unstimulated cells and the levels of DNA binding were comparable to those seen in the IARC-171 LCL. From these data, we conclude that LMP1 alone is sufficient for inducing a constitutive STAT1 DNA-binding complex that is unphosphorylated at tyrosine Y701.
|
-stimulated cells and incubated with 1 µg STAT1 antibody pre-coupled to Sepharoseprotein G. Immunoprecipitated proteins were analysed by SDS-PAGE and Western blotting using specific antibodies to serine-phosphorylated and pan-STAT1. Fig. 4(a)
|
-stimulated IARC-171 LCL cells and were pre-incubated with 2 µg phospho-STAT1 (S727) antibody before 32P-radiolabelled GRR probe was added (Fig. 4b
-stimulated IARC-171 LCL cells is serine-phosphorylated.
Both tyrosine and serine phosphorylation are key regulatory modifications of STAT1, but other post-translational modifications of STAT1 have been characterized. Arginine methylation of STAT1 at the N-terminal residue 31 has been documented and is believed to enhance the DNA-binding activity of STAT1 (Mowen et al., 2001
), although other studies have disputed these claims (Komyod et al., 2005
; Meissner et al., 2004
). Lysine acetylation of STAT1 at residues 410 and 413 has recently been demonstrated and is believed to regulate the activity of NF-
B (Kramer et al., 2006
). To investigate whether STAT1 is acetylated in LCLs, we immunoprecipitated STAT1 from the nuclei of IARC-171 LCL cells that were untreated, stimulated with IFN-
and/or incubated with trichostatin A, a specific histone deacetylase inhibitor that has previously been shown to enhance STAT3 acetylation (Wang et al., 2005
; Yuan et al., 2005
). Immunoprecipitates were analysed by SDS-PAGE and Western blotting using an antibody specific for acetylated lysine residues. The results showed that STAT1 lysine acetylation cannot be detected in the immunoprecipitates of nuclear extracts of IARC-171 LCL (Fig. 4c
), although the acetylation of an unidentified protein was observed in standard nuclear extracts. STAT1 acetylation was also not detected in immunoprecipitates of cytosolic extracts of this LCL (data not shown).
STAT1 is serine-phosphorylated downstream of PI3K and MEK and seems to restrict IFN-stimulated STAT1 DNA binding
The observation of constitutive STAT1 serine phosphorylation in our LCL model led us to the question of which serine kinase(s) regulates this process and whether it can be inhibited. Many kinases have been implicated in other cell models, including p38 mitogen-activated protein kinase (p38 MAPK) (Goh et al., 1999
; Zykova et al., 2005
), extracellular signal-regulated kinase (ERK) (Zykova et al., 2005
) and phosphatidylinositol 3-kinase (PI3K) (Nguyen et al., 2001
; Rahimi et al., 2005
; Zykova et al., 2005
). We used a selection of serine kinase inhibitors (all supplied by Calbiochem) to investigate their effect on IARC-171 LCLs: PD98059, a MEK1/2 inhibitor; staurosporine, a broad-spectrum serine/threonine kinase inhibitor; and LY294002, a PI3K inhibitor. We found that staurosporine inhibited STAT1 serine phosphorylation, but also produced dramatic cytotoxicity to the cells (data not shown). However, PD98059 and LY294002 both inhibited STAT1 serine phosphorylation without causing dramatic cell death. We also found that, in combination, they further reduced the levels of STAT1 serine phosphorylation compared with that seen with the two inhibitors incubated alone (Fig. 5a
). As LY294002 has been shown to inhibit the phosphorylation of S6 ribosomal protein (Breslin et al., 2005
), phospho-S6 detection was used to demonstrate the actions of LY294002. Phospho-ERK detection was used to demonstrate the actions of PD98059. Thus, serine phosphorylation of STAT1 in our LCL model is sensitive to inhibition of both PI3K and MEK, suggesting that EBV stimulates serine phosphorylation through two distinct pathways.
|
for 30 min, by EMSA (Fig. 5b
-stimulated IARC-171 LCL cells. In fact, surprisingly, inhibition of serine phosphorylation actually increased the amount of STAT1 DNA binding in IFN-
-treated cells. Interestingly, IFN-
treatment did not increase the amount of STAT1 found in nuclear extracts. This effect is attributed to the high levels of STAT1 that already exist in the nucleus of an LCL and shows that IFN-
does not stimulate further STAT1 nuclear translocation. | DISCUSSION |
|---|
|
|
|---|
Although we have characterized a STAT1 DNA-binding complex lacking tyrosine phosphorylation in EBV-immortalized LCLs, this complex does not seem to exist in untreated BL41+B95.8 cells (Fig. 1b, c
). This observation conflicts with previously published data that show DNA-bound STAT1 in untreated BL41+B95.8 cells (Richardson et al., 2003
). However, this contrast reflects the variable expression of LMP1 in these cells, as clones high in LMP1 display DNA-bound STAT1, whereas those low in LMP1 lack detectable STAT1 DNA binding. The role of LMP1 in this STAT1 DNA-binding complex is evident from the data displayed in Fig. 3
. We have shown that LMP1 is sufficient to induce a constitutive STAT1 DNA-binding complex that lacks tyrosine phosphorylation. However, our hypothesis could be strengthened by depleting LMP1 from an LCL by RNA interference. We also have not ruled out the possibility that other STATs, such as STAT2 or STAT3, may comprise part of this complex. STAT1 is capable of forming STAT1STAT2 and STAT1STAT3 heterodimers, as well as forming classical STAT1 homodimers (Darnell et al., 1994
; Zhong et al., 1994
). With regard to STAT3, we found, by immunoprecipitation, that it did not co-precipitate with STAT1 in the nuclei of IARC-171 LCL cells, even though it was both tyrosine- and serine-phosphorylated (data not shown). Only with further characterization will the function of this complex in EBV-immortalized LCLs be elucidated.
Constitutive serine phosphorylation of STAT1 has been observed in malignancies such as chronic lymphocytic leukemia (Frank et al., 1997
) and Wilms' tumour (Timofeeva et al., 2006
). We provide further evidence that STAT1 is constitutively serine-phosphorylated in EBV-infected cells, agreeing with reports in the literature (Zhang et al., 2004
). Our data suggest that this phenomenon is not EBV-specific, as constitutive serine phosphorylation was also observed in the EBV-negative Burkitt's lymphoma cell line DG75 (Fig. 4a
). However, constitutive STAT1 DNA binding was seen in IARC-171 LCL cells, but not in DG75 cells, even though both cell lines exhibit serine-phosphorylated STAT1. This would suggest that DNA-bound serine-phosphorylated STAT1 is a feature of EBV-immortalized LCLs. Also, as constitutive serine phosphorylation is absent in normal peripheral blood B lymphocytes (Frank et al., 1997
), this suggests that constitutive serine phosphorylation of STAT1 may be a feature of B-cell malignancy in general. Recent evidence has shown that serine-phosphorylated STAT1 promotes cell survival through the upregulation of two known pro-survival genes, MCL-1 and HSP-27 (Timofeeva et al., 2006
), indicating why malignant B cells may accumulate this molecular change.
Lysine acetylation of STAT1 has been demonstrated recently (Kramer et al., 2006
) and could regulate its transcriptional abilities, as lysine acetylation of STAT3 has been shown to be vital for its DNA-binding and transcriptional capacity (Wang et al., 2005
; Yuan et al., 2005
). Our evidence suggests that STAT1 is not lysine-acetylated in EBV-immortalized LCLs (Fig. 4c
). This observation would suggest that this modification is not necessary for STAT1 function in LCLs, although we do not rule out the possibility that we cannot detect it with the technology at our disposal. More specific antibodies for lysine-acetylated STAT1 may provide a different answer but, at present, do not exist commercially.
Many serine kinases have been implicated in catalysing STAT1 serine phosphorylation in various cell systems. We have shown that the constitutive serine phosphorylation of STAT1 in LCLs is abrogated following long-term treatment with inhibitors of PI3K and MEK (Fig. 5a
). Both of these enzymes have also been implicated by other studies (Nguyen et al., 2001
; Rahimi et al., 2005
; Zykova et al., 2005
). Long-term treatment was necessary to ensure sufficient inhibition of STAT1 serine phosphorylation, as shorter incubation times yielded very little or no effect (data not shown). It is possible that this may reflect some form of indirect mechanism or perhaps just a slow inhibitory effect by PD98059 and LY294002 in combination. This is highlighted by the fact that staurosporine, a broad-spectrum serine/threonine kinase inhibitor, caused rapid inhibition after only 1 h (data not shown). By inhibiting STAT1 serine phosphorylation in LCLs through use of the combined incubation of PD98059 and LY294002, we have shown increased STAT1 DNA binding in LCLs stimulated with IFN-
(Fig. 5b
). This provides evidence that the constitutive serine phosphorylation of STAT1 in LCLs may have a repressive effect on IFN-
-induced STAT1 signalling. Repression of STAT signalling has been linked to serine phosphorylation and suggests that its role is more complex than thought previously (Bowman et al., 2000
). STAT3 serine phosphorylation has been shown to prevent tyrosine phosphorylation and DNA binding through either a direct influence upon or an indirect negative interaction with upstream tyrosine kinases (Chung et al., 1997
; Jain et al., 1998
; Sengupta et al., 1998
). Our data agree with these findings, in that serine phosphorylation seems to repress STAT1 DNA binding in IFN-
-stimulated LCLs. This effect could explain why no constitutive STAT1 tyrosine phosphorylation was seen in our LCLs (Fig. 1a
). These observations provide new data supporting a repressive role of serine phosphorylation on STAT1 rather than an enhancing role, and may indicate some form of reprogramming in IFN signalling by EBV.
In summary, this study builds on previous reports by being the most complete survey of post-translational modifications of STAT1 in EBV-immortalized LCLs. Our work illustrates three key advances in our knowledge. Firstly, we have shown that LMP1-induced STAT1 lacks tyrosine phosphorylation and lysine acetylation, but is capable of binding DNA. Secondly, we have also demonstrated, for the first time in EBV-immortalized LCLs, that the serine phosphorylation of STAT1 is regulated by two distinct pathways, PI3K and MEK. Thirdly, and most surprisingly, this modification appears to repress the DNA binding of IFN-stimulated STAT1. This indicates that STAT1 may be subject to some form of viral reprogramming by EBV during cellular transformation.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ben-Bassat, H., Goldblum, N., Mitrani, S., Goldblum, T., Yoffey, J. M., Cohen, M. M., Bentwich, Z., Ramot, B., Klein, E. & Klein, G. (1977). Establishment in continuous culture of a new type of lymphocyte from a Burkitt like malignant lymphoma (line D.G.-75). Int J Cancer 19, 2733.[Medline]
Bowman, T., Garcia, R., Turkson, J. & Jove, R. (2000). STATs in oncogenesis. Oncogene 19, 24742488.[CrossRef][Medline]
Brennan, P. & O'Neill, L. A. (1996). 2-Mercaptoethanol restores the ability of nuclear factor
B (NF
B) to bind DNA in nuclear extracts from interleukin 1-treated cells incubated with pyrollidine dithiocarbamate (PDTC). Evidence for oxidation of glutathione in the mechanism of inhibition of NF
B by PDTC. Biochem J 320, 975981.[Medline]
Breslin, E. M., White, P. C., Shore, A. M., Clement, M. & Brennan, P. (2005). LY294002 and rapamycin co-operate to inhibit T-cell proliferation. Br J Pharmacol 144, 791800.[CrossRef][Medline]
Chatterjee-Kishore, M., Wright, K. L., Ting, J. P. & Stark, G. R. (2000). How Stat1 mediates constitutive gene expression: a complex of unphosphorylated Stat1 and IRF1 supports transcription of the LMP2 gene. EMBO J 19, 41114122.[CrossRef][Medline]
Chung, J., Uchida, E., Grammer, T. C. & Blenis, J. (1997). STAT3 serine phosphorylation by ERK-dependent and -independent pathways negatively modulates its tyrosine phosphorylation. Mol Cell Biol 17, 65086516.[Abstract]
Darnell, J. E., Jr, Kerr, I. M. & Stark, G. R. (1994). Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264, 14151421.
Decker, T. & Kovarik, P. (2000). Serine phosphorylation of STATs. Oncogene 19, 26282637.[CrossRef][Medline]
Dupuis, S., Dargemont, C., Fieschi, C., Thomassin, N., Rosenzweig, S., Harris, J., Holland, S. M., Schreiber, R. D. & Casanova, J. L. (2001). Impairment of mycobacterial but not viral immunity by a germline human STAT1 mutation. Science 293, 300303.
Eliopoulos, A. G. & Young, L. S. (2001). LMP1 structure and signal transduction. Semin Cancer Biol 11, 435444.[CrossRef][Medline]
Fagard, R., Mouas, H., Dusanter-Fourt, I., Devillers, C., Bissieres, P., Martin, A., Lenoir, G., VanTan, H., Feuillard, J. & Raphael, M. (2002). Resistance to fludarabine-induced apoptosis in Epstein-Barr virus infected B cells. Oncogene 21, 44734480.[CrossRef][Medline]
Floettmann, J. E., Ward, K., Rickinson, A. B. & Rowe, M. (1996). Cytostatic effect of Epstein-Barr virus latent membrane protein-1 analyzed using tetracycline-regulated expression in B cell lines. Virology 223, 2940.[CrossRef][Medline]
Frank, D. A., Mahajan, S. & Ritz, J. (1997). B lymphocytes from patients with chronic lymphocytic leukemia contain signal transducer and activator of transcription (STAT) 1 and STAT3 constitutively phosphorylated on serine residues. J Clin Invest 100, 31403148.[Medline]
Gires, O., Zimber-Strobl, U., Gonnella, R., Ueffing, M., Marschall, G., Zeidler, R., Pich, D. & Hammerschmidt, W. (1997). Latent membrane protein 1 of Epstein-Barr virus mimics a constitutively active receptor molecule. EMBO J 16, 61316140.[CrossRef][Medline]
Goh, K. C., Haque, S. J. & Williams, B. R. (1999). p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. EMBO J 18, 56015608.[CrossRef][Medline]
Hori, T., Uchiyama, T., Tsudo, M., Umadome, H., Ohno, H., Fukuhara, S., Kita, K. & Uchino, H. (1987). Establishment of an interleukin 2-dependent human T cell line from a patient with T cell chronic lymphocytic leukemia who is not infected with human T cell leukemia/lymphoma virus. Blood 70, 10691072.
Jain, N., Zhang, T., Fong, S. L., Lim, C. P. & Cao, X. (1998). Repression of Stat3 activity by activation of mitogen-activated protein kinase (MAPK). Oncogene 17, 31573167.[CrossRef][Medline]
Kaye, K. M., Izumi, K. M. & Kieff, E. (1993). Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 90, 91509154.
Kilger, E., Kieser, A., Baumann, M. & Hammerschmidt, W. (1998). Epstein-Barr virus-mediated B-cell proliferation is dependent upon latent membrane protein 1, which simulates an activated CD40 receptor. EMBO J 17, 17001709.[CrossRef][Medline]
Komyod, W., Bauer, U. M., Heinrich, P. C., Haan, S. & Behrmann, I. (2005). Are STATS arginine-methylated?. J Biol Chem 280, 2170021705.
Kovacic, B., Stoiber, D., Moriggl, R., Weisz, E., Ott, R. G., Kreibich, R., Levy, D. E., Beug, H., Freissmuth, M. & Sexl, V. (2006). STAT1 acts as a tumor promoter for leukemia development. Cancer Cell 10, 7787.[CrossRef][Medline]
Kramer, O. H., Baus, D., Knauer, S. K., Stein, S., Jager, E., Stauber, R. H., Grez, M., Pfitzner, E. & Heinzel, T. (2006). Acetylation of Stat1 modulates NF-
B activity. Genes Dev 20, 473485.
Kumar, A., Commane, M., Flickinger, T. W., Horvath, C. M. & Stark, G. R. (1997). Defective TNF-
-induced apoptosis in STAT1-null cells due to low constitutive levels of caspases. Science 278, 16301632.
Lee, C. K., Gimeno, R. & Levy, D. E. (1999). Differential regulation of constitutive major histocompatibility complex class I expression in T and B lymphocytes. J Exp Med 190, 14511464.
Meissner, T., Krause, E., Lodige, I. & Vinkemeier, U. (2004). Arginine methylation of STAT1: a reassessment. Cell 119, 587589.[Medline]
Mowen, K. A., Tang, J., Zhu, W., Schurter, B. T., Shuai, K., Herschman, H. R. & David, M. (2001). Arginine methylation of STAT1 modulates IFN
/
-induced transcription. Cell 104, 731741.[CrossRef][Medline]
Najjar, I., Baran-Marszak, F., Le Clorennec, C., Laguillier, C., Schischmanoff, O., Youlyouz-Marfak, I., Schlee, M., Bornkamm, G. W., Raphael, M. & other authors (2005). Latent membrane protein 1 regulates STAT1 through NF-
B-dependent interferon secretion in Epstein-Barr virus-immortalized B cells. J Virol 79, 49364943.
Nepomuceno, R. R., Snow, A. L., Robert Beatty, P., Krams, S. M. & Martinez, O. M. (2002). Constitutive activation of Jak/STAT proteins in Epstein-Barr virus-infected B-cell lines from patients with posttransplant lymphoproliferative disorder. Transplantation 74, 396402.[CrossRef][Medline]
Nguyen, H., Ramana, C. V., Bayes, J. & Stark, G. R. (2001). Roles of phosphatidylinositol 3-kinase in interferon-gamma-dependent phosphorylation of STAT1 on serine 727 and activation of gene expression. J Biol Chem 276, 3336133368.
Rahimi, A. A., Gee, K., Mishra, S., Lim, W. & Kumar, A. (2005). STAT-1 mediates the stimulatory effect of IL-10 on CD14 expression in human monocytic cells. J Immunol 174, 78237832.
Richardson, C., Fielding, C., Rowe, M. & Brennan, P. (2003). Epstein-Barr virus regulates STAT1 through latent membrane protein 1. J Virol 77, 44394443.
Rickinson, A. B. & Kieff, E. (1996). Epstein-Barr virus. In Fields Virology, 3rd edn, vol. 2, pp. 23972446. Edited by D. M. Knipe, B. N. Fields & P. M. Howley. Philadelphia, PA: LippincottRaven.
Rickinson, A. B. & Moss, D. J. (1997). Human cytotoxic T lymphocyte responses to Epstein-Barr virus infection. Annu Rev Immunol 15, 405431.[CrossRef][Medline]
Rowe, M. & Jones, M. (2001). Detection of EBV latent proteins by Western blotting. Methods Mol Biol 174, 229242.[Medline]
Rowe, M., Rooney, C. M., Edwards, C. F., Lenoir, G. M. & Rickinson, A. B. (1986). Epstein-Barr virus status and tumour cell phenotype in sporadic Burkitt's lymphoma. Int J Cancer 37, 367373.[Medline]
Rowe, M., Rowe, D. T., Gregory, C. D., Young, L. S., Farrell, P. J., Rupani, H. & Rickinson, A. B. (1987). Differences in B cell growth phenotype reflect novel patterns of Epstein-Barr virus latent gene expression in Burkitt's lymphoma cells. EMBO J 6, 27432751.[Medline]
Rowe, M., Khanna, R., Jacob, C. A., Argaet, V., Kelly, A., Powis, S., Belich, M., Croom-Carter, D., Lee, S. & Burrows, S. R. (1995). Restoration of endogenous antigen processing in Burkitt's lymphoma cells by Epstein-Barr virus latent membrane protein-1: coordinate up-regulation of peptide transporters and HLA-class I antigen expression. Eur J Immunol 25, 13741384.[Medline]
Sadowski, H. B., Shuai, K., Darnell, J. E., Jr & Gilman, M. Z. (1993). A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261, 17391744.
Sengupta, T. K., Talbot, E. S., Scherle, P. A. & Ivashkiv, L. B. (1998). Rapid inhibition of interleukin-6 signaling and Stat3 activation mediated by mitogen-activated protein kinases. Proc Natl Acad Sci U S A 95, 1110711112.
Timofeeva, O. A., Plisov, S., Evseev, A. A., Peng, S., Jose-Kampfner, M., Lovvorn, H. N., Dome, J. S. & Perantoni, A. O. (2006). Serine-phosphorylated STAT1 is a pro-survival factor in Wilms' tumor pathogenesis. Oncogene 25, 75557564.[CrossRef][Medline]
Wang, R., Cherukuri, P. & Luo, J. (2005). Activation of Stat3 sequence-specific DNA binding and transcription by p300/CREB-binding protein-mediated acetylation. J Biol Chem 280, 1152811534.
Weber-Nordt, R. M., Egen, C., Wehinger, J., Ludwig, W., Gouilleux-Gruart, V., Mertelsmann, R. & Finke, J. (1996). Constitutive activation of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV)-related lymphoma cell lines. Blood 88, 809816.
Yang, J., Chatterjee-Kishore, M., Staugaitis, S. M., Nguyen, H., Schlessinger, K., Levy, D. E. & Stark, G. R. (2005). Novel roles of unphosphorylated STAT3 in oncogenesis and transcriptional regulation. Cancer Res 65, 939947.
Yuan, Z. L., Guan, Y. J., Chatterjee, D. & Chin, Y. E. (2005). Stat3 dimerization regulated by reversible acetylation of a single lysine residue. Science 307, 269273.
Zhang, L., Hong, K., Zhang, J. & Pagano, J. S. (2004). Multiple signal transducers and activators of transcription are induced by EBV LMP-1. Virology 323, 141152.[CrossRef][Medline]
Zhong, Z., Wen, Z. & Darnell, J. E., Jr (1994). Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264, 9598.
Zykova, T. A., Zhang, Y., Zhu, F., Bode, A. M. & Dong, Z. (2005). The signal transduction networks required for phosphorylation of STAT1 at Ser727 in mouse epidermal JB6 cells in the UVB response and inhibitory mechanisms of tea polyphenols. Carcinogenesis 26, 331342.
Received 27 November 2006;
accepted 28 February 2007.
This article has been cited by other articles:
![]() |
J. M. Brooks, S. P. Lee, A. M. Leese, W. A. Thomas, M. Rowe, and A. B. Rickinson Cyclical Expression of EBV Latent Membrane Protein 1 in EBV-Transformed B Cells Underpins Heterogeneity of Epitope Presentation and CD8+ T Cell Recognition J. Immunol., February 15, 2009; 182(4): 1919 - 1928. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Stephens, E. Nikoopour, B. J. Rider, M. Leon-Ponte, T. A. Chau, S. Mikolajczak, P. Chaturvedi, E. Lee-Chan, R. A. Flavell, S. M. M. Haeryfar, et al. Dendritic Cell Differentiation Induced by a Self-Peptide Derived from Apolipoprotein E J. Immunol., November 15, 2008; 181(10): 6859 - 6871. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |