J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 88 (2007), 1992-2002; DOI 10.1099/vir.0.82782-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masek, T.
Right arrow Articles by Pospisek, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masek, T.
Right arrow Articles by Pospisek, M.
Agricola
Right arrow Articles by Masek, T.
Right arrow Articles by Pospisek, M.

Hepatitis C virus internal ribosome entry site initiates protein synthesis at the authentic initiation codon in yeast

Tomas Masek1, Vaclav Vopalensky1, Ondrej Horvath2, Lucie Vortelova1, Zuzana Feketova1 and Martin Pospisek1

1 Department of Genetics and Microbiology, Faculty of Science, Charles University in Prague, Vinicna 5, 128 44 Prague, Czech Republic
2 Institute of Molecular Genetics, Laboratory of Leukocyte Antigens, AS CR, Videnska 1083, 140 00 Prague, Czech Republic

Correspondence
Martin Pospisek
martin{at}natur.cuni.cz


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Hepatitis C virus (HCV) is an important pathogen causing both acute and chronic infections in humans. The HCV polyprotein is synthesized by cap-independent translation initiation after ribosome binding to the highly structured internal ribosome entry site (IRES). The HCV IRES has been shown to have a low requirement for translation initiation factors and the ability to bind directly to the 40S ribosomal subunit. A novel yeast bicistronic reporter system, suitable for sensitive and accurate analysis of IRES activity, has been developed. It employs signal amplification based on the Gal4p transcription factor-mediated activation of a variety of secondary reporter genes. The system has a broad dynamic range and, depending on the nature of the particular secondary reporter, can be used both for precise measurements of IRES activity and for selection and screening for novel IRES variants and IRES trans-acting factors. By using this novel bicistronic system, it was shown that the HCV IRES is functional in yeast cells. Mutational analysis of the IRES loop IV and the adjacent region revealed that, in yeast, as in mammalian cells, translation initiates preferentially at the authentic 342AUG codon and that disruption of the HCV IRES loop IV abrogates its function, whilst minor positional changes or substitutions of the initiation codon within loop IV are largely tolerated. These findings bring more general insights to translation initiation, but also open the door for utilization of yeast and its sophisticated genetics for searching for new antiviral drugs and HCV IRES trans-acting proteins.

Supplementary data and sequences can be found with the online version of this paper and in IRESite, the Database of Experimentally Verified IRES Structures. http://www.iresite.org/; IRESite ID 86, 88, 90–99, 126–128 (Mokrejs et al., 2006Down).


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Hepatitis C virus (HCV) is an important pathogen infecting around 170 million people, many of whom will develop severe, chronic liver diseases. Almost all of the 340 nt long 5' untranslated region (UTR) of HCV RNA comprises a well-defined and highly structured internal ribosome entry site (IRES) that, together with the first 30–40 nt of the viral open reading frame (ORF), is required for efficient synthesis of the viral polyprotein (Fletcher et al., 2002Down; Hwang et al., 1998Down; Reynolds et al., 1995Down; Rijnbrand et al., 1995Down, 2001Down; Tsukiyama-Kohara et al., 1992Down). The HCV IRES is unique in its low requirement for host translation initiation factors and its ability to bind directly to the small 40S ribosomal subunit (Fukushi et al., 2001Down; Kolupaeva et al., 2000Down; Lytle et al., 2001Down; Otto et al., 2002Down). The translation initiation complex is further stabilized by translation initiation factor 3, which interacts physically with both the ribosome and loop III of the HCV IRES (Buratti et al., 1998Down; Collier et al., 2002Down; Kieft et al., 2001Down; Sizova et al., 1998Down). The resulting complex associates with the eukaryotic initiation factor 2 (eIF2)–GTP–met-tRNAi ternary complex and recruits the 60S ribosomal subunit to begin viral protein synthesis (Sizova et al., 1998Down). The HCV IRES contains several initiation and termination codons; however, the ribosome does not utilize them and, due to the structural and sequence features of the IRES, is positioned internally and initiates protein synthesis from the sixth – i.e. the last – 342AUG codon (Reynolds et al., 1996Down; Rijnbrand et al., 1996Down). The cellular translation initiation machinery can, to some extent, tolerate both mutations of the authentic initiation codon to non-AUG codons and minor changes of its position within loop IV (Honda et al., 1996Down; Hwang et al., 1998Down; Reynolds et al., 1995Down). Curiously, inclusion of a markedly longer part of the core protein coding sequence significantly suppressed the translation measured by bicistronic mRNAs both in vivo and in vitro (Wang et al., 2000Down).

The yeast Saccharomyces cerevisiae has been shown to be a powerful model organism for studies of basic molecular biology and genetic processes, including translation initiation. Nevertheless, there is little known about the ability of yeast cells to utilize viral IRES elements for internal translation initiation (Altmann et al., 1990Down; Iizuka et al., 1994Down; Paz et al., 1999Down). Several viral IRESs, including those from poliovirus, coxsackievirus, HCV, tobamovirus and cricket paralysis virus, have been reported to be functional in translation-competent yeast-cell extracts (Altmann et al., 1990Down; Dorokhov et al., 2002Down; Iizuka & Sarnow, 1997Down; Iizuka et al., 1994Down). Among them, only the function of the cricket paralysis virus IRES has been plausibly demonstrated in living yeast cells (Thompson et al., 2001Down). Rosenfeld & Racaniello (2005)Down recently presented the first attempt to demonstrate HCV IRES activity in yeast.

To analyse HCV IRES activity and cap-independent translation in yeast generally, we developed a sensitive system based upon the new pFGAL4 bicistronic vectors and engineered yeast strains. These generate an amplified signal in vivo by the primary reporter (GAL4)-mediated transcription activation of secondary reporters bearing measurable enzymic (lacZ) and physiological (ADE2, HIS3) activities. Presented data suggest that, in yeast, the HCV IRES is fully functional, translation initiates at the authentic initiation codon at position 342 and mutations that abrogate IRES translational activity in mammals act similarly in yeast.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Plasmids.
The novel bicistronic vector pFGAL4 is a derivative of the pYX212 yeast shuttle vector (2µ, URA3, ampR, TPI promoter; Ingenius). The coding region of firefly luciferase was PCR-amplified from the pGL3 plasmid (Promega) by using a High Fidelity PCR Master kit (Roche) (forward primer, 5'-CTGTCCCCAGTGCAAGTG-3'; reverse primer, 5'-TTTTCCTAGGCTAGAATTACACGGCGATCT-3'). The PCR fragment and pYX212 were digested with NcoI and XmaJI (Fermentas) and ligated together to form pYX212F. GAL4 DNA was PCR-amplified from the pCL1 template (Clontech) with gene-specific primers (forward, 5'-ACTAGTAAGCTTGAATTCATGAAGCTACTGTCTTCTATCGAACAAG-3'; reverse, 5'-TTGAGCTCTTACTCTTTTTTTGGGTTTGGTGG-3'). The resulting PCR product was cut with HindIII and SacI and ligated into pYX212F digested with the same enzymes. The pFGAL4 vector was finalized to pFGAL4h by insertion of a stem–loop hairpin [CCTAGGAAA(13)CAAA(13)GAGGGCCCAGGATCCGTCGACAAGCTT] into the XmaJI and HindIII sites following the firefly luciferase gene. A pFGAL4 : : {lambda} library was created by ligation of HindIII/TasI- or TasI-digested bacteriophage {lambda} DNA (Fermentas) into pFGAL4 cut by HindIII/EcoRI or EcoRI, respectively. The whole-length IRES sequence from HCV genotype 1a (nt 1–385) was PCR-amplified from the p90HCVFL vector (courtesy of Charles Rice, Rockefeller University, New York, USA; forward primer, 5'-AAAGGATCCGCCAGCCCCCTGATGGGGGCGACAC-3'; reverse primer, 5'-AGGAATTCGTGTTACGTTTGGTTTTTCTTTGAGGTTTAGG-3') and inserted behind the stem–loop between the reporter genes via EcoRI and BamHI sites (pFGAL4h-HCV1). XmaJI/BamHI digestion of pFGAL4h-HCV1 and subsequent circularization of the blunt-ended vector was used to create a control vector (pFGAL4-HCV1) lacking the 13G : C hairpin. The tricistronic vector pFGAL4-L270-HCV1 and its derivative containing the inverted HCV IRES sequence (pFGAL4-L270-HCV1rc) were prepared by ligation of the full-length HCV IRES amplicon into the single EcoRI site behind the {lambda}270 insert. The mammalian bicistronic vector pRG is a derivative of the pDsRed2-C1 vector (pUC ori, KanR, CMV promoter, DsRed2; Clontech) containing the enhanced green fluorescent protein (EGFP) gene from the pEGFP-N1 vector (Clontech) inserted into the HincII site. A new stop codon was introduced at the end of the DsRed2 gene by ligation of the 5'-GATCCAGCAAGATATCCTAA-3'/5'-GATCTTAGGATATCTTGCTG-3' adaptor into the BglII site.

Cells and media.
S. cerevisiae strain PJ69-4A (MATa, trp1-901, leu2-3,112, ura3-52, his3-200, gal4{Delta}, gal80{Delta}, GAL2-ADE2, LYS2 : : GAL1-HIS3, met2 : : GAL7-lacZ) was used throughout this study (James et al., 1996Down). Yeast transformation was performed by the one-step LiCl method (Gietz & Woods, 2002Down) and obtained clones were grown in drop-out synthetic minimal medium (SD) without uracil to ensure maintenance of plasmids. Selection for IRES activity was performed on SD plates lacking uracil, adenine and histidine and supplemented with 0–120 mM 3-aminotriazole (3-AT; Sigma), a competitive inhibitor of histidine biosynthesis.

Luciferase, beta-galactosidase (beta-gal) and flow-cytometry assays.
Yeast cell cultures were grown in SD medium without uracil and harvested in the exponential-growth phase (OD595, 0.5–0.7). Cell extracts were prepared by homogenization with glass beads in a Mixer Mill apparatus MM301 (Retsch) in ice-cold 100 mM potassium phosphate lysis buffer (pH 7.8), containing 0.2 % Triton X-100 and 0.5 mM dithiothreitol. Firefly luciferase activity was quantified in quadruplicate by the Luciferase Assay system (Promega) according the manufacturer's instructions in a Microlite TLX2 Dynatech luminometer. beta-Gal assays were done in triplicate by using a Galacto-Light Plus beta-galactosidase assay kit (Tropix) following the manufacturer's instructions. All luminescence measurements were performed within 1 min of starting the respective reactions. The results are expressed as relative normalized luminescence units of beta-gal activity (RGU), calculated as a quotient of beta-gal luminescence units/5x105 luciferase luminescence units. Mean values and SD are shown. For flow-cytometry analyses, human liver epithelial CCL-13 cells were transfected in ExGene transfection reagent dissolved in 100 mM NaCl solution according the manufacturer's instructions (Fermentas). After 2 days, cells were harvested by trypsinization and resuspended in Dulbecco's modified Eagle's medium (Sigma-Aldrich). At least fifty thousand cells were analysed by flow cytometry in each experiment, using an LSRII machine (BD Biosciences).

RNA analysis.
Five hundred millilitres of yeast cells (OD595, 0.65) was sedimented and washed twice in 10 ml 10 mM Tris/HCl (pH 7), 5 mM MgCl2, 140 mM KCl. Cell lysis was carried out by using RNA–DNA stabilization reagent (Roche). An mRNA Isolation Kit for Blood and Bone Marrow (Roche) was used to isolate mRNA. DNase treatment and inactivation were carried out by using a DNA-free kit (Ambion) following the manufacturer's instructions. cDNA was synthesized with a gene-specific primer and 200 U SuperScript II RNaseH reverse transcriptase (Invitrogen). One microlitre of reverse transcriptase reaction was subjected to PCR amplification [95 °C, 1 min (initial template denaturation); 24 cycles of 94 °C, 30 s (denaturation); 54 °C, 30 s (primer annealing); and 68 °C ,1 min (extension); 72 °C, 4 min (final extension)] by using the High Fidelity PCR Master system according to the manufacturer's instructions (Roche). Aliquots (10 µl) of the PCR samples were run on TAE/1 % agarose gels and visualized by ethidium bromide (EtBr) staining. For real-time PCR analysis, a LightCycler 1.5 and QuantiTect SYBR Green PCR kit (Qiagen) were used with essentially the same protocol as described above, with exception that the initial denaturation step was extended to 15 min.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Novel yeast bicistronic reporter assay system
We constructed a novel bicistronic reporter vector, pFGAL4, to test the translational activity of the HCV IRES in living yeast cells. The pFGAL4 vector is derived from the multicopy expression plasmid pYX212, which contains the strong constitutive triose phosphate isomerase (TPI) promoter to ensure high-level production of a bicistronic mRNA bearing the firefly luciferase as a first cistron and the GAL4 gene as a second cistron. Employment of the Gal4 transcription factor ensures further signal amplification originating from the IRES containing intercistronic region activity. Even limited translation of the second cistron, leading to the presence of just a few molecules of active Gal4 protein in the cell, can trigger strong transcription of the secondary reporter genes under the control of the Gal4-inducible promoter and, thus, proportional signal enhancement. The pFGAL4-based system thus takes advantage of the natural regulatory pathways that have evolved for the tight and precise control of metabolic utilization of galactose in yeast (reviewed by Lohr et al., 1995Down). The pFGAL4 vector can be used in any yeast strain lacking the wild-type GAL4 and GAL80 alleles and containing either episomally or chromosomally encoded Gal4-inducible reporter genes, typical in yeast strains that are used routinely for two-hybrid screens and other similar approaches. Throughout this study, we used the PJ69A strain (James et al., 1996Down), which contains bacterial beta-gal (LacZ) and yeast ADE2 and HIS3 reporter genes under the control of the Gal4-inducible GAL1 promoter. Data were normalized to the activity of the firefly luciferase encoded by the first cistron of the bicistronic Fluc-IRES-GAL4 mRNA. Employment of the Gal4 transcription factor as a natural signal amplifier in the PJ69A yeast strain thus allows simultaneous determination of even tiny changes in IRES activity, both in lysates by measuring the ratio of the beta-gal/luciferase (beta-gal/luc) enzymic activities and in living cells by analysing colony-growth rates on selection SD plates lacking adenine and histidine and containing various concentrations of 3-AT, a competitive inhibitor of the histidine biosynthetic pathway (Fig. 1aDown). For most experiments, ribosome read-through beyond the end of the first cistron was reduced by inserting a stable 13G : C hairpin loop just behind the firefly luciferase stop codon, thus giving rise to the pFGAL4h vector.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 1. (a) Design of the pFGAL4/PJ69A system. The pFGAL4 vector bears genes for firefly luciferase and Gal4p as the first and second cistrons, respectively. The yeast strain PJ69A contains reporter genes encoding the yeast Ade2 and His3 proteins and bacterial beta-gal, all under the control of the Gal4-inducible GAL1 promoter. pFGAL4/PJ69A represents a specialized and sensitive system that allows amplification of the signal in vivo by coupled transcriptional activation and enzymic detection. This system can be used both for measuring the ratio of the beta-gal/luc enzymic activities and for examination of the IRES activity by screening the colony-growth rates on selection medium lacking adenine and histidine. TPI, Triose phosphate isomerase promoter; T, terminator; GAL1 UAS, GAL1 promoter upstream activation sequence. (b) Influence of intercistronic length and stem–loop structure on Gal4p translation in the pFGAL4/PJ69A reporter system. beta-Gal/luc enzymic activities were measured in exponentially growing yeast clones transformed with individual vectors from the pFGAL4 : : {lambda} library containing intercistronic spacers spanning between 34 (empty pFGAL4 vector) and 682 bp. Arrows show the beta-gal activity of the pFGAL4 and pFGAL4h vectors. Decrease of beta-gal activity of pFGAL4h is caused by insertion of the stable 13G : C stem–loop, with the aim of preventing ribosome read-through.

 
Calibration of the pFGAL4 bicistronic reporter system
We further characterized the pFGAL4/PJ69A system to get information about the influence of the intercistronic region length on the ability of the ribosome to reinitiate at the AUG codon of the second cistron. We prepared a mini-library of pFGAL4 vectors containing intercistronic spacers of various lengths constructed from a set of random bacteriophage {lambda} sequences. Despite the fact that we used random DNA sequences, which therefore contained an unpredictable number of ORFs, multiple translation initiation codons and cryptic promoters, for mini-library construction, we obtained data similar to those reported by Rajkowitsch et al. (2004)Down, who reported that the elongating yeast ribosomes maintain competence to reinitiate only over short distances. This phenomenon is seen clearly in our results, where ribosome reinitiation 100 nt downstream of the luciferase gene stop codon declines by two orders of magnitude (Fig. 1bUp). Insertion of the 13G : C stable loop, of minimum free-energy change ({Delta}G) 177.5 kJ mol–1, substantially lowers the ribosome read-through of the intercistronic region of pFGAL4h bicistronic mRNA and reduces the normalized relative beta-gal activity by approximately 90 % (Fig. 1bUp).

Yeast cells can utilize the HCV IRES
Reported observations of moderate activity of the HCV IRES in translation-competent yeast-cell lysates led us to test the functionality of the HCV IRES in living yeast cells. We cloned the full-length 5' UTR of HCV genomic RNA, together with the first 45 nt of the viral polyprotein gene, into the bicistronic pFGAL4h vector in frame with the second reporter, thus making an N-terminal fusion of the first 15 aa from the HCV polyprotein with the yeast transcriptional activator Gal4p. In the PJ69A yeast tester strain, the resulting plasmid, pFGAL4h-HCV1, produced about 42 % of normalized beta-gal activity compared with the empty bicistronic pFGAL4h vector, but gave rise to approximately 26 times higher relative activity of the beta-gal reporter than control vectors containing similarly sized pieces of {lambda} phage DNA inserted between the firefly luciferase and GAL4 genes (Fig. 2aDown). As well as the lacZ gene, encoding bacterial beta-gal, the yeast PJ69A tester strain contains also HIS3 and ADE2 genes under the transcriptional control of the Gal4p activator. As shown clearly in Fig. 2(b)Down, results similar to the biochemical beta-gal/luc assays can be obtained by careful monitoring of yeast-colony growth on selection agar medium containing various concentrations of the competitive inhibitor of the yeast imidazoleglycerol-phosphate dehydratase, encoded by the reporter HIS3 gene.


Figure 2
View larger version (57K):
[in this window]
[in a new window]

 
Fig. 2. (a) Ability of the HCV IRES to mediate translation initiation in yeast. Normalized beta-gal activity measured in lysates from yeast cells expressing the following bicistronic reporters (shown schematically above): pFGAL4h (the empty bicistronic vector containing the 13G : C stem–loop); pFGAL4h-HCV1 (the parent vector with the HCV IRES); pFGAL4-Lxxx (the vectors containing various inserts of randomized {lambda} DNA; numbers represent lengths of the respective intercistronic regions); pFGAL4h-HCV3 (the parent vector containing a frameshift mutation between the HCV IRES and the GAL4 reporter). (b) IRES activity determination by colony-growth-rate analysis on drop-out minimal agar medium. –U (without uracil), selecting for the presence of the pFGAL4 plasmid and its derivatives; –UHA (without uracil, histidine and adenine), selecting for IRES activity; –UHA, 40–120 mM 3-AT (–UHA plates supplemented with the competitive His3 inhibitor 3-AT), selecting for IRES activity with an increasing stringency. The pFGAL4h-HCV1 vector allows yeast-colony development under conditions in which other vectors containing intercistronic regions of length similar to the HCV IRES do not support yeast growth. The rows at each panel represent two dilutions of respective yeast strains (106 and 105 cells per spot).

 
Further supporting evidence of the functionality of the HCV IRES in S. cerevisiae is provided by analysis of the HCV3 clone, which contains a frameshift mutation at the 3' end of the IRES (Fig. 2Up). This point-mutated clone differs from standard pFGAL4h-HCV1 by a 4 nt insertion between the authentic IRES initiation codon and the inherent Gal4p initiation codon. The difference of 82 % between the relative beta-gal activity of HCV1 and that of the mutated HCV3 clone points clearly to the preferential usage of the authentic HCV initiation codon.

Translational activity of the HCV IRES is not influenced by cryptic transcription, splicing or mRNA breakage
We decided to measure the effect of insertion of another ‘blocking’ sequence between the luciferase gene and the HCV IRES on IRES activity in order to exclude an influence of ribosome reinitiation or of a possible artificial promoter lying within the bicistronic part of the vector. To obtain such blocking sequences, we used the pFGAL4 : : {lambda} library described herein for in vivo selection of clones giving the lowest GAL4 expression in a plate assay as monitored by growth retardation on SD drop-out medium. To prevent instability of the vector and the bicistronic reporter mRNA, we chose among the selected clones those containing the shortest {lambda} DNA inserts. It is not surprising that such clones usually reveal other short ORFs within the {lambda} DNA insert. For further work, we picked the pFGAL4-L270 vector, containing a 270 nt long {lambda} DNA insert, which includes a short ORF located between nt 91 and 147 of the intercistronic region. The HCV IRES was inserted in both orientations just behind the L270 DNA fragment. The resulting vectors, pFGAL4-L270, pFGAL4-L270-HCV1 and pFGAL4-L270-HCV1rc, are thus tricistronic. The HCV IRES activity in these tricistronic vectors was compared with that in standard bicistronic pFGAL4h-HCV1 and pFGAL4h-HCV1rc plasmids, where ‘rc’ means the inverted HCV IRES (reverse complement; Fig. 3Down). Careful analysis of HCV IRES activity in tri- and bicistronic vectors revealed that the ratio between the activities of the HCV IRES in the correct and inverted orientations is exactly the same in both kinds of vector (RGUHCV1/RGUHCV1rc=2.45). If shortening of the bicistronic mRNA by cryptic transcription, splicing or mRNA breakage within the intercistronic region occurred, then the measured IRES activity would be the same for both the bi- and tricistronic systems, which is not the case. On the other hand, the results show clearly that some kind of ribosome reinitiation at the last cistron – the second or the third – exists and that the HCV IRES-mediated translation is at least partly dependent on ribosomes supplied from the first cistron of the bi(tri)cistronic mRNA.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
Fig. 3. Comparison of HCV IRES activities in bi- and tricistronic reporters. The tricistronic pFGAL4-L270 vector, which contains a 57 nt short ORF within the spacer, was selected for low GAL4 expression from the pFGAL4 : : {lambda} library. The HCV IRES in either the correct (HCV1) or inverted (HCV1rc) orientation was inserted just behind the 270 nt bacteriophage {lambda} spacer to create tricistronic constructs pFGAL4-L270-HCV1 and pFGAL4-L270-HCV1rc, respectively. HCV and HCVrc IRES activity in tricistronic mRNAs was compared with that in corresponding bicistronic transcripts (pFGAL4h-HCV1 and pFGAL4h-HCV1rc). Activities of all of the constructs were measured in lysates of the respective transformed yeast clones and are expressed in normalized beta-gal units (RGU). The monocistronic vector (pYX212F, FLuc gene only) represents the basal RGU level of the employed yeast system.

 
To exclude occurrence of functionally monocistronic mRNAs derived from the bicistronic pFGAL4h-HCV1 vector in yeast and to confirm the results obtained with tricistronic vectors in vivo, we performed RT-PCR and real-time PCR analyses. We analysed three overlapping regions of bicistronic FLUC-HCV_IRES-GAL4 mRNA (Fig. 4Down). In all cases, we obtained amplification products of the expected size, thus there is no evidence for cryptic splicing or for any kind of mRNA shortening (Fig. 4bDown). Also, the amplification curves of the L and G fragments, which correspond to the first and the second cistron, respectively, fit each other for both IRES-containing and empty vectors. This clearly points to no cryptic promoter activity residing in the HCV IRES segment. The quantification of I fragment, corresponding to the intercistronic regions, was affected by the differing sizes of the amplicons (Fig. 4cDown).


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
Fig. 4. Control RT-PCR experiments. Reverse transcription was performed with a GAL4 gene-specific primer. To exclude the possible occurrence of cryptic splicing, transcription or mRNA breakage, three overlapping regions of bicistronic mRNA were analysed by RT-PCR or real-time quantitative RT-PCR (G, 5'-proximal part of GAL4; I, intercistronic region; L, 3'-terminal part of luciferase gene; see also supplementary data, available in JGV Online, for other data and Ct values). (a) Design of RT-PCR. (b) Detection of RT-PCR products on EtBr-stained agarose gel [M, GeneRuler 100 bp DNA Ladder Plus (Fermentas); C, PCR control reaction without template; +/–, reactions with or without reverse transcriptase, respectively]. The correct size of products suggests no aberrant splicing of bicistronic mRNA. (c) Real-time RT-PCR experiment. The amplification curves of the L and G fragments are almost identical for both empty and HCV IRES-containing vector. All of the analyses were performed on the same amount of yeast cells. This result demonstrates no cryptic promoter activity residing in the HCV IRES segment.

 
The authentic HCV initiation codon is preferred in both yeast and mammalian cells
To dissect the mode of translation initiation at the HCV IRES in the yeast cellular environment, we prepared, in addition to the frameshift-containing HCV3 clone, a set of mutants with point mutations in the HCV IRES authentic AUG initiation codon and in its close vicinity (Fig. 5aDown; Table 1Down). Disruption of loop IV and removal of the polyprotein coding sequence (pFGAL4h-HCV1{Delta}1–15AA) or alteration of the authentic HCV and inherent GAL4 initiation codons to the UUG codon (pFGAL4A/UUGh-HCV1A/UUG) eliminates HCV IRES activity almost completely. About three times higher, but still very low, IRES activities are exhibited by clones either bearing a frameshift mutation between the HCV IRES and GAL4 initiation codons (pFGAL4h-HCV3) or bearing the HCV IRES authentic AUG initiation codon changed to UUG (pFGAL4h-HCV1A/UUG). Also, the change of the inherent AUG codon of the GAL4 reporter gene to the UUG codon alone (pFGAL4A/UUGh-HCV1) led to a substantial decrease of IRES activity, whilst a slight change of AUG position within loop IV produced only a moderate decrease in the measured IRES activity (pFGAL4h-HCV1ACCAUG/AUGACC). The presence of the stable hairpin loop preceding the HCV IRES in the pFGAL4h-HCV1 vector series had almost no influence on IRES activity [compare pFGAL4h-HCV1 and pFGAL4-HCV1 columns in Fig. 5(a)Down].


Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
Fig. 5. (a) In order to further dissect the activity of the HCV IRES in yeast, we inserted some point mutations into the IRES loop IV and the adjacent region and compared these constructs with control vectors with or without the 13G : C stem–loop (pFGAL4h-HCV1 or pFGAL4-HCV1). The mutations are as follows: pFGAL4h-HCV3 (frameshift between the HCV IRES and the GAL4 reporter); pFGAL4h-HCV1ACCAUG/AUGACC (permutation of 339ACC and 342AUG within stem–loop IV); pFGAL4h-HCV1A/UUG (substitution of the authentic initiation 342AUG codon for 342UUG); pFGAL4A/UUGh-HCV1 (substitution of the GAL4 natural initiation AUG codon for UUG), pFGAL4A/UUGh-HCV1A/UUG (substitution of both the authentic HCV IRES initiation codon and the GAL4 natural initiation codon for UUG); pFGAL4h-HCV1{Delta}1–15AA (deletion of the first 15 codons from the HCV polyprotein gene). Activities of all constructs were measured in lysates of the respective transformed yeast clones and are expressed as normalized beta-gal units (RGU). (b) Flow-cytometric analysis of Chang CCL-13 liver cells transiently expressing pRG bicistronic construct containing DsRed2 and EGFP fluorescent protein genes as the first and the second cistrons, respectively. The individual experiments are labelled according to the corresponding vectors used for the transfections: pEGFP-N1 (the monocistronic vector expressing only the green fluorescent protein); pDsRed2-C1 (the monocistronic vector expressing only the red fluorescent protein); pRG (expressing a bicistronic mRNA encoding the red fluorescent and the green fluorescent proteins as the first and the second cistrons, respectively); pRG-HCV1 (pRG vector containing the HCV IRES in the intercistronic region: high production of both the red and the green fluorescent proteins is obvious); pRG-L270 and pRG-L666 (control vectors containing the inserts of randomized {lambda} DNA; numbers represent lengths of the respective intercistronic regions); pRG-HCV1rc (the control vector containing the inverted HCV IRES inserted between the two fluorescent protein reporter genes); pRG-HCV1A/UUG (the vector containing substitution of the authentic initiation 342AUG codon for 342UUG in the HCV IRES). No green fluorescent protein production is clearly visible in the case of pRG-L270, pRG-L666 or the pRG-HCV1rc vectors, whereas mutation of the authentic HCV initiation codon leads to observable but reduced expression of the second cistron.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Activities of the HCV IRES variants mutated in stem–loop IV, expressed as normalized beta-gal units (RGU)

 
To confirm the function of the control and mutated HCV IRES clones in both yeast and mammalian cells, we constructed a mammalian bicistronic expression vector based on fluorescent proteins (Fig. 5bUp). We obtained mutually comparable results that are, in the case of the mammalian system, in good agreement with data presented elsewhere (Hwang et al., 1998Down).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Many new questions concerning the evolutionarily well-preserved structures and functional similarities of the yeast and mammalian translation machinery stem from the finding that yeast is able to support HCV IRES-mediated cap-independent translation initiation. Principal among them are those concerning the small ribosomal subunit and eIF3. The yeast ribosome is smaller than the mammalian one, but structural studies revealed a strong similarity between them, including the HCV IRES-binding site (Spahn et al., 2001Down). Overall identity between the mammalian and yeast 40S ribosomal proteins is as high as 60 % (Wool et al., 1996Down), yet the human HCV IRES-binding ribosomal proteins share on average an even higher degree of identity (65 %) and similarity (79 %) with their yeast counterparts (Csank et al., 2002Down). Less striking is the homology between the yeast Nip1 and TIF34, the subunits of eIF3 implicated in HCV IRES binding, and their mammalian counterparts (Csank et al., 2002Down; Hershey & Merrick, 2000Down) (see also Supplementary Table S2, available in JGV Online). The potency of the yeast system can also be implicated from the recent results of Sarnow's group, who detected HCV IRES-mediated translation in a reconstituted system containing no translation initiation factors, but HeLa ribosomes, yeast elongation factors 1A and 2 and bulk aminoacylated tRNAs (Lancaster et al., 2006Down).

We present herein a novel bicistronic system that enables use of the yeast model to study HCV IRES function and facilitates the use of various detection and selection methods (Fig. 1aUp). This system is very sensitive, has a high dynamic range and, due to intrinsic features of the natural transcription regulatory network of the GAL gene family, reproducibly allows transcriptional amplification of the target signal and estimated quantification of probably just a few molecules of the primary reporter – Gal4p (Fig. 1bUp). The pFGAL4 vector can be employed as general tool for the search for new IRESs, as well as for the precise characterization of any particular IRES, including the search for IRES trans-acting proteins and compounds.

The first successful attempt to test functionality of the HCV IRES in yeast has been published recently (Rosenfeld & Racaniello, 2005Down). However, the authors had serious difficulty detecting IRES activity and had to extend the IRES sequence with 360 nt of the HCV polyprotein coding region, thus almost doubling the length of the HCV IRES. Aside from the increased risk of measuring artefacts in the yeast system, the IRES extended by another 120 codons of the viral polyprotein almost reaches the length that has been reported to suppress translation in mammalian cells (Wang et al., 2000Down). The extended length of the HCV IRES, along with probable low sensitivity and reproducibility of the strain/vector system used, could be one of the reasons for the observed high experiment-to-experiment variations of measured Miller units (Rosenfeld & Racaniello, 2005Down). In comparison to that system, the HCV IRES sequence used herein is extended by only 15 codons of the HCV polyprotein, which have been shown to be important for loop IV stability and for efficient HCV expression in mammals (Hwang et al., 1998Down; Jackson, 2000Down; Reynolds et al., 1995Down). Moreover, our system takes advantage of sensitive normalization to intracellular bicistronic transcript level by assaying activity of the firefly luciferase encoded by the first cistron of the bicistronic Fluc-IRES-GAL4 mRNA.

HCV IRES activity measured by the pFGAL4-based yeast system has been compared with the activity of various sets of controls, including several {lambda} DNA fragments of similar length and inverted and mutated versions of the HCV IRES. HCV IRES activity was 26 times higher than the almost basal activity of {lambda} phage DNA sequences spanning a window of similar length (Fig. 2Up). Initiation and termination codons appear very frequently in the randomized or naturally occurring non-coding nucleotide sequences. Indeed, the full-length HCV 5' UTR contains five AUG codons and numerous stop codons in all three reading frames. This is also the case with the intercistronic regions derived from {lambda} phage DNA. These data, together with the knowledge that yeast cap-dependent translation initiation starts almost exclusively at the first initiation codon and is sensitive to extensive RNA secondary structures such as the 13G : C hairpin or the HCV IRES itself, led us to the conclusion that yeast cells are able to support cap-independent translation initiation at the HCV IRES.

To dissect HCV IRES-dependent translation in yeast in more detail and to prove that the HCV IRES performs similarly in yeast and mammals, we mutated the authentic 342AUG to UUG, which reduced the HCV IRES activity to 22 % of that of the wild-type control (pFGAL4h-HCV1) in yeast (Fig. 5aUp). This result is comparable with our analysis of essentially the same mutation in Chang CCL-13 liver cells (Fig. 5bUp) and shows an even higher reduction of IRES activity than has been already described by Hwang et al. (1998)Down for the same mutation in Huh-7 hepatocytes. This result, together with the effect of the frameshift mutation in the HCV3 clone, further demonstrates the ability of the HCV IRES to mediate translation initiation in yeast cells and points to the importance of the HCV authentic 342AUG.

We also show that the disruption of stem–loop IV by deletion of the first 15 codons of the HCV polyprotein almost eliminates HCV IRES activity (Fig. 5aUp). However, we cannot distinguish in this case whether the elimination of HCV IRES activity is due to the disruption of stem–loop IV or whether there is some more general requirement for HCV polyprotein sequence. It is presumed that the permissiveness of reporter sequences to the HCV IRES-driven translation lies in the A-rich, unstructured character of the 5'-proximal region (Jackson, 2000Down). We performed an alignment of coding sequences for the first 15 aa of those reporters that were used most commonly to study HCV IRES function in mammalian systems and compared them with the HCV polyprotein sequence and with the sequences of those reporters used in yeast (Fig. 6Down). The yeast reporters share a higher degree of sequence similarity with the reporters that do not support translation mediated by the HCV IRES without the N-terminal fusion with HCV polyprotein sequence [summarized in detail by Fletcher et al. (2002)Down]. This analysis also explains why Rosenfeld & Racaniello (2005)Down, using LacZ as a second reporter, failed to detect any activity of the HCV IRES extended by only five codons.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 6. Alignment of coding sequences for the first 15 aa of the HCV polyprotein (this study) and selected reporters: luciferase (pGL3-basic, U47295), 3_CAT (Rijnbrand et al., 2001Down), Gal4p (NC_001148), 3_SAP (Rijnbrand et al., 2001Down), NS'_cistron (Reynolds et al., 1995Down) and lacZ (GenBank accession no. AP009048). Gaps introduced to optimize alignment are indicated by dashes and nucleotides that differ from the consensus sequence are indicated by dots. The conserved, unstructured, A-rich domain is boxed. The translation-permissive sequences are shown above the HCV polyprotein sequence and the non-permissive ones beneath.

 
Further, permutation of the 339ACC and authentic 342AUG codons (pFGAL4h-HCV1ACCAUG/AUGACC) represents little change in the AUG codon position within the loop IV and, as such, has only a moderate effect on IRES activity. Thus, as in mammalian cells, the HCV IRES also requires the intact stem–loop IV to promote protein synthesis in yeast, as well as being able to tolerate to some extent minor positional changes and conservative mutations of the initiation codon within loop IV (Honda et al., 1996Down; Rijnbrand et al., 1996Down).

In another set of control experiments, we focused on detection of Fluc-IRES-GAL4 mRNA integrity. Under certain circumstances, the yeast S. cerevisiae can utilize very short and simple sequences to initiate transcription from both regular and cryptic promoters (Hecht et al., 2002Down; Hellen & Sarnow, 2001Down; Robinson & Lopes, 2000Down). As a control, we compared the translational activities of the wild-type and inverted HCV IRESs in the bi- and tricistronic vectors (Fig. 3Up). We demonstrate here that inserting another short ORF in front of the HCV IRES or its inverted form shifted the activities proportionally down. This result shows that translation driven by the HCV IRES is not influenced significantly by cryptic transcription from the intercistronic region, because in the case of a cryptic promoter occurrence in this region, the measured IRES activities would not change by insertion of any other ORF upstream from the IRES, as has been done in tricistronic vectors. These functional in vivo assays are in good agreement with the result of quantification of bicistronic mRNA in yeast cells.

The observed similarities of HCV IRES-mediated translation between the mammalian and yeast systems promise future prospects for the use of yeast genetics for functional studies of the HCV IRES.


   ACKNOWLEDGEMENTS
 
We would like to thank to Martin Mokrejs, Ondrej Kolenaty and Vlasta Pelechova (Charles University, Prague, Czech Republic), Charles Rice (Rockefeller University, New York, USA), Phil James (University of Wisconsin-Madison, WI, USA) and Steve Button (British Council, Prague, Czech Republic) for their help. This work was supported by the Czech Science Foundation (grants no. 204/03/1487 and 301/07/0607), by the Grant Agency of Charles University (grant no. 251/2004/B-BIO/PrF) and by the Ministry of Education (grant no. MSM 0021620813).


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
 
Altmann, M., Blum, S., Pelletier, J., Sonenberg, N., Wilson, T. M. & Trachsel, H. (1990). Translation initiation factor-dependent extracts from Saccharomyces cerevisiae. Biochim Biophys Acta 1050, 155–159.[Medline]

Buratti, E., Tisminetzky, S., Zotti, M. & Baralle, F. E. (1998). Functional analysis of the interaction between HCV 5'UTR and putative subunits of eukaryotic translation initiation factor eIF3. Nucleic Acids Res 26, 3179–3187.[Abstract/Free Full Text]

Collier, A. J., Gallego, J., Klinck, R., Cole, P. T., Harris, S. J., Harrison, G. P., Aboul-Ela, F., Varani, G. & Walker, S. (2002). A conserved RNA structure within the HCV IRES eIF3-binding site. Nat Struct Biol 9, 375–380.[Medline]

Csank, C., Costanzo, M. C., Hirschman, J., Hodges, P., Kranz, J. E., Mangan, M., O'Neill, K., Robertson, L. S., Skrzypek, M. S. & other authors (2002). Three yeast proteome databases: YPD, PombePD, and CalPD (MycoPathPD). Methods Enzymol 350, 347–373.[Medline]

Dorokhov, Y. L., Skulachev, M. V., Ivanov, P. A., Zvereva, S. D., Tjulkina, L. G., Merits, A., Gleba, Y. Y., Hohn, T. & Atabekov, J. G. (2002). Polypurine (A)-rich sequences promote cross-kingdom conservation of internal ribosome entry. Proc Natl Acad Sci U S A 99, 5301–5306.[Abstract/Free Full Text]

Fletcher, S. P., Ali, I. K., Kaminski, A., Digard, P. & Jackson, R. J. (2002). The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes. RNA 8, 1558–1571.[Abstract]

Fukushi, S., Okada, M., Stahl, J., Kageyama, T., Hoshino, F. B. & Katayama, K. (2001). Ribosomal protein S5 interacts with the internal ribosomal entry site of hepatitis C virus. J Biol Chem 276, 20824–20826.[Abstract/Free Full Text]

Gietz, R. D. & Woods, R. A. (2002). Transformation of yeast by the Liac/ss carrier DNA/PEG method. Methods Enzymol 350, 87–96.[CrossRef][Medline]

Hecht, K., Bailey, J. E. & Minas, W. (2002). Polycistronic gene expression in yeast versus cryptic promoter elements. FEMS Yeast Res 2, 215–224.[Medline]

Hellen, C. U. & Sarnow, P. (2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev 15, 1593–1612.[Free Full Text]

Hershey, J. W. B. & Merrick, W. C. (2000). Pathway and mechanism of initiation of protein synthesis. In Translational Control of Gene Expression, pp. 33–88. Edited by N. Sonenberg, J. W. B. Hershey & M. B. Mathews. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Honda, M., Brown, E. A. & Lemon, S. M. (1996). Stability of a stem-loop involving the initiator AUG controls the efficiency of internal initiation of translation on hepatitis C virus RNA. RNA 2, 955–968.[Abstract]

Hwang, L. H., Hsieh, C. L., Yen, A., Chung, Y. L. & Chen, D. S. (1998). Involvement of the 5' proximal coding sequences of hepatitis C virus with internal initiation of viral translation. Biochem Biophys Res Commun 252, 455–460.[CrossRef][Medline]

Iizuka, N. & Sarnow, P. (1997). Translation-competent extracts from Saccharomyces cerevisiae: effects of L-A RNA, 5' cap, and 3' poly(A) tail on translational efficiency of mRNAs. Methods 11, 353–360.[CrossRef][Medline]

Iizuka, N., Najita, L., Franzusoff, A. & Sarnow, P. (1994). Cap-dependent and cap-independent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae. Mol Cell Biol 14, 7322–7330.[Abstract/Free Full Text]

Jackson, R. J. (2000). Comparative view of initiation site selection mechanisms. In Translational Control of Gene Expression, pp. 127–183. Edited by N. Sonenberg, J. W. B. Hershey & M. B. Mathews. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

James, P., Halladay, J. & Craig, E. A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 1425–1436.[Abstract]

Kieft, J. S., Zhou, K., Jubin, R. & Doudna, J. A. (2001). Mechanism of ribosome recruitment by hepatitis C IRES RNA. RNA 7, 194–206.[Abstract]

Kolupaeva, V. G., Pestova, T. V. & Hellen, C. U. (2000). An enzymatic footprinting analysis of the interaction of 40S ribosomal subunits with the internal ribosomal entry site of hepatitis C virus. J Virol 74, 6242–6250.[Abstract/Free Full Text]

Lancaster, A. M., Jan, E. & Sarnow, P. (2006). Initiation factor-independent translation mediated by the hepatitis C virus internal ribosome entry site. RNA 12, 894–902.[Abstract/Free Full Text]

Lohr, D., Venkov, P. & Zlatanova, J. (1995). Transcriptional regulation in the yeast GAL gene family: a complex genetic network. FASEB J 9, 777–787.[Abstract]

Lytle, J. R., Wu, L. & Robertson, H. D. (2001). The ribosome binding site of hepatitis C virus mRNA. J Virol 75, 7629–7636.[Abstract/Free Full Text]

Mokrejs, M., Vopalensky, V., Kolenaty, O., Masek, T., Feketova, Z., Sekyrova, P., Skaloudova, B., Kriz, V. & Pospisek, M. (2006). IRESite: database of experimentally verified IRES structures (www.iresite.org). Nucleic Acids Res 34, D125–D130.[Abstract/Free Full Text]

Otto, G. A., Lukavsky, P. J., Lancaster, A. M., Sarnow, P. & Puglisi, J. D. (2002). Ribosomal proteins mediate the hepatitis C virus IRES-HeLa 40S interaction. RNA 8, 913–923.[Abstract]

Paz, I., Abramovitz, L. & Choder, M. (1999). Starved Saccharomyces cerevisiae cells have the capacity to support internal initiation of translation. J Biol Chem 274, 21741–21745.[Abstract/Free Full Text]

Rajkowitsch, L., Vilela, C., Berthelot, K., Ramirez, C. V. & McCarthy, J. E. (2004). Reinitiation and recycling are distinct processes occurring downstream of translation termination in yeast. J Mol Biol 335, 71–85.[CrossRef][Medline]

Reynolds, J. E., Kaminski, A., Kettinen, H. J., Grace, K., Clarke, B. E., Carroll, A. R., Rowlands, D. J. & Jackson, R. J. (1995). Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J 14, 6010–6020.[Medline]

Reynolds, J. E., Kaminski, A., Carroll, A. R., Clarke, B. E., Rowlands, D. J. & Jackson, R. J. (1996). Internal initiation of translation of hepatitis C virus RNA: the ribosome entry site is at the authentic initiation codon. RNA 2, 867–878.[Abstract]

Rijnbrand, R., Bredenbeek, P., van der Straaten, T., Whetter, L., Inchauspe, G., Lemon, S. & Spaan, W. (1995). Almost the entire 5' non-translated region of hepatitis C virus is required for cap-independent translation. FEBS Lett 365, 115–119.[CrossRef][Medline]

Rijnbrand, R. C., Abbink, T. E., Haasnoot, P. C., Spaan, W. J. & Bredenbeek, P. J. (1996). The influence of AUG codons in the hepatitis C virus 5' nontranslated region on translation and mapping of the translation initiation window. Virology 226, 47–56.[CrossRef][Medline]

Rijnbrand, R., Bredenbeek, P. J., Haasnoot, P. C., Kieft, J. S., Spaan, W. J. & Lemon, S. M. (2001). The influence of downstream protein-coding sequence on internal ribosome entry on hepatitis C virus and other flavivirus RNAs. RNA 7, 585–597.[Abstract]

Robinson, K. A. & Lopes, J. M. (2000). The promoter of the yeast INO4 regulatory gene: a model of the simplest yeast promoter. J Bacteriol 182, 2746–2752.[Abstract/Free Full Text]

Rosenfeld, A. B. & Racaniello, V. R. (2005). Hepatitis C virus internal ribosome entry site-dependent translation in Saccharomyces cerevisiae is independent of polypyrimidine tract-binding protein, poly(rC)-binding protein 2, and La protein. J Virol 79, 10126–10137.[Abstract/Free Full Text]

Sizova, D. V., Kolupaeva, V. G., Pestova, T. V., Shatsky, I. N. & Hellen, C. U. (1998). Specific interaction of eukaryotic translation initiation factor 3 with the 5' nontranslated regions of hepatitis C virus and classical swine fever virus RNAs. J Virol 72, 4775–4782.[Abstract/Free Full Text]

Spahn, C. M., Kieft, J. S., Grassucci, R. A., Penczek, P. A., Zhou, K., Doudna, J. A. & Frank, J. (2001). Hepatitis C virus IRES RNA-induced changes in the conformation of the 40S ribosomal subunit. Science 291, 1959–1962.[Abstract/Free Full Text]

Thompson, S. R., Gulyas, K. D. & Sarnow, P. (2001). Internal initiation in Saccharomyces cerevisiae mediated by an initiator tRNA/eIF2-independent internal ribosome entry site element. Proc Natl Acad Sci U S A 98, 12972–12977.[Abstract/Free Full Text]

Tsukiyama-Kohara, K., Iizuka, N., Kohara, M. & Nomoto, A. (1992). Internal ribosome entry site within hepatitis C virus RNA. J Virol 66, 1476–1483.[Abstract/Free Full Text]

Wang, T. H., Rijnbrand, R. C. & Lemon, S. M. (2000). Core protein-coding sequence, but not core protein, modulates the efficiency of cap-independent translation directed by the internal ribosome entry site of hepatitis C virus. J Virol 74, 11347–11358.[Abstract/Free Full Text]

Wool, I. G., Chan, Y.-L. & Gluck, A. (1996). Mammalian ribosomes: the structure and the evolution of the proteins. In Translational Control, pp. 685–732. Edited by J. W. B. Hershey, M. B. Mathews & N. Sonenberg. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Received 11 December 2006; accepted 23 February 2007.


This article has been cited by other articles:


Home page
RNAHome page
V. Vopalensky, T. Masek, O. Horvath, B. Vicenova, M. Mokrejs, and M. Pospisek
Firefly luciferase gene contains a cryptic promoter
RNA, September 1, 2008; 14(9): 1720 - 1729.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masek, T.
Right arrow Articles by Pospisek, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masek, T.
Right arrow Articles by Pospisek, M.
Agricola
Right arrow Articles by Masek, T.
Right arrow Articles by Pospisek, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS