| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Short Communication |
Department of Pediatrics, Medical College of Virginia campus of Virginia Commonwealth University, 1101 E. Marshall Street, Richmond, Virginia 23298-0163, USA
Correspondence
Michael A. McVoy
mmcvoy{at}vcu.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT MAIN TEXTREFERENCES |
|---|
Supplementary material is available with the online version of this paper
|
MAIN TEXT |
|---|
|
TOPABSTRACTMAIN TEXTREFERENCES |
|---|
). This process is carried out by an enzyme called terminase. Phage terminases have two subunits (Black, 1989), while herpesvirus terminases appear to have three. The terminase subunits of human cytomegalovirus (HCMV) are UL51, UL56 and UL89. DNA translocation is believed to be ATP-dependent, and indeed, UL89 contains Walker A and B motifs (Walker et al., 1982) indicative of an ATP-binding pocket, but UL89 has not been shown to have ATPase activity in vitro. In contrast, a C-terminal portion of UL56 expressed in Escherichia coli has been shown to have ATPase activity (Hwang & Bogner, 2002) and mutations within a putative ATP-binding site decreased this activity (Scholz et al., 2003). However, the importance of these residues for viral replication has not been confirmed. Recently, peptides encoded by UL56a, an open reading frame (ORF) that overlaps much of UL56, have been detected in HCMV virions (Varnum et al., 2004), but the relevance of the UL56a gene product to terminase function or viral replication is not known.
To facilitate mutagenesis of the murine cytomegalovirus (MCMV) gene M56, the MCMV orthologue of the HCMV terminase subunit UL56, a cis complementation system was developed (Hahn et al., 2003) in which M56 was deleted from a bacterial artificial chromosome (BAC) clone of the MCMV genome, then complemented in cis by reintroduction of wild-type or mutant sequences at an ectopic location by site-specific Tn7-mediated transposition. BACs thus complemented were assessed for their ability to reconstitute viruses and the growth properties of such viruses were characterized.
BAC pSM3-117B, an infectious clone of the MCMV genome, contains a lacZ
-mini-attTn7 site that permits insertion of sequences into the attTn7 locus via Tn7-mediated transposition (Luckow et al., 1993). It was made from pSM3-117K by Flip recombinase-mediated removal of a kanamycin resistance (kn) marker (Hahn et al., 2003). BAC pSM3-117
M56 was constructed by replacing most of M56 (nucleotides 86 400–88 120; positions based on GenBank accession no. NC_004065
[GenBank]
) with kn (Fig. 1a). Briefly, kn from pACYC177 was PCR-amplified (Wang et al., 2008) using primers M56-pACYC177-F (GAACATGGGACCGTTGATGAAACGGTAGATCTGCTGCCCGAGCTGGGGCAGCAGCTCGGACGATTTATTCAACGAAGCC) and M56-pACYC177-R (GTCTGTGCGCGGTATGTATAAGCGGAGGGGTAGGGGAGTCGACCTGCTCGCGCGCAACGTGCCAGTGTTACAACCAATT). The product was DpnI-restricted then electroporated into pSM3-117B-containing E. coli strain DY380 cells that had been induced at 42 °C for 15 min to express 
recombinases (Yu et al., 2000). Colonies containing recombinant BACs were selected on plates containing 50 µg kanamycin ml–1, 50 µg chloramphenicol ml–1 and 50 µg tetracycline ml–1. One clone was designated pSM3-117M56 after confirmation of correct structure using the five PCRs illustrated in Fig. 1a (for primer sequences see Supplementary Table S1, available in JGV Online). Reaction A was predicted to amplify a 1840 bp product from pSM3-117B or a 1089 bp product from pSM3-117M56. Reactions B and C were predicted to produce 376 and 327 bp products from pSM3-117M56, respectively, but no products from pSM3-117B. Reactions D and E were predicted to produce 476 and 530 bp products from pSM3-117B, respectively, but no products from pSM3-117M56. That each reaction produced the predicted results (Fig. 1b) confirmed that pSM3-117M56 has the predicted structure and lacks a functional M56 locus. Transfection of pSM3-117M56 DNA into mouse NIH3T3 cells (Wang et al., 2008) failed to reconstitute an infectious virus, consistent with a critical role for M56 in viral replication.
|
) and has homology to UL56a. As the importance of M56a or its hypothetical protein product M56a were not known, and as the deletion in pSM3-117M56 disrupts both M56 and M56a (Fig. 1a), sequences from the M56a start to the M56 stop were included in efforts to complement the deletion. The Tn7 transposition shuttle pFastBac1 (Invitrogen) was modified to include the HCMV major immediate-early promoter (MIEP), a multiple cloning site for insertion of M56/M56a sequences, and a 3' IRES–gfp reporter (Fig. 2a). This shuttle, designated pMA178B, was made by ligation of annealed oligonucleotides MOL126/MOL127 into BamHI/HindIII-restricted pFastBac1 (Invitrogen), then restriction of the resulting plasmid with NdeI/MfeI and insertion of a 2.1 kb AseI/MfeI fragment from pIRES2-EGFP (Clontech). Shuttle plasmids containing wild-type or mutant M56/M56a sequences were subsequently constructed. The sequences of oligonucleotides used for plasmid construction are given in Supplementary Table S1. Sanger dideoxy sequencing was used to confirm the entire sequence of each M56/M56a insertion.
|
M56 to generate pSM3-117M56-t219, as described previously (Hahn et al., 2003). Briefly, pMA219 was transformed into E. coli strain DH10B containing pSM3-117M56 and helper plasmid pMON7124 (Luckow et al., 1993). Transformants were selected on plates containing 25 µg chloramphenicol ml–1, 50 µg kanamycin ml–1, 7 µg gentamicin ml–1, 10 µg tetracycline ml–1, 200 µg X-Gal ml–1, and 40 µg ml–1 IPTG and incubated for 48 h at 37 °C. White colonies in which lacZ was disrupted by transposition into the lacZ-mini-attTn7 site of pSM3-117M56 were further screened for correct transposition using three PCRs as previously described (Wang et al., 2008).
BAC pSM3-117M56-t219 was transfected into mouse NIH3T3 cells. Reconstitution of a virus designated RM219 was evidenced by the appearance of GFP positive/cytopathic effect positive foci 5–10 days post-transfection. The predicted genome structure of RM219 is shown in Fig. 2a. The sequence of the ectopic M56/M56a insertion in RM219 was confirmed by Sanger dideoxy sequencing of DNA isolated from virions as previously described (McVoy et al., 1998).
To compare the growth properties of RM219 with those of wild-type virus, NIH3T3 cells were infected at an m.o.i. of 0.1. Cells were washed 3 h post-infection and culture supernatants were collected daily and titrated by limiting dilution in 96-well plate cultures as described previously (Cui et al., 2008). The replication kinetics and efficiency of virus production were broadly comparable for MCMV RM219 to those of parental viruses SM3 (derived from pSM3) and RM117B (derived from pSM3-117B) (Fig. 3). Therefore, the ectopic M56/M56a sequences were able to complement in cis the deletion of native M56/M56a sequences without significant loss of viral replication efficiency.
|
). This was achieved by PCR amplification of pMA219 with primers MOL210b and MOL211, ligation of the product into pGEM-T Easy, and transfer of a 0.45 kb BssHII/NdeI fragment to BssHII/NdeI-restricted pMA219.
The sequences in pMA247 and pMA249 were transposed into pSM3-117M56 to produce pSM3-117M56-t247 and pSM3-117M56-t249, respectively. Both BACs reconstituted viruses (RM247 and RM249, respectively) that replicated with wild-type kinetics and efficiencies (Fig. 3). Sequencing of virion DNA confirmed that RM247 and RM249 retained their respective mutations within their ectopic M56/M56a sequences. Moreover, while PCR A amplified 1089 and 1840 bp products from RM219, RM247 and RM249 DNA, reaction E failed to amplify these DNAs yet produced an abundant 530 bp product from RM117B DNA (data not shown). Thus, the 1840 bp products of reaction A were presumably derived from the ectopic M56/M56a insertions while the native M56/M56a region remained disrupted in all three viruses. That the frame shift in M56a was maintained in virus RM249, yet caused no impairment in its replication, demonstrates that M56a is fully dispensable for viral replication.
ATPase activity has been demonstrated for the C-terminal portion of HCMV UL56 when expressed in E. coli (Hwang & Bogner, 2002). Residues 709–716 were proposed as a putative ATP-binding pocket and substitutions of residues within this region impaired the in vitro ATPase activity of the E. coli-expressed protein (Scholz et al., 2003). UL56 residues 709–716 are identical to M56 residues 674–681. To determine if this region is important for MCMV replication, the complementing M56 gene was modified to encode two amino acid changes, G679D and K680E (Fig. 2b). Plasmid pMA241 was constructed by PCR overlap extension. DNA from pMA219 was amplified using the primers MOL189 and MOL190 or MOL191 and MOL192 to generate overlapping products containing two nucleotide changes. The two products were then mixed and amplified again using primers MOL189 and MOL191. The resulting product was double-digested with BbvCI/BamHI and ligated into BbvCI/BamHI-restricted pMA219 to produce plasmid pMA241. Sequences from pMA241 were transposed into pSM3-117M56 to generate pSM3-117M56-t241. Repeated attempts to reconstitute virus from pSM3-117M56-t241 failed, suggesting that residues within the proposed ATP binding site are critical for the function of M56 during viral replication.
As antibodies have not been raised against M56, we sought to construct viruses encoding M56 fused with an N-terminal FLAG epitope tag. Plasmid pMA219 was PCR-amplified with MOL237 and MOL242 and the product ligated into pCR8/GW/TOPO (Invitrogen). A 2.4 kb EcoRI fragment was then excised and ligated into EcoRI-restricted pMA178B to produce plasmid pMA292. Transposition into pSM3-117M56 produced pSM3-117M56-t292, in which the native M56 AUG and upstream M56a sequences were replaced by sequences encoding an N-terminal FLAG epitope (Fig. 2b). Infectious virus could not be reconstituted from pSM3-117M56-t292, suggesting that the M56 protein was likely rendered non-functional by the N-terminal epitope fusion.
DNA maturation is an attractive target for the development of novel antivirals, and indeed, several compounds are known to block this process (Hwang et al., 2007; Krosky et al., 2000; Reefschlaeger et al., 2001; Underwood et al., 1998, 2004; van Zeijl et al., 2000). Future drug discovery efforts would benefit from a better understanding of the protein composition, structure and biochemical functions of terminase. Progress has been made in expressing terminase subunits and dissecting their biochemical activities in vitro. To test the importance of such activities for viral replication we developed a cis complementation system that facilitates mutagenic evaluation of the M56 terminase subunit. Deletion of the native M56/M56a locus was lethal, but could be efficiently complemented by transposition of an ectopic copy of M56/M56a sequences. As native M56 is most probably expressed with late kinetics while ectopic expression from the MIEP likely occurs with early or immediate early kinetics, this result suggests that the kinetics of M56 expression may not be critical.
Bacteriophage terminases use the energy from ATP hydrolysis to translocate DNA into capsids (Catalano, 2000; Feiss & Catalano 2005; Rao & Black, 2005). The large subunits contain Walker A and B box motifs that form ATP-binding pockets (Walker et al., 1982), and many have been shown to possess ATPase activities in vitro (Mitchell et al., 2002). Walker box motifs are highly conserved among the herpesvirus terminase subunits that include HCMV UL89 and its orthologue in herpes simplex virus type 1, UL15. Within these motifs, homology even extends to phage terminase large subunits (Davison, 1992; Mitchell et al., 2002; Przech et al., 2003). Although a mutation in the Walker A box of UL15 confirmed its importance for viral replication (Yu & Weller, 1998), ATPase activity has not been demonstrated for UL15, UL89 or their orthologues in other herpesviruses. In contrast, UL56 lacks canonical Walker box motifs or sequence homology with bacteriophage terminase subunits, but a C-terminal region of UL56 has been shown to have ATPase activity when expressed in E. coli (Hwang & Bogner, 2002), and mutations within a putative ATP-binding pocket affected a decrease in this activity (Scholz et al., 2003). That BAC pSM3-117M56-t241 containing similar mutations in M56 was unable to reconstitute an infectious virus confirms that residues within the proposed ATP-binding pocket are necessary for viral replication and supports the hypothesis that an ATPase-activity associated with this region (Scholz et al., 2003) is important for terminase function.
In 2004 Varnum et al. detected peptides within HCMV virions having amino acid sequences encoded by an unannotated ORF that was designated UL56a because it overlaps the UL56 gene (Varnum et al., 2004). We found that similar ORFs are conserved in MCMV, rat CMV, rhesus CMV, chimpanzee CMV and tupaia herpesvirus, and that they encode hypothetical proteins that are highly conserved at the amino acid level (Supplementary Fig. S1, available in JGV Online). While this suggests that these ORFs serve an important purpose, other herpesviruses, including guinea pig CMV, a close relative of MCMV and rat CMV (McGeoch et al., 2006), appear to lack UL56a homologues. Moreover, the strong nucleotide sequence conservation among the terminase genes that they overlap could account for the amino acid conservation observed in Supplementary Fig. S1. That virus RM249 replicates with wild-type efficiency in vitro clearly demonstrates that expression of the putative M56a protein is not important for replication of MCMV in cell culture. Why these overlapping ORFs have evolved in some viral genomes and what role the encoded proteins play in vivo remain to be determined.
In summary, amino acids proposed to function as an ATP-binding pocket and to mediate an ATPase activity of M56 were confirmed to be of critical importance for viral replication, and an overlapping ORF of unknown function (M56a) was shown to be dispensable. In the future, this system can provide a rapid genetic approach to complement progress made in defining the in vitro biochemical properties of terminase.
|
ACKNOWLEDGEMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTMAIN TEXTREFERENCES |
|---|
Brown, J. C., McVoy, M. A. & Homa, F. L. (2002). Packaging DNA into herpesvirus capsids. In Structure-Function Relationships of Human Pathogenic Viruses, pp. 111–154. Edited by A. Holzenburg & E. Bogner. New York: Kluwer Academic/Plenum Publishers.
Catalano, C. E. (2000). The terminase enzyme from bacteriophage lambda: a DNA-packaging machine. Cell Mol Life Sci 57, 128–148.[CrossRef][Medline]
Cui, X., McGregor, A., Schleiss, M. R. & McVoy, M. A. (2008). Cloning the complete guinea pig cytomegalovirus genome as an infectious bacterial artificial chromosome with excisable origin of replication. J Virol Methods 149, 231–239.[CrossRef][Medline]
Davison, A. J. (1992). Channel catfish virus: a new type of herpesvirus. Virology 186, 9–14.[CrossRef][Medline]
Feiss, M. & Catalano, C. E. (2005). Bacteriophage lambda terminase and the mechanisms of viral DNA packaging. In Viral Genome Packaging Machines: Genetics, Structure and Mechanism, pp. 5–39. Edited by C. E. Catalano. Austin, TX: Landes Biosciences.
Hahn, G., Jarosch, M., Wang, J. B., Berbes, C. & McVoy, M. A. (2003). Tn7-mediated introduction of DNA sequences into bacmid-cloned cytomegalovirus genomes for rapid recombinant virus construction. J Virol Methods 107, 185–194.[CrossRef][Medline]
Hwang, J. S. & Bogner, E. (2002). ATPase activity of the terminase subunit pUL56 of human cytomegalovirus. J Biol Chem 277, 6943–6948.
Hwang, J. S., Kregler, O., Schilf, R., Bannert, N., Drach, J. C., Townsend, L. B. & Bogner, E. (2007). Identification of acetylated, tetrahalogenated benzimidazole D-ribonucleosides with enhanced activity against human cytomegalovirus. J Virol 81, 11604–11611.
Krosky, P. M., Ptak, R. G., Underwood, M. R., Biron, K. K., Townsend, L. B. & Drach, J. C. (2000). Differences in DNA packaging genes and sensitivity to benzimidazole ribonucleosides between human cytomegalovirus strains AD169 and Towne. Antivir Chem Chemother 11, 349–352.[Medline]
Luckow, V. A., Lee, S. C., Barry, G. F. & Olins, P. O. (1993). Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J Virol 67, 4566–4579.
McGeoch, D. J., Rixon, F. J. & Davison, A. J. (2006). Topics in herpesvirus genomics and evolution. Virus Res 117, 90–104.[CrossRef][Medline]
McVoy, M. A., Nixon, D. E., Adler, S. P. & Mocarski, E. S. (1998). Sequences within the herpesvirus-conserved pac1 and pac2 motifs are required for cleavage and packaging of the murine cytomegalovirus genome. J Virol 72, 48–56.
Mitchell, M. S., Matsuzaki, S., Imai, S. & Rao, V. B. (2002). Sequence analysis of bacteriophage T4 DNA packaging/terminase genes 16 and 17 reveals a common ATPase center in the large subunit of viral terminases. Nucleic Acids Res 30, 4009–4021.
Przech, A. J., Yu, D. & Weller, S. K. (2003). Point mutations in exon I of the herpes simplex virus putative terminase subunit, UL15, indicate that the most conserved residues are essential for cleavage and packaging. J Virol 77, 9613–9621.
Rao, V. B. & Black, L. W. (2005). DNA Packaging in Bacteriophage T4. In Viral Genome Packaging Machines: Genetics, Structure, and Mechanism, pp. 40–58. Edited by C. E. Catalano. Austin, TX: Landes Biosciences.
Reefschlaeger, J., Bender, W., Hallenberger, S., Weber, O., Eckenberg, P., Goldmann, S., Haerter, M., Buerger, I., Trappe, J. & other authors (2001). Novel non-nucleoside inhibitors of cytomegaloviruses (BAY 38-4766): in vitro and in vivo antiviral activity and mechanism of action. J Antimicrob Chemother 48, 757–767.
Scholz, B., Rechter, S., Drach, J. C., Townsend, L. B. & Bogner, E. (2003). Identification of the ATP-binding site in the terminase subunit pUL56 of human cytomegalovirus. Nucleic Acids Res 31, 1426–1433.
Underwood, M. R., Harvey, R. J., Stanat, S. C., Hemphill, M. L., Miller, T., Drach, J. C., Townsend, L. B. & Biron, K. K. (1998). Inhibition of human cytomegalovirus DNA maturation by a benzimidazole ribonucleoside is mediated through the UL89 gene product. J Virol 72, 717–725.
Underwood, M. R., Ferris, R. G., Selleseth, D. W., Davis, M. G., Drach, J. C., Townsend, L. B., Biron, K. K. & Boyd, F. L. (2004). Mechanism of action of the ribopyranoside benzimidazole GW275175X against human cytomegalovirus. Antimicrob Agents Chemother 48, 1647–1651.
van Zeijl, M., Fairhurst, J., Jones, T. R., Vernon, S. K., Morin, J., LaRocque, J., Feld, B., O'Hara, B., Bloom, J. D. & Johann, S. V. (2000). Novel class of thiourea compounds that inhibit herpes simplex virus type 1 DNA cleavage and encapsidation: resistance maps to the UL6 gene. J Virol 74, 9054–9061.
Varnum, S. M., Streblow, D. N., Monroe, M. E., Smith, P., Auberry, K. J., Pasa-Tolic, L., Wang, D., Camp, D. G., II, Rodland, K. & other authors (2004). Identification of proteins in human cytomegalovirus (HCMV) particles: the HCMV proteome. J Virol 78, 10960–10966.
Walker, J. E., Saraste, M., Runswick, M. J. & Gay, N. J. (1982). Distantly related sequences in the - and β-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945–951.[Medline]
Wang, J. B., Nixon, D. E. & McVoy, M. A. (2008). Definition of the minimal cis-acting sequences necessary for genome maturation of the herpesvirus murine cytomegalovirus. J Virol 82, 2394–2404.
Yu, D. & Weller, S. K. (1998). Genetic analysis of the UL15 gene locus for the putative terminase of herpes simplex virus type 1. Virology 243, 32–44.[CrossRef][Medline]
Yu, D., Ellis, H. M., Lee, E. C., Jenkins, N. A., Copeland, N. G. & Court, D. L. (2000). An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A 97, 5978–5983.
Received 15 April 2008;
accepted 25 June 2008.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
