|
|
||||||||
Short Communication |
Laboratory of Molecular Medicine and Neuroscience, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892, USA
Correspondence
Eugene O. Major
majorg{at}ninds.nih.gov
| ABSTRACT |
|---|
|
|
|---|
| MAIN TEXT |
|---|
|
|
|---|
Host-cell nuclear transcription factors are required for the activation of the JCV promoter/enhancer (Nathanson et al., 1997
; Raj & Khalili, 1995
). Nucleotide sequences that act as transcriptional promoters are located immediately upstream of the origin of DNA replication (Delbue et al., 2005
; Nathanson et al., 1997
). These sequences include the TATA box and binding sites for Sp1, YB1, sup2, Pur-
and NF-1. The NF-1 site is directly adjacent to an AP-1 or c-jun/c-fos site (Ciappi et al., 1999
; Ravichandran et al., 2006
). The nuclear transcription factor recognition sites are duplicated in the tandem repeat arrangement found in JCV isolates that support viral expression in permissible cells (Delbue et al., 2005
). These transcription factors are required for activation of the JCV promoter/enhancer. Cell-specific expression of JCV has been associated with several transcription factors, but the mechanisms through which the JCV promoter is controlled by these transcription factors are poorly understood.
The nuclear transcription factor NF-1 is an example of a cell-specific regulator of JCV promoter/enhancer activity (Chen & Khalili, 1995
). The NF-1 transcription family of DNA-binding proteins (NF-1A, NF-1B, NF-1C and NF-1X) is encoded by four genes (Gronostajski, 2000
; Kruse et al., 1991
; Kruse & Sippel, 1994
; Sumner et al., 1996
). Many NF-1-binding sites are found in the JCV promoter/enhancer region (Amemiya et al., 1992
; Ciappi et al., 1999
; Jeang et al., 1987
; Tamura et al., 1988
). Products of the four NF-1 genes form homo- and heterodimers that bind to the canonical NF-1-binding site with apparently identical affinities (Gronostajski, 2000
). Mutations in the NF-1-binding sites reduce JCV expression (Amemiya et al., 1989
). We have shown previously that the level of expression of NF-1 proteins differs in JCV-permissive and -non-permissive cells (Messam et al., 2003
). Human progenitor-derived astrocyte cells that support JCV infection expressed high levels of NF-1X when compared with the non-permissive cell line HeLa. JCV-susceptible cells showed higher levels of NF-1X and lower levels of NF-1A compared with JCV-non-susceptible cells.
While all NF-1 proteins appear to bind to the same DNA sequence, differences in function among NF-1 gene products have been observed in a number of systems. The promoters of several genes were shown to be activated by NF-1 proteins (Bisgrove et al., 2000
; Jones et al., 1987
; Shaul et al., 1986
). Genes that are negatively regulated by NF-1 also exist (Fazi et al., 2005
; Kleene et al., 2001
; Wong et al., 2007
). Since NF-1A is shown to function as a negative regulator of many genes, the current study aims to determine whether higher levels of NF-1A expressed in JCV-non-susceptible cells act as a negative regulator for JCV multiplication. We used different techniques to decrease the level of NF-1A in JCV-non-susceptible cell types and observed an increase in JCV multiplication. This indicates an essential negative regulatory role of NF-1A in JCV tropism.
Human brain-derived progenitor cells (referred to here as progenitors) were obtained from the telencephalon of an 8-week gestational fetal brain, in accordance with NIH guidelines as described previously (Messam et al., 2003
). Progenitor cultures grown at 10–40 % confluence were at least 98 % positive for nestin staining and did not express glial fibrillary acidic protein (GFAP). Differentiation of progenitors into an astrocytic lineage (referred to as progenitor-derived astrocytes; PDA) was initiated by culture medium substitution as described before (Messam & Major, 2000
). HeLa cells were grown with MEM supplemented with 10 % fetal bovine serum. For induction of TGF-β1 signalling, cultures were treated with 5 ng recombinant TGF-β1 ml–1 (R&D Systems). Progenitor, PDA or HeLa cultures were exposed to JCV (Mad-4 variant) at 100 haemagglutination units (HAU) per 5x105 cells in a minimal covering of appropriate serum-free medium. After overnight JCV exposure, cultures were washed and replenished with appropriate fresh media. All JCV-exposed cultures were processed 4 days after JCV exposure.
siRNA against NF-1A or NF-1B (Dharmacon) or control siRNA (SantaCruz) (final concentration of 10 nM) was used to transfect cells using appropriate nucleofector reagents (Amaxa, Inc.). Human miR-223 (hsa-miR-223; Dharmacon) was transfected into progenitor cells (final concentration 10 nM) using nucleofector reagent (Amaxa, Inc.). At 16 h post-transfection, the culture medium was replaced with fresh medium containing JCV at 100 HAU per 5x105 cells. After 8 h of JCV exposure, viral medium was removed by aspiration, the cells were washed once and fresh medium was added.
Four days after the transfection (3 days after JCV exposure), nuclear fractions or whole-cell lysates were prepared for use in Western blot experiments with appropriate antibodies as described before (Ravichandran et al., 2007
). The antibodies used were: anti-JCV-VP-1 (rabbit polyclonal antibody developed in our laboratory), anti-JVC-VP-1 (monoclonal; Novocastra), anti-SV40 T-antigen (Oncogene), anti-β-actin (Sigma), anti-NF-1A (Geneka/Active Motif), anti-NF-1B (Geneka/Active Motif) and anti-NF-1X (Geneka/Active Motif). Bound primary antibodies were detected using either an anti-rabbit or anti-mouse horseradish peroxidase-conjugated secondary antibody combined with the SuperSignal West Pico Chemiluminescent substrate kit (Pierce), according to the manufacturer's protocol.
RT-PCR was performed as follows. Four days after the transfection of miR-223 into progenitor cells, total RNA was isolated using the RNeasy total RNA isolation system (Qiagen) followed by treatment for 60 min with DNase I [10 U (µg RNA)–1; Boehringer Mannheim]. First-strand cDNA synthesis was performed on 1 µg total RNA using oligo dT primers and Superscript II reverse transcriptase (Invitrogen). cDNA product (2 µl) served as the template for specific PCR amplification. The PCR primers for NFI-A were 5'-GTCAGCTTCACTTGGCTGGC (5' primer) and 5'-AGCTTTATCTTTCCGTAACTTGGCCCGGATATCAAGGCCAAGTTACGGAAAGATATCG (3' primer). PCR amplification consisted of 30 cycles of 30 s at 95 °C, 30 s at 55 °C and 1 min at 72 °C using a Perkin-Elmer 2400 thermal cycler. PCR products (20 µl) were subjected to 1.5 % agarose gel electrophoresis, stained with ethidium bromide and photographed.
Four days after the transfection of miR-223 into progenitor cells (3 days after JCV exposure) or 4 days after treatments with or without TGF-β1, HeLa cells grown with JCV on chamber slides were fixed with 4 % paraformaldehyde in PBS for 20 min at room temperature and permeabilized with 0.2 % Triton in PBS for 10 min at room temperature. Blocking, probing and visualization were done as described previously (Ravichandran et al., 2007
).
Because of the differentiation of JCV-non-susceptible progenitors into JCV-susceptible PDAs, we examined the role of NF-1 protein levels in these cell types. Differentiation of progenitor cells into PDA was accompanied by a gradual increase in the level of NF-1X. Notably, levels of NF-1A and NF-1B decreased (Fig. 1a
). Our observation that progenitor cells express very low levels of NF-1X protein supports our previous study, which showed an essential role of NF-1X protein in JCV multiplication.
|
To examine the negative role of NF-1A in JCV multiplication, another JCV-non-susceptible cell type, HeLa, was studied. Addition of TGF-β1 to HeLa in the presence of JCV showed increased JCV multiplication, as observed by increased VP-1 protein in immunofluorescence experiments (Fig. 2a
) as well as in a Western blot (Fig. 2b
). Further, the reduction of the level of NF-1A protein in HeLa cells by siRNA resulted in JCV multiplication (Fig. 2c
). Based on the observation by Fazi et al. (2005)
that miR-223 regulates the NF-1A protein level, we transfected hsa-miR-223 into progenitor cells and found a decrease in the level of NF-1A protein without affecting the mRNA level. This reduction in NF-1A protein was accompanied by an increase in JCV multiplication, as measured by Western blot (Fig. 3a
) as well as immunofluorescence experiments (Fig. 3b
). Taken together, our data demonstrate that any means of reducing the abundance of NF-1A protein in JCV-non-permissive cells leads to an increase in JCV multiplication (Fig. 3c
).
|
|
Even though the four NF-1 genes are expressed in broadly overlapping patterns in different cell types, there are apparently unique mechanisms for expression of individual members of the NF-1 family. Since all NF-1 proteins bind to the same DNA binding region but differ in their promoter-specific activation and repression of transcription, the association of NF-1 proteins with the JCV DNA may be proportionate to the availability of an individual member of the NF-1 family. Our study shows that NF-1A and NF-1B proteins are abundant in JCV-non-susceptible progenitor cells. During the differentiation into JCV-susceptible PDA, the levels of NF-1A and NF-1B protein decreased significantly. Also, our anchored-JCV–promoter assay using the progenitor and PDA nuclear extract showed association of NF-1A, NF-1B or NF-1X in proportion to the level of protein (not shown). Hence, we assumed that binding of NF-1A or NF-1B from the (JCV-non-susceptible) progenitor cells at the JCV promoter might act as a transcriptional repressor of JCV-encoded gene expression. This is confirmed by our results, which also indicate that a reduction of the level of NF-1A protein in progenitor cells leads to susceptibility to JCV multiplication. Further, to extend an earlier report that TGF-β1 increased JCV multiplication in progenitor cells, we observed a decrease in NF-1A levels after TGF-β1 treatment. There was, however, no increase in the level of NF-1X protein.
Since the reduction of the level of NF-1A protein by siRNA led to an increase in NF-1B protein as well as JCV susceptibility, a proactive role of NF-1B was considered. However, a reduction of the level of NF-1B protein by siRNA was also associated with an increase in NF-1A and a subsequent decrease in JCV susceptibility. To overcome this reciprocal effect, we transfected progenitor cells with NF-1B-encoding plasmids, and found that overexpression of NF-1B protein did not lead to JCV multiplication (not shown). The reduction of levels of NF-1A protein during the differentiation of progenitor into PDA that leads to JCV susceptibility suggests that progenitor cells, with higher levels of NF-1A, experience a negative regulatory effect of NF-1A on JCV gene transcription. The promoters of several genes have been shown to be positively or negatively regulated by NF-1 protein; in particular, NF-1A-mediated transcriptional suppression of many genes has been reported (Wong et al., 2007
).
Furthermore, HeLa cells, which do not show JCV susceptibility, also express higher levels of NF-1A protein. Significantly, the addition of TGF-β1 resulted in JCV activity in HeLa cells, which do not normally support JCV activity. This increase in JCV activity was also associated with a decrease in NF-1A protein. Further, these results raise the possibility that, even though specific cellular receptors are important for JCV internalization, regulatory factors that act at the nuclear level are central to JCV multiplication. The observation that JCV-non-permissive cells, which express high levels of NF-1A, could also be infected with JCV by reducing the level of NF-1A protein supports the negative regulatory role of NF-1A on JCV multiplication. Our results show the important cell-specific regulatory mechanisms of NF-1A proteins in the control of JCV multiplication.
| ACKNOWLEDGEMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amemiya, K., Traub, R., Durham, L. & Major, E. O. (1992). Adjacent nuclear factor-1 and activator protein binding sites in the enhancer of the neurotropic JC virus. A common characteristic of many brain-specific genes. J Biol Chem 267, 14204–14211.
Astrom, K. E., Mancall, E. L. & Richardson, E. P. (1958). Progressive multifocal leukoencephalopathy; a hitherto unrecognized complication of chronic lymphatic leukaemia and Hodgkin's disease. Brain 81, 93–127.
Berger, J. R. & Major, E. O. (1999). Progressive multifocal leukoencephalopathy. Semin Neurol 19, 193–200.[Medline]
Bisgrove, D. A., Monckton, E. A., Packer, M. & Godbout, R. (2000). Regulation of brain fatty acid-binding protein expression by differential phosphorylation of nuclear factor I in malignant glioma cell lines. J Biol Chem 275, 30668–30676.
Chen, N. N. & Khalili, K. (1995). Transcriptional regulation of human JC polyomavirus promoters by cellular proteins YB-1 and Pur alpha in glial cells. J Virol 69, 5843–5848.[Abstract]
Ciappi, S., Azzi, A., De Santis, R., Leoncini, F., Sterrantino, G., Mazzotta, F. & Mecocci, L. (1999). Archetypal and rearranged sequences of human polyomavirus JC transcription control region in peripheral blood leukocytes and in cerebrospinal fluid. J Gen Virol 80, 1017–1023.[Abstract]
Delbue, S., Sotgiu, G., Fumagalli, D., Valli, M., Borghi, E., Mancuso, R., Marchioni, E., Maserati, R. & Ferrante, P. (2005). A case of a progressive multifocal leukoencephalopathy patient with four different JC virus transcriptional control region rearrangements in cerebrospinal fluid, blood, serum, and urine. J Neurovirol 11, 51–57.[CrossRef][Medline]
Fazi, F., Rosa, A., Fatica, A., Gelmetti, V., De Marchis, M. L., Nervi, C. & Bozzoni, I. (2005). A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis. Cell 123, 819–831.[CrossRef][Medline]
Gronostajski, R. M. (2000). Roles of the NFI/CTF gene family in transcription and development. Gene 249, 31–45.[CrossRef][Medline]
Hamilton, R. S., Gravell, M. & Major, E. O. (2000). Comparison of antibody titers determined by hemagglutination inhibition and enzyme immunoassay for JC virus and BK virus. J Clin Microbiol 38, 105–109.
Imperiale, M. J. & Major, E. O. (2007). Polyomaviruses. In Field's Virology, 5th edn, pp. 2263–2298. Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, S. E. Straus, M. A. Martin & B. Roizman. New York: Lippincott, Williams & Wilkins.
Jeang, K. T., Rawlins, D. R., Rosenfeld, P. J., Shero, J. H., Kelly, T. J. & Hayward, G. S. (1987). Multiple tandemly repeated binding sites for cellular nuclear factor 1 that surround the major immediate-early promoters of simian and human cytomegalovirus. J Virol 61, 1559–1570.
Jones, K. A., Kadonaga, J. T., Rosenfeld, P. J., Kelly, T. J. & Tjian, R. (1987). A cellular DNA-binding protein that activates eukaryotic transcription and DNA replication. Cell 48, 79–89.[CrossRef][Medline]
Kleene, R., Yang, H., Kutsche, M. & Schachner, M. (2001). The neural recognition molecule L1 is a sialic acid-binding lectin for CD24, which induces promotion and inhibition of neurite outgrowth. J Biol Chem 276, 21656–21663.
Kruse, U. & Sippel, A. E. (1994). Transcription factor nuclear factor I proteins form stable homo- and heterodimers. FEBS Lett 348, 46–50.[CrossRef][Medline]
Kruse, U., Qian, F. & Sippel, A. E. (1991). Identification of a fourth nuclear factor I gene in chicken by cDNA cloning: NFI-X. Nucleic Acids Res 19, 6641
Messam, C. A. & Major, E. O. (2000). Stages of restricted HIV-1 infection in astrocyte cultures derived from human fetal brain tissue. J Neurovirol 6 (Suppl. 1), S90–S94.[Medline]
Messam, C. A., Hou, J., Gronostajski, R. M. & Major, E. O. (2003). Lineage pathway of human brain progenitor cells identified by JC virus susceptibility. Ann Neurol 53, 636–646.[CrossRef][Medline]
Nathanson, N., Ahmed, R., Gonzalez-Scarano, F., Griffin, D. E., Holmes, K., Murphy, F. & Robinson, H. (editors) (1997). Viral Pathogenesis. New York: Lippincott–Raven.
Raj, G. V. & Khalili, K. (1995). Transcriptional regulation: lessons from the human neurotropic polyomavirus, JCV. Virology 213, 283–291.[CrossRef][Medline]
Ravichandran, V., Sabath, B. F., Jensen, P. N., Houff, S. A. & Major, E. O. (2006). Interactions between c-Jun, nuclear factor 1, and JC virus promoter sequences: implications for viral tropism. J Virol 80, 10506–10513.
Ravichandran, V., Jensen, P. N. & Major, E. O. (2007). MEK1/2 inhibitors block basal and transforming growth factor 1beta1-stimulated JC virus multiplication. J Virol 81, 6412–6418.
Shaul, Y., Ben-Levy, R. & De-Medina, T. (1986). High affinity binding site for nuclear factor I next to the hepatitis B virus S gene promoter. EMBO J 5, 1967–1971.[Medline]
Sumner, C., Shinohara, T., Durham, L., Traub, R., Major, E. O. & Amemiya, K. (1996). Expression of multiple classes of the nuclear factor-1 family in the developing human brain: differential expression of two classes of NF-1 genes. J Neurovirol 2, 87–100.[Medline]
Tamura, T., Inoue, T., Nagata, K. & Mikoshiba, K. (1988). Enhancer of human polyoma JC virus contains nuclear factor I-binding sequences; analysis using mouse brain nuclear extracts. Biochem Biophys Res Commun 157, 419–425.[CrossRef][Medline]
Walker, D. L. & Padgett, B. L. (1983). The epidemiology of human polyomaviruses. Prog Clin Biol Res 105, 99–106.[Medline]
Wong, Y. W., Schulze, C., Streichert, T., Gronostajski, R. M., Schachner, M. & Tilling, T. (2007). Gene expression analysis of nuclear factor I-A deficient mice indicates delayed brain maturation. Genome Biol 8, R72[CrossRef][Medline]
Yousry, T. A., Major, E. O., Ryschkewitsch, C., Fahle, G., Fischer, S., Hou, J., Curfman, B., Miszkiel, K., Mueller-Lenke, N. & other authors (2006). Evaluation of patients treated with natalizumab for progressive multifocal leukoencephalopathy. N Engl J Med 354, 924–933.
Received 2 January 2008;
accepted 18 February 2008.
This article has been cited by other articles:
![]() |
M. K. White, M. Safak, and K. Khalili Regulation of Gene Expression in Primate Polyomaviruses J. Virol., November 1, 2009; 83(21): 10846 - 10856. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mahon, B. Liang, I. Tikhanovich, J. R. Abend, M. J. Imperiale, H. P. Nasheuer, and W. R. Folk Restriction of Human Polyomavirus BK Virus DNA Replication in Murine Cells and Extracts J. Virol., June 1, 2009; 83(11): 5708 - 5717. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |