J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Gen Virol 89 (2008), 2315-2330; DOI 10.1099/vir.0.2008/001412-0

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Y.-R.
Right arrow Articles by Wang, C.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Y.-R.
Right arrow Articles by Wang, C.-H.
Agricola
Right arrow Articles by Chen, Y.-R.
Right arrow Articles by Wang, C.-H.

Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus

Yun-Ru Chen1,{dagger}, Chih-Yu Wu1,{dagger}, Song-Tay Lee2,{dagger}, Yan-Jheng Wu2, Chu-Fang Lo3, Meng-Feng Tsai4 and Chung-Hsiung Wang1

1 Department of Entomology, National Taiwan University, Taipei, Taiwan, ROC
2 Department of Biotechnology, Southern Taiwan University of Technology, No. 1 Nantai Street, Yung-Kang City, Tainan 710, Taiwan, ROC
3 Department of Zoology, National Taiwan University, Taipei, Taiwan, ROC
4 Department of Molecular Biotechnology, Dayeh University, No. 112 Shanjiao Road, Dacun, Changhua, Taiwan, ROC

Correspondence
Chung-Hsiung Wang
wangch{at}ccms.ntu.edu.tw
Chu-Fang Lo
gracelow{at}ntu.edu.tw


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
The complete genome of the Maruca vitrata nucleopolyhedrovirus (MaviNPV) isolated from the legume pod borer, Maruca vitrata (Lepidoptera: Pyralidae), was sequenced. It was found to be 111 953 bp in length, with an overall 39 % G+C content, and contained 126 open reading frames (ORFs) encoding predicted proteins of over 50 aa. The gene content and gene order of MaviNPV have the highest similarity to those of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and their shared homologous genes are 100 % collinear. In fact, MaviNPV seems to be a mini-AcMNPV that is native to Taiwan and possesses a smaller genome with fewer auxiliary genes than the AcMNPV type species. Except for one ORF (Mv74), all of the MaviNPV ORFs have homologues in the AcMNPV genome. MaviNPV is the first lepidopteran-specific baculovirus to lack homologues of vfgf and odv-e66. In addition, MaviNPV lacks the baculovirus repeat ORF (bro) gene that corresponds to AcMNPV ORF2. Five homologous regions (hrs) were located within the MaviNPV genome, and these contained a total of 44 imperfect palindromes. Phylogenetic analysis of the whole genome revealed that MaviNPV was separated from the common ancestor of AcMNPV and Bombyx mori nucleopolyhedrovirus before these two viral species diverged from each other. Moreover, replication of MaviNPV in several cell lines and an egfp–MaviNPV infection assay revealed that IPLB-LD-652Y cells are only partially permissive to MaviNPV, which supports our conclusion that MaviNPV is a distinct species of the group I lepidopteran NPVs.

{dagger}These authors contributed equally to this work. Back

The GenBank/EMBL/DDBJ accession number for the complete genome sequence of MaviNPV reported in this paper is EF125867.


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
The legume pod borer, Maruca vitrata (Lepidoptera: Pyralidae), is a pantropical pest of legume crops, particularly cowpea (Jackai, 1995Down), pigeonpea (Shanower et al., 1999Down) and beans (Abate & Ampofo, 1996Down). In the 1990s, infestation rates reached 50–80 % for cowpea in West Africa (Afun et al., 1991Down; Dreyer et al., 1994Down). Most nucleopolyhedroviruses (NPVs) studied so far are pathogenic for insect species of the orders Lepidoptera, Diptera and Hymenoptera (Theilmann et al., 2005Down). A new baculovirus isolated from M. vitrata (M. vitrata nucleopolyhedrovirus, MaviNPV) has great potential to allow us to investigate the biological control of this pest (Lee et al., 2007Down). The family Baculoviridae is subdivided into two genera, Nucleopolyhedrovirus (NPV) and Granulovirus (GV). Based on the polyhedrin (polh) gene, NPVs are further subdivided into group I and group II (Bulach et al., 1999Down; Herniou et al., 2001Down, 2003Down). Recent evidence shown from the comparison of 29 baculovirus genomes indicates that baculovirus phylogeny is aligned with the classification of the hosts more closely than with morphological traits (Afonso et al., 2001Down; Garcia-Maruniak et al., 2004Down; Lauzon et al., 2004Down; Jehle et al., 2006Down). An updated classification of the family Baculoviridae, which includes four genera – Alphabaculovirus (lepidopteran-specific NPV), Betabaculovirus (lepidopteran-specific GV), Gammabaculovirus (hymenopteran-specific NPV) and Deltabaculovirus (dipteran-specific NPV) – was thus proposed (Lauzon et al., 2004Down; Jehle et al., 2006Down). Using whole genome sequence data to compare the genetic makeup of different baculoviruses may help to determine which genes are essential for these viruses and help in understanding host range, virulence and morphology. Genes found in all baculoviruses are more likely to be essential genes, while auxiliary genes found in only some baculoviruses may give viruses a selective advantage in nature (O'Reilly, 1997Down).

The type species of the genus Nucleopolyhedrovirus is Autographa californica multiple nucleopolyhedrovirus (AcMNPV). This virus can infect more than 33 species of Lepidoptera (Groener, 1986Down) and a wide variety of lepidopteran cell lines (Hink, 1970Down; Hink & Hall, 1989Down; Goodman & McIntosh, 1994Down; McIntosh et al., 2005Down). In contrast, most NPVs generally have a more restricted host range, for example, Bombyx mori nucleopolyhedrovirus (BmNPV) replicates strongly in Bm5 cells or larvae, but only weakly in Sf9 cells (Martin & Croizier, 1997Down); Lymantria xylina multiple nucleopolyhedrovirus (LyxyMNPV) replicates only in Lymantria dispar and Lymantria xylina cells (Wu & Wang, 2005Down, 2006Down). Limits on the host range of baculoviruses appear to be controlled and influenced by the cell's factors (Miller & Lu, 1997Down).

The apparent size of the MaviNPV genome (111.95 kbp in this study) is smaller than that of AcMNPV (133.9 kbp) (Ayres et al., 1994Down) and BmNPV (128.4 kbp) (Gomi et al., 1999Down). Based on the sequences of 29 baculoviral core genes in phylogenetic analyses in this study, MaviNPV belongs to group I NPVs and is closely related to AcMNPV and BmNPV.

In this report, in addition to describing the whole genomic sequence and gene structure, and performing a phylogenetic analysis, we also investigated the replicative host range of MaviNPV in lepidopteran cell lines using wild-type and egfp recombinant MaviNPV.


   METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Insect cell lines, virus and viral DNA.
Lymantria dispar cell line [IPLB-LD-652Y; Goodwin et al., 1978Down (LD)], Perina nuda cell line [NTU-PN-HH; Wang et al., 1996Down (PN)], Lymantria xylina cell line [NTU-LY4; Wu & Wang, 2006Down (LY)] and M. vitrata cell line [NTU-MV56; Yeh et al., 2007Down (MV)] were cultured in TNM-FH medium (Hink & Strauss, 1976Down) at 28 °C. The medium contained 8 % fetal bovine serum (FBS) supplemented with 50 IU penicillin ml–1, 50 µg streptomycin ml–1 and 1.25 µg fungizone ml–1. Sf9 cells were cultured in SF900 medium (Gibco) at 28 °C. An MaviNPV clone (MV-8) was isolated using MV cells and used for mass production. In addition to the wild-type MaviNPV, the methods of Summers & Smith (1987)Down were used to construct an egfp recombinant MaviNPV (egfp–MaviNPV, in which the egfp gene is driven by the MaviNPV pol promoter). Virus titres were determined following the protocol described by Summers & Smith (1987)Down. Viral occlusion bodies (OBs) and viral DNA were prepared according to a procedure of Yeh et al. (2007)Down. Quantity and quality of extracted DNA were determined spectrophotometrically and by electrophoresis in 0.7 % agarose.

Nucleotide sequence determination.
The MaviNPV genome was sequenced to eightfold coverage by a shotgun approach. The viral DNA was sheared by nebulization into fragments with an average size of 2000 bp (HybroShear; GeneMachines). DNA fragments were size fractionated by gel electrophoresis and cloned into the EcoRV site of pBluescript II SK(–) (Stratagene). Sequencing was performed by ABI 3730 DNA Analyser (Applied Biosystems) then compiled into contigs using the PHRED/PHRAP software package (Ewing & Green, 1998Down; Ewing et al., 1998Down). The assembled sequences were then edited and completed using the Sun workstation interface (Bonfield et al., 1995Down).

DNA sequence analysis.
Open reading frames (ORFs) were identified using GeneWorks software (IntelliGenetics) and ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) (Wheeler et al., 2003Down). The criterion for defining an ORF was a size of at least 150 nt (50 aa) with minimal overlap. In addition, the genome was checked in detail for the presence of any ORFs similar to AcMNPV (Ayres et al., 1994Down) or any other baculovirus in GenBank. Homology searches were done through the National Centre for Biotechnology Information website using the BLAST program (Altschul et al., 1990Down). Multiple alignments and percentage identities of all MaviNPV ORFs with their homologues in selected genomes were generated using CLUSTAL_X (Thompson et al., 1997Down). Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html) was used to locate and analyse the homologous regions (hrs). Gene parity plot analysis was performed on the MaviNPV genome in comparison to the genomes of AcMNPV, BmNPV, Lymantria dispar multiple nucleopolyhedrovirus (LdMNPV) and Cydia pomonella granulovirus (CpGV) as described previously (Hu et al., 1998Down).

Phylogenetic analysis.
A phylogenetic tree was inferred from a dataset of combined amino acid sequences of the 29 baculovirus core genes (Herniou et al., 2003Down; Jehle et al., 2006Down) of the 33 baculoviruses that had been completely sequenced at the time of analysis (Supplementary Table S1 available in JGV Online). Neighbour-joining (NJ) and maximum-parsimony (MP) analyses were performed using MEGA, version 3.1 (Kumar et al., 2004Down). Culex nigripalpus nucleopolyhedrovirus (CuniNPV) was selected as the outgroup. Bootstrap analyses were performed to evaluate the robustness of the phylogenies using 1000 replicates for both NJ and MP analyses.

MaviNPV infection assay.
The MV, Sf9, PN, LY and LD insect cell lines (3x106 cells in T25 flask) were incubated with MaviNPV (m.o.i. of 10) for 1 h at 28 °C, and then washed twice with medium. After washing, 5 ml fresh medium was added to the cells which were incubated at 28 °C. Total RNA was extracted by Trizol (Invitrogen) at 0, 72 and 168 h post-infection (p.i.) according to the product manual. The cDNA samples were prepared following Liu et al. (2005)Down for real-time PCR analysis to detect the expression of the representative early, late and very late stage genes: ie-1, vp39 and polh, respectively. Primer sets IE1-q-f: 5'-GTATTTGACTCAGAATGCGGC-3', IE1-q-r: 5'-GTTTACATCTTTAATTTCGCCAG-3', 5'-GAGTCCGTGCCGATGTAAAC-3'; VP39-q-f: 5'-GCAAATAAACCATCCGTCGT-3', VP39-q-r: 5'-CCGAGACAAATGAAACTCAATC-3', 5'-GAAGAGCACCGCGATAGGATT-3'; polh-q-f: 5'-CAACGAGTACAGAATTAGTCTTGC-3', polh-q-r and Mv18S-QPCR-F: 5'-TGTTGCGGTTAAAAAGCTCGTA-3', Mv18S-QPCR-R, for ie-1, vp39, polh and 18S, respectively, were designed by the Primer Express computer program (Applied Biosystems). The reactions were performed in the iQ5 Real-Time PCR Detection System (Bio-Rad) by using Q SYBR Green Supermix (Bio-Rad). The comparative Ct method was used to analyse the real-time PCR data (Livak & Schmittgen, 2001Down). All values were normalized to 18S rRNA by subtracting the mean 18S rRNA Ct from the mean target Ct for each sample to give the {Delta}Ct. For relative quantification, we used the 2-{Delta}{Delta}Ct equation to calculate gene expression in target samples relative to the calibrator.

egfp–MaviNPV infection assay.
The MV, Sf9, PN, LY and LD insect cell lines (1x106 cells per well; six-well plate) were infected with egfp–MaviNPV (m.o.i of 10). The cells were checked daily for cytopathic effect (CPE), and the infection rates and virus titres were counted and determined at 7 days p.i. by observing the fluorescent signal.


   RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Genome sequence analysis and ORFs prediction
Sequence analysis of the MaviNPV genome.
The entire MaviNPV genome is 111 953 nt (Fig. 1Down). This size is in line with the estimate of 113.4 kbp produced by restriction-enzyme analysis (Lee et al., 2007Down). The G+C content of the MaviNPV genome is 38.6 %, slightly lower than that of lepidopteran NPVs group I, but very close to the content recorded for a variant of AcMNPV, Rachiplusia ou multiple nucleopolyhedrovirus (RoMNPV) (39.1 %). A total of 126 ORFs were defined. Fifty-one per cent (64/126) of the ORFs are oriented clockwise and 49 % (62/126) anti-clockwise, with respect to the orientation of the polh gene (ORF1; Vlak & Smith, 1982Down). All 126 MaviNPV ORFs have an assigned function or homologues in other baculoviruses. The 29 genes shared by all baculovirus genomes, including the dipteran and hymenopteran baculoviruses (Herniou et al., 2003Down; Garcia-Maruniak et al., 2004Down), were also found in the MaviNPV genome. The 126 predicted ORFs are encoded by 92 % of the MaviNPV genome; the rest is made up of intergenic spaces and hrs. Five identified hrs were dispersed around the MaviNPV genome; the maximum distance between two hrs was 35 kbp. The MaviNPV genome has 29 pairs of ORFs with overlapping codons. This compares to 23 in AcMNPV, 16 of which are also found in MaviNPV. In MaviNPV, the average overlap is 36 bp, and there are 12 overlaps longer than 20 bp. The maximal overlap of 153 bp exists between lef-3 and ac68 (Mv51/52). These two genes are in the opposite orientation, and both have homologues in AcMNPV. There are, moreover, two gene clusters packed very tightly: ORFs 36–40 and 60–66 in the MaviNPV genome (Table 1Down). In general, the MaviNPV genome is densely packed.


Figure 1
View larger version (58K):
[in this window]
[in a new window]

 
Fig. 1. Circular map of the MaviNPV genome. Locations for PstI, HindIII and EcoRI are shown on the inner, middle and outer rings, respectively.

 

View this table:
[in this window]
[in a new window]

 
Table 1. ORFs predicted in the genome of MaviNPV

 
Comparison of MaviNPV ORFs to those of other baculoviruses.
The gene content and organization of MaviNPV were compared with those of two group I NPVs (AcMNPV and BmNPV), a group II NPV (LdMNPV) and a GV (CpGV). MaviNPV shares 125 ORFs with AcMNPV, 123 with BmNPV, 90 with LdMNPV and 62 with CpGV, and these homologous ORFs had mean amino acid identities of 79.2, 78.6, 34.8 and 27.1 %, respectively. In the 132 genes shared between BmNPV and AcMNPV, the average amino acid identity is 93 % (Gomi et al., 1999Down). There are fewer shared genes between MaviNPV and BmNPV (123), and between MaviNPV and AcMNPV (125); the mean amino acid identities of these shared genes are also lower (79.2 and 78.6 %, respectively). Thus, the phylogenetic relationship between BmNPV and AcMNPV is closer than the relationship that MaviNPV has to either virus.

Ninety-six ORFs show the highest percentage of identity with AcMNPV, 17 with BmNPV and 12 with identities equal to AcMNPV and BmNPV. Three pairs of adjacent AcMNPV ORFs that are in the same orientation (Ac20/Ac21, Ac58/Ac59 and Ac106/Ac107) are fused into a single ORF in MaviNPV. The homologues of these ORFs also occur in other baculovirus genomes in which they are fused into a single ORF (Harrison & Bonning, 2003Down).

In Fig. 2Down, genes of AcMNPV were renumbered manually, starting with the polh gene as number 1. The gene arrangement of the MaviNPV genome was completely collinear to those of AcMNPV and BmNPV, but less collinear with LdMNPV. In contrast, parity analysis of MaviNPV and CpGV ORFs displayed a much more dispersed pattern.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 2. Gene parity plot analysis of MaviNPV in comparison with AcMNPV, BmNPV, LdMNPV and CpGV, as indicated. Axes: the relative position of each ORF; dots: ORFs.

 
Transcriptional regulation.
Sixteen MaviNPV ORFs possess a consensus early gene promoter motif (a TATA box followed by a CAGT motif 20–30 bp downstream) within 180 bp (Kool & Vlak, 1993Down; Xing et al., 2005Down) of the initiation codon (Table 1Up). Of these, nine ORFs, including Mv1 (polh), Mv14 (efp/ld130), Mv25 (39K), Mv42 (ac56), Mv66 (p95), Mv89 (pif-3), Mv97 (gp64), Mv107 (me53) and Mv109 (ie-0), also possess a late gene promoter motif (A/T/GTAAG), which may allow transcription of these genes during both early and late stages of infection, which has also been reported for Ac128 (gp64) and Ac147 (ie-1) (Kool & Vlak, 1993Down; O'Reilly et al., 1994aDown). Although the early gene promoter motif is present in the MaviNPV polh, mRNA was not detectable at the early stage of infection (data not shown). Seventy-seven MaviNPV ORFs possess a consensus late gene promoter motif within 120 bp of the initiation codon. A CGTGC motif has also been identified as an early promoter consensus sequence/transcription initiation site (enhancer-like element) in AcMNPV Ac40 (p47), Ac65 (DNA-pol) and Ac95 (helicase) (see Kool & Vlak, 1993Down). A CGTGC motif was found within 210 bp of the initiation codon of 28 MaviNPV ORFs (Table 1Up). Thirty-one of the MaviNPV ORFs did not possess consensus late or early promoter sequences. It seems likely that additional, as-yet-unidentified, promoter sequences might exist within the MaviNPV genome, as they do in other baculoviruses (Kool & Vlak, 1993Down; O'Reilly et al., 1994aDown).

Transcription-specific genes.
Baculovirus gene transcription occurs in a temporal cascade for the immediate-early, delayed-early, late and very late genes. In AcMNPV, the viral RNA polymerase comprises four subunits encoded by lef-4, lef-8, lef-9 and p47 (Guarino et al., 1998Down), and these are present in all fully sequenced baculovirus genomes, including that of MaviNPV, as ORFs 68, 35, 46 and 29, respectively. Homologues of both lef-5 and vlf-1 were also found in MaviNPV (ORFs 76 and 60). Although the function of lef-5 is unclear, vlf-1 is essential for the ‘burst’ in very late gene expression seen for p10 and polh (Yang & Miller, 1998Down, 1999Down). Two transcription-specific genes lef-10 and lef-12, previously identified in AcMNPV and BmNPV, were also present in MaviNPV as ORFs 39 and 30, respectively. In addition, MaviNPV encodes homologues of 39K (ORF25), lef-6 (ORF19) and lef-11 (ORF26), which are present in all sequenced lepidopteran baculoviruses (Herniou et al., 2003Down). Although AcMNPV, BmNPV and MaviNPV are all closely related, we note that while the amino acid identity of AcMNPV lef-6 and BmNPV lef-6 aa is 93 %, the identity between MaviNPV lef-6 aa and AcMNPV or BmNPV is only 34–35 %.

DNA replication genes.
Six baculovirus genes, lef-1, lef-2, lef-3, DNApol, helicase and ie-1, are essential in transient assays for DNA replication in AcMNPV and Orgyia pseudotsugata multiple nucleopolyhedrovirus (OpMNPV) and exist in all lepidopteran baculoviruses, including MaviNPV (Kool et al., 1995Down; Lu & Miller, 1995bDown; Ahrens & Rohrmann, 1995Down). Homologues of an additional single-stranded DNA-binding protein (dbp) (Mikhailov et al., 1998Down) and an immediate-early gene, me53, both of which have been implicated in DNA replication, were also found in MaviNPV (ORF16 and ORF107). Homologues of the non-essential DNA replication stimulatory genes, ie-2, lef-7 and pe38 (Kool et al., 1994Down), identified in AcMNPV, were also present in MaviNPV. However, no homologues to rr1, rr2 or dutpase or any other gene involved in nucleotide metabolism were found in MaviNPV; MaviNPV is the only baculovirus that is so far reported to lack these genes (Ahrens et al., 1997Down).

Structural protein genes.
Eighteen structural protein genes are conserved in 26 lepidopteran baculoviruses that have been sequenced (Herniou et al., 2003Down; Jehle et al., 2006Down). Only 17 of these genes were identified in the MaviNPV genome, including basic DNA-binding protein p6.9 (ORF77); capsid-associated proteins vp39 (ORF67), vp1054 (ORF40) and vp91/p95 (ORF66); occlusion-derived virus (ODV)-associated proteins tegument protein gp41 (ORF63) and p74 (ORF106); ODV envelope proteins odv-e18 (ORF111), odv-e25 (ORF71), odv-e27 (ORF112) and odv-e56 (ORF116); occlusion body matrix polh (ORF1); per os infectivity factors pif-1 (ORF91), pif-2 (ORF13) and pif-3 (ORF89); as well as protein kinase-1 (pk-1; ORF3), efp/ld130 (ORF14) and fp25K (ORF45). An odv-e66 homologue was not identified. An additional seven structural protein genes – including protein tyrosine phosphatase (ptp), orf1269, vp80, p24, pp34, p10 and group I NPV-specific gp64 – were also found in MaviNPV, as ORFs 123, 2, 81, 97, 98, 100 and 105, respectively. Sequence identity among the 24 structural proteins of MaviNPV and AcMNPV was generally 83.6 % (Table 1Up), suggesting that they may be structurally similar. The p6.9 protein was even more conserved than the polyhedrin (polh) protein (88 % identity). In contrast, the odv-e18, pp34 and p10 genes showed the lowest levels of sequence conservation between MaviNPV and AcMNPV (Table 1Up).

Anti-apoptotic genes.
Programmed cell death is triggered early in baculovirus infection. To counter this, baculoviruses encode proteins that inhibit apoptosis, such as P35 and IAP. A homologue for p35 (Clem & Miller, 1994Down) is present in MaviNPV as ORF103. So far, the p35 gene has also been found in AcMNPV, BmNPV and RoMNPV, three closely related group I NPVs, and it has homologues in Spodoptera litura nucleopolyhedrovirus (SpltNPV) (group II NPV) and in Choristoneura occidentalis granulovirus (ChocGV), as well as in Amsacta moorei entomopoxvirus (Clem et al., 1991Down; Du et al., 1999Down; Escasa et al., 2006Down; Kamita et al., 1993Down; Means et al., 2006Down). In contrast, iaps have been found in all members of the family Baculoviridae sequenced to date. Apoptotic inhibition has been recovered in AcMNPV p35 deletion mutants with a variety of baculovirus iap homologues (Seshagiri & Miller, 1997Down). Two MaviNPV ORFs, MV18 and 54, show strong homology to AcMNPV iap-1 and iap-2, respectively.

Auxiliary genes.
Auxiliary genes are defined as being non-essential for viral replication, but they provide a selective advantage to maximize virus production/survival either at the cellular level or at the level of the organism (O'Reilly, 1997Down). Several of these auxiliary genes have homologues in MaviNPV, including ptp-1, ubiquitin, p10, superoxide dismutases (sod), v-cath, chitinase, ecdysteroid UDP-glucosyltransferase (egt), actin rearrangement-inducing factor-1 (arif-1), alkaline exonuclease (alk-exo) and pk-1. The only auxiliary gene conserved among all baculoviruses is alk-exo, which interacts with lef-3, possesses both endo- and exonuclease activities and can degrade both single- and double-stranded DNA in a 5'–3' direction (Mikhailov et al., 2003Down). Two additional auxiliary genes with unknown function, viral fibroblast growth factor (vfgf) and ubiquitin, were also considered conserved among all lepidopteran baculoviruses (Herniou et al., 2003Down); surprisingly, no homologue of vfgf gene was found in MaviNPV.

MaviNPV ORF74 does not exist in the AcMNPV genome.
Only one MaviNPV ORF (Mv74) had no homologue in AcMNPV (Table 1Up). This ORF occupied the same genomic location as Ac97 in AcMNPV. BLASTP searches showed that the homologue of Mv74 was also found in Chrysodeixis chalcites nucleopolyhedrovirus (ChchNPV, ORF34), OpMNPV (ORF98) and Mamestra configurata nucleopolyhedrovirus-A (MacoNPV-A, ORF28); however, with low identities (26–21 %) in amino acid sequences. The significance of Mv74 as well as of its homologues is not yet known and requires further analysis.

AcMNPV ORFs with no homologues in the MaviNPV genome.
Table 2Down lists the 28 AcMNPV ORFs missing from the MaviNPV genome. Genes that are important for AcMNPV replication or infection, but which are not in the MaviNPV genome are as follows: Ac42, a general transcription activator (gta), contains seven motifs common to the SWI2/SNF2 family of proteins, which is involved in chromatin remodelling (Pazin & Kadonaga, 1997Down; Tsukiyama & Wu, 1997Down); Ac46 (odv-e66) encodes an ODV envelope protein; Ac49 (pcna/etl) encodes a protein with similarity to eukaryotic proliferating cell nuclear antigen (O'Reilly et al., 1989Down) and studies show that the late gene expression of a mutant AcMNPV lacking a functional pcna gene is markedly delayed compared with that of wild-type AcMNPV (Crawford & Miller, 1988Down); Ac70, host cell-specific factor-1 (hcf-1), has been shown to be important in host-specific virus replication (Lu & Miller, 1995aDown, 1996Down); Ac123, protein kinase 2 (pk-2) might be involved in the regulation of translation in infected cells (Morris et al., 1994Down); however, an AcMNPV mutant lacking a functional pk-2 gene displayed no noticeable phenotypic alterations compared with wild-type virus (Li & Miller, 1995Down).


View this table:
[in this window]
[in a new window]

 
Table 2. AcMNPV ORFs with no homologues in the MaviNPV genome

Numbers of AcMNPV ORFs were taken from Ayres et al. (1994)Down. Percentage identity between AcMNPV ORFs and BmNPV homologues is shown.

 
hrs.
A novel feature of many baculovirus genomes is the presence of hrs that are located throughout the genome (Ayres et al., 1994Down; Cochran & Faulkner, 1983Down; Garcia-Maruniak et al., 1996Down). These regions are composed of repeated sequences encompassing both direct repeats and imperfect palindromic sequences and have closely related counterparts elsewhere in the genome. hrs function as enhancers of RNA polymerase II-mediated transcription of baculovirus early promoters (Guarino & Summers, 1986Down; Theilmann & Stewart, 1992Down). In both AcMNPV and OpMNPV, hrs can perform as cis-acting origins of DNA replication (Ahrens & Rohrmann, 1995Down; Leisy & Rohrmann, 1993Down; Kool et al., 1995Down; Pearson et al., 1992Down); it has also been suggested that hrs can probably substitute for each other, since it was recently shown that not all hrs need to be present for successful DNA replication (Carstens &Wu, 2007Down). In seven of the 33 baculoviruses currently sequenced [ChchNPV, Trichoplusia ni single nucleopolyhedrovirus (TnSNPV), Adoxophyes honmai nucleopolyhedrovirus (AdhoNPV), Agrotis segetum granulovirus (AgseGV), CpGV, Neodiprion abietis nucleopolyhedrovirus (NeabNPV) and Neodiprion lecontii nucleopolyhedrovirus (NeleNPV)] canonical hrs were not identified. The remaining fully sequenced baculoviruses contain between three (Cryptophlebia leucotreta granulovirus; CrleGV) and 17 (SpltNPV) hrs (Table 1Up).

Five homologous regions (hrs1–5) containing a total of 44 imperfect palindromes were found in the MaviNPV genome. The number of imperfect palindromes per hr ranges from 7 in hr2 and hr5 and 9 in both hr1 and hr4 to 12 in hr3 and accounts for 3.2 % of the genome. hr2, 4 and 5 have a clockwise orientation and hr1 and 3 are anti-clockwise in the MaviNPV genome (Fig. 3bDown). A similar arrangement of hrs is also found in the OpMNPV genome (Ahrens et al., 1997Down). The MaviNPV hr palindrome consensus GTTTTACGAGTAGAATCGTACTCGTAAAGC shows 24/30 palindrome matches (Supplementary Fig. S1 available in JGV Online). This is similar to the 24/30 matches for the BmNPV (Gomi et al., 1999Down) and OpMNPV (Ahrens et al., 1997Down) palindrome sequence, and the 26/30 matches for the AcMNPV (Ayres et al., 1994Down) palindrome consensus (Fig. 3aDown). In addition, the MaviNPV hr palindrome consensus has the highest identity to the hr consensus sequence from BmNPV (26/30 bases, 86 %), followed by the hr consensus from AcMNPV (21/30 bases, 70 %) and OpMNPV (19/30 bases, 63 %).


Figure 3
View larger version (43K):
[in this window]
[in a new window]

 
Fig. 3. Comparison of MaviNPV hr palindromes with hr palindrome consensus sequence from other baculoviruses. (a) Alignment of consensus hr palindrome from MaviNPV, BmNPV (Majima et al., 1993Down), AcMNPV and OpMNPV. The two 8 bp sequences that bind the IE-1 transactivator in AcMNPV (Rodems & Friesen, 1995Down) are underlined, as are the equivalent regions for MaviNPV, BmNPV and OpMNPV. Y=T or C, K=G or T, M=C or A, R=A or G. (b) Comparison of the genomic context of the hrs and hr locations relative to homologous ORFs between MaviNPV, BmNPV, AcMNPV and OpMNPV in the linearized genomes. ORFs flanking the hrs: below the line. Grey rectangles: major inserts relative to AcMNPV and ORFs within the inserts are shown above the line. For consistency, all linearized genomes start with polh, but hrs and ORF numbers remain as in the original papers. AcMNPV hr2a is shown as in Possee & Rohrmann (1997)Down.

 
Major insertions and deletions were found near the MaviNPV hrs when we compared these regions to their counterparts in the BmNPV, AcMNPV and OpMNPV genomes (Fig. 3bUp). The clearest example involves hr3, located between ORFs 83 and 84 in AcMNPV. Homologues of AcMNPV ORF83 also flank hr3 on the left in BmNPV (ORF69), OpMNPV (ORF86) and MaviNPV (ORF66). Similarly, BmNPV lacks homologues to AcMNPV ORFs 84–86, and hr3 is therefore flanked by the BmNPV ORF70, which is an AcMNPV ORF87 homologue (Ahrens et al., 1997Down). In contrast, MaviNPV lacks a large region comparable to AcMNPV ORFs 84–88 and therefore MaviNPV hr3 is flanked on the right by ORF67, an AcMNPV ORF89 homologue. MaviNPV hr5, BmNPV hr5 and AcMNPV hr5 are in the same genomic locations between p35 and p26, while the hr5 of OpMNPV is between p74 and Op135. The close relatedness of the hr sequence within each viral genome suggests that the sequences are conserved, possibly because of their interaction with a viral protein, such as IE-1, which is involved in hr binding (Choi & Guarino, 1995Down; Leisy et al., 1995Down; Rodems & Friesen, 1995Down). In AcMNPV, IE-1 has been shown to bind the two 8 bp sequences that are three bases in from the ends of the palindrome sequence (Fig. 3aUp; underlined) (Rodems & Friesen, 1995Down). It would be expected that the IE-1 proteins from MaviNPV, BmNPV and OpMNPV bind the same regions of the palindrome sequences in these viruses, even though the IE-1 proteins of these viruses are not strictly conserved and show a variation in the range of 50–87 %.

Phylogenetic position of MaviNPV.
The NJ and MP trees generated similar results, but the NJ tree revealed higher bootstrap values and is the only tree shown here. The results reflect the current systematic assignment of the viruses. As Fig. 4Down shows, the family Baculoviridae consists of five major clades: the NPVs infecting Lepidoptera (including group I and group II), the GVs, the hymenopteran-specific NPVs and CuniNPV. Two subclades within the lepidopteran NPV group I resemble the AcMNPV and AgMNPV lineages as reported by Oliveira et al. (2006)Down. The patterns of adjacency indicated that MaviNPV is grouped into the AcMNPV lineage with BmNPV, RoMNPV and AcMNPV. Moreover, phylogenetic analysis revealed that MaviNPV was separated from the ancestor of AcMNPV and BmNPV before these two viral species diverged, supporting the idea that MaviNPV is a distinct baculovirus species.


Figure 4
View larger version (51K):
[in this window]
[in a new window]

 
Fig. 4. Baculovirus phylogeny inferred from a combined dataset of the 29 baculovirus core protein sequences. Shown is an unrooted NJ tree. CuniNPV was selected as the outgroup. Numbers at nodes indicate bootstrap scores above 60 % for the NJ and MP analyses (1000 replicates, NJ bootstrap/MP bootstrap).

 
MaviNPV replication in cell lines
Infection assay.
For wild-type MaviNPV infection, MV cells showed a typical NPV-infected CPE, and OBs in the nuclei of the infected MV cells at 3 days p.i., the infection rate of MV cells reached 98 % at 7 days p.i., while CPE in LD, PN, LY and Sf9 cells was not obvious at 3 (Fig. 5Down) and 7 days p.i.


Figure 5
View larger version (144K):
[in this window]
[in a new window]

 
Fig. 5. CPE of MaviNPV-infected MV, Sf9, PN, LY and LD cells at 72 h p.i. Bars, 25 µm.

 
For egfp–MaviNPV infection, the infection rates of LD, Sf9 and MV cells, with fluorescent signal at 7 days p.i., were 0.97±0.135, 0.01±0.00135 and 99.32±1.83 %, respectively, but the fluorescent signal was not seen in the infected PN and LY cells. The progeny virus titres of the egfp–MaviNPV-infected MV and LD cells at 7 days p.i. were 3.98±0.37x107 and 3.14±1.03x104 TCID50 ml–1, respectively. The virus titre of the infected LD cells increased to 2.81±0.95x105 TCID50 ml–1 at 9 days p.i. There was no progeny virus found in the infected LY, PN and Sf9 cells, although fluorescent signals were seen in a few infected Sf9 cells.

McIntosh et al. (2005)Down defined three types of viral susceptibility of a cell line: permissive (full replication), semi-permissive (partial replication) and non-permissive (no replication). MV cells are a permissive cell line and LY, PN and Sf9 cells are non-permissive cell lines for MaviNPV infection. Only 1 % of LD cells were susceptible to egfp–MaviNPV and neither obvious CPE nor OBs were observed in MaviNPV-infected LD cells (Fig. 5Up). This kind of baculovirus infection, with no OB formation, occurs in other baculovirus-infected cells; for example, AcMNPV-infected BmN-4 cells, Hyphantria cunea nucleopolyhedrovirus-infected Sf21 cells (Shirata et al., 1999Down) and Helicoverpa zea single nucleopolyhedrovirus (HzSNPV)-infected Helicoverpa zea cells (Goodman et al., 2001Down). Conversely, the baculovirus-infected cells that produce OBs generate progeny virus with no exception. polh proteins in NPVs and cytoplasmic polyhedroviruses (CPVs) are not homologous even though they both form similar polyhedral structures. In CPVs, hydrophobic interactions produce the main structure of the polyhedron via a trimer form of polh protein (Coulibaly et al., 2007Down). In NPVs, aa 19–130 of polh protein are important for the formation of polh-like crystals in the nucleus. Eason et al. (1998)Down provided ultrastructural evidence that in NPVs, polyhedron formation is initiated by the nucleation of polh on the virion surface. Pilot studies showed that at 7 days p.i. the eGFP level in LD cells was about 100 times lower than in infected MV cells (data not shown), which is consistent with the hypothesis that the polh protein level may be one important factor for the formation of OBs. Two other genes may also be critical: p10 and pp34 encode a protein for the fibrillar structure formation and a calyx protein, respectively, and both of these proteins are important for the assembly and stability of the polyhedron structure (Lee et al., 1996Down; Dong et al., 2005Down).

qPCR examination.
As depicted by qPCR (Fig. 6Down), normalized with the level of cellular 18S, MaviNPV-infected MV cells produced the highest transcription levels of three representative genes: ie-1 (early gene), vp39 (late gene) and polh (very late gene), followed by MaviNPV-infected LD cells, and then MaviNPV-infected Sf9 cells, while LY and PN cells did not produce transcription of these three genes at 3 days p.i. A very low transcription of vp39 and polh in the infected Sf9 cells was found at 3 days p.i. In the MaviNPV-infected LD cells, ie-1 and polh transcriptions were increased by about two- and 2000-fold, respectively, at 7 days p.i., while vp39 transcription decreased approximately 2.5-fold at 7 days p.i. Morris & Miller (1992)Down examined the activities of viral and insect promoters in AcMNPV-permissive and non-permissive cell lines by CAT recombinant viruses. LD cells are non-permissive for AcMNPV and show strikingly low expression of CAT in LD cells. In particular no CAT activity of very late genes was found at 6–48 h p.i. Guzo et al. (1992)Down compared the viral and host cellular transcription of AcMNPV-infected LD cells in permissive and non-permissive cell lines, and suggested that the absence of normal AcMNPV protein synthesis was not due to a lack of virus-specific transcription, but instead could result from an inability of host LD cells to translate abundant viral mRNAs even though the virus-specific mRNAs were neither excessively destabilized nor defective with regard to protein synthesis.


Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 6. MaviNPV transcription levels in MaviNPV-infected MV, Sf9, PN, LY and LD cells detected by real-time PCR analysis: (a) ie-1, (b) vp39 and (c) polh at 72 and 168 h p.i.

 
Our previous reports showed that 20 % of P. nuda nucleopolyhedrovirus-infected LD cells contained OBs, and that LD cells are susceptible to LyxyMNPV (Chou et al., 1996Down; Wu & Wang, 2006Down). However, the replication cycle of LyxyMNPV in LD cells was much slower than that of AcMNPV in Sf9 cells. Usually, the OBs in the LyxyMNPV-infected LD cells were observed at 3–5 days p.i. and the highest infection rate was found at 7–10 days p.i. (unpublished data). This delayed replication cycle was also found in the MaviNPV-infected LD cells (Fig. 6cUp). The qPCR assay found a higher relative amount of polh mRNA at 168 h (7 days) p.i. (Fig. 6cUp). In addition, the very late gene expression of CAT-AcMNPV-infected LD cells was detected at 6–48 h p.i. (Morris & Miller, 1992Down). Such a short detection time after infection was not sufficient to express the very late gene of AcMNPV, especially polh in LD cells. Moreover, only about 1 % LD cells were susceptible to egfp–MaviNPV and no obvious CPE and OBs in wild-type MaviNPV-infected LD cells (m.o.i. of 10) were found at 168 h p.i. When LD cells were inoculated with a high dose of MaviNPV (m.o.i. of 20 or 100), cell blebbing occurred and the cells lysed at 3 days p.i. The infection dose therefore did not appear to be the main factor of the infection rate. The susceptibility of a cell line may be influenced by the age of cells, cell cycle (synchronous or asynchronous) and genetic heterogeneity of the cell types (Freshney, 2005Down; O'Reilly et al., 1994bDown); the latter is more likely the reason for uneven MaviNPV susceptibility of the LD cells.

Efficient expression of the late viral genes of baculovirus in a cell line determines whether the cell line is non-permissive or semi-permissive of the virus (McIntosh et al., 2005Down). The qPCR (Fig. 6Up) showed that the early, late and very late genes of MaviNPV could be transcribed. However, even though the very late viral genes of MaviNPV were expressed in some of the LD cells, the full constellation of factors that influence OB formation in LD cells remains to be determined.

A gene, hrf-1 (host range factor 1), of LdMNPV can promote NPV infectivity (including SeMNPV, HycuNPV, BmNPV and AcMNPV) to LD cells (Du & Thiem, 1997Down; Ikeda et al., 2005Down; McIntosh et al., 2005Down, Thiem et al., 1996Down), and in vivo infection experiments also revealed that the expression of hrf-1 could increase AcMNPV infectivity to H. zea and L. dispar larvae (Chen et al., 1998Down). No hr of LdMNPV hrf-1 is found in the AcMNPV or MaviNPV genomes. We also note that the replication of MaviNPV in several cell lines is interestingly distinct from that of AcMNPV, while AcMNPV only appears to infect the MV cells with an infection rate of about 10 % (data not shown). MaviNPV can also infect LD cells, while AcMNPV could not; conversely, Sf9 cells could be infected by AcMNPV but not by MaviNPV. We will construct a DNA chip based on the MaviNPV genome to elucidate the expression of the whole MaviNPV genome in LD cells. The role of hrf-1 on MaviNPV-infected LD cells will also be examined in our future work.


   ACKNOWLEDGEMENTS
 
We thank Yu-Shin Nai, Shih-Chia Yeh and Hsueh-Fang Lin (Department of Entomology, National Taiwan University, Taiwan) for assistance with DNA sequence analysis, Yuh-Hui Chiu for the ORF map, and Leellen Solter PhD, Illinois Natural History Survey, for this manuscript revision. This work was supported by the National Science Council under Grant 95N-1302 and NSC-95-2313-B-002-038, Republic of China.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Abate, T. & Ampofo, J. K. O. (1996). Insect pests of beans in Africa: their ecology and management. Annu Rev Entomol 41, 45–73.[Medline]

Afonso, C. L., Tulman, E. R., Lu, Z., Balinsky, C. A., Moser, B. A., Becnel, J. J., Rock, D. L. & Kutish, G. F. (2001). Genome sequence of a baculovirus pathogenic for Culex nigripalpus. J Virol 75, 11157–11165.[Abstract/Free Full Text]

Afun, J. V. K., Jackai, L. E. N. & Hodgson, C. J. (1991). Calendar and monitored insecticide application for the control of cowpea pests. Crop Prot 10, 363–370.[CrossRef]

Ahrens, C. H. & Rohrmann, F. (1995). Replication of Orgyia pseudotsugata baculovirus DNA: lef-2 and ie-1 are essential and ie-2, p34, and Op-iap are stimulatory genes. Virology 212, 650–662.[CrossRef][Medline]

Ahrens, C. H., Russell, R. L. Q., Funk, C. J., Evans, J. T., Harwood, S. H. & Rohrmann, G. F. (1997). The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 229, 381–399.[CrossRef][Medline]

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol 215, 403–410.[CrossRef][Medline]

Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586–605.[CrossRef][Medline]

Bonfield, J. K., Smith, K. F. & Staden, R. (1995). A new DNA sequence assembly program. Nucleic Acids Res 23, 4992–4999.[Abstract/Free Full Text]

Bulach, D. M., Kumar, C. A., Zaia, A., Liang, B. & Tribe, D. E. (1999). Group II nucleopolyhedrovirus subgroups revealed by phylogenetic analysis of polyhedrin and DNA polymerases gene sequences. J Invertebr Pathol 73, 59–73.[CrossRef][Medline]

Carstens, E. B. & Wu, Y. (2007). No single homologous repeat region is essential for DNA replication of the baculovirus Autographa californica multiple nucleopolyhedrovirus. J Gen Virol 88, 114–122.[Abstract/Free Full Text]

Chen, C. J., Quentin, M. E., Brenna, L. A., Kukel, C. & Thiem, S. M. (1998). Lymantria dispar nucleopolyhedrovirus hrf-1 expands the larval host range of Autographa californica nucleopolyhedrovirus. J Virol 72, 2526–2531.[Abstract/Free Full Text]

Choi, J. & Guarino, L. A. (1995). The baculovirus transactivator IE1 binds to viral enhancer elements in the absence of insect cell factors. J Virol 69, 4548–4551.[Abstract]

Chou, C. M., Huang, C. J., Lo, C. F., Kou, G. H. & Wang, C. H. (1996). Characterization of Perina nuda polyhedrin gene. J Invertebr Pathol 67, 259–266.[CrossRef][Medline]

Clem, R. J. & Miller, L. K. (1994). Control of programmed cell death by the baculovirus genes p35 and iap. Mol Cell Biol 14, 5212–5222.[Abstract/Free Full Text]

Clem, R. J., Fechheimer, M. & Miller, L. K. (1991). Prevention of apoptosis by a baculovirus gene during infection of insect cells. Science 254, 1388–1390.[Abstract/Free Full Text]

Cochran, M. A. & Faulkner, P. (1983). Location of homologous DNA sequences interspersed at five regions in the baculovirus AcMNPV genome. J Virol 45, 961–970.[Abstract/Free Full Text]

Coulibaly, F., Chiu, E., Ikeda, K., Gutmann, S., Haebel, P. W., Schulze-Briese, C., Mori, H. & Metcalf, P. (2007). The molecular organization of cypovirus polyhedra. Nature 446, 97–101.[CrossRef][Medline]

Crawford, A. M. & Miller, L. K. (1988). Characterization of an early gene accelerating expression of late genes of the baculovirus Autographa californica nuclear polyhedrosis virus. J Virol 62, 2773–2781.[Abstract/Free Full Text]

Dong, C., Li, D., Long, G., Deng, F., Wang, H. & Hu, Z. (2005). Identification of functional domains required for HearNPV P10 filament formation. Virology 338, 112–120.[CrossRef][Medline]

Dreyer, H., Baumgärtner, J. & Tamò, M. (1994). Seed damaging field pests of cowpea (Vigna unguiculata L. Walp.) in Benin: occurrence and pest status. Int J Pest Manage 40, 252–260.

Du, X. & Thiem, S. M. (1997). Characterization of host range factor1 (hrf-1) expression in Lymantria dispar M nucleopolyhedrovirus and recombinant Autographa californica M nucleopolyhedrovirus-infected IPLB-LD-652Y cells. Virology 227, 420–430.[CrossRef][Medline]

Du, Q., Lehavi, D., Faktor, O., Qi, Y. & Chejanovsky, N. (1999). Isolation of an apoptosis suppressor gene of the Spodoptera littoralis nucleopolyhedrovirus. J Virol 73, 1278–1285.[Abstract/Free Full Text]

Eason, J. E., Hice, R. H., Johnson, J. J. & Federici, B. A. (1998). Effects of substituting granulin or a granulin-polyhedrin chimera for polyhedrin on virion occlusion and polyhedral morphology in Autographa californica multiplenucleocapsid nuclear polyhedrosis virus. J Virol 72, 6237–6243.[Abstract/Free Full Text]

Escasa, S. R., Lauzon, H. A. M., Mathur, A. C., Krell, P. J. & Arif, B. M. (2006). Sequence analysis of the Choristoneura occidentalis granulovirus genome. J Gen Virol 87, 1917–1933.[Abstract/Free Full Text]

Ewing, B. & Green, P. (1998). Base-calling of automated sequencer traces using PHRED. II. Error probabilities. Genome Res 8, 186–194.[Abstract/Free Full Text]

Ewing, B., Hillier, L., Wendl, M. C. & Green, P. (1998). Base-calling of automated sequencer traces using PHRED. I. Accuracy assessment. Genome Res 8, 175–185.[Abstract/Free Full Text]

Freshney, R. I. (2005). Biology of cultured cells. In Culture of Animal Cells: a Manual of Basic Technique, 5th edition, pp. 31–42. New York: Wiley-Liss.

Garcia-Maruniak, A., Pavan, O. H. O. & Maruniak, J. E. (1996). A variable region of Anticarsia gemmatalis nuclear polyhedrosis virus contains tandemly repeated DNA sequences. Virus Res 41, 123–132.[Medline]

Garcia-Maruniak, A., Maruniak, J. E., Zanotto, P. M. A., Doumbouya, A. E., Liu, J.-C., Merritt, T. M. & Lanoie, J. S. (2004). Sequence analysis of the genome of the Neodiprion sertifer nucleopolyhedrovirus. J Virol 78, 7036–7051.[Abstract/Free Full Text]

Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. J Gen Virol 80, 1323–1337.[Abstract]

Goodman, C. L. & McIntosh, A. H. (1994). Production of baculovirus for insect control using cell culture. In Insect Cell Biotechnology, pp. 33–56. Edited by K. Maramorosch & A. H. McIntosh. Boca Raton, FL: CRC Press.

Goodman, C. L., McIntosh, A. H., El Sayed, G. N. E., Grasela, J. J. & Stiles, B. (2001). Production of selected baculoviruses in newly established lepidopteran cell lines. In Vitro Cell Dev Biol Anim 37, 374–379.[Medline]

Goodwin, R. H., Tropkins, F. J. & McCawley, P. (1978). Gypsy moth cell lines divergent in viral susceptibility. In Vitro 14, 485–494.[Medline]

Groener, A. (1986). Specificity and safety of baculovirus. In The Biology of Baculoviruses, vol. 1. Biological Properties and Molecular Biology, pp. 177–202. Boca Raton, FL: CRC Press.

Guarino, L. A. & Summers, M. D. (1986). Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. J Virol 60, 215–223.[Abstract/Free Full Text]

Guarino, L. A., Xu, B., Jin, J. & Dong, W. (1998). A virus-encoded RNA polymerase purified from baculovirus-infected cells. J Virol 72, 7985–7991.[Abstract/Free Full Text]

Guzo, D., Rathburn, H., Guthrie, K. & Dougherty, E. (1992). Viral and host cellular transcription in Autographa californica nuclear polyhedrosis virus-infected gypsy moth cell line. J Virol 66, 2966–2972.[Abstract/Free Full Text]

Harrison, R. L. & Bonning, B. C. (2003). Comparative analysis of the genomes of Rachiplusia ou and Autographa californica multiple nucleopolyhedrovirus. J Gen Virol 84, 1827–1842.[Abstract/Free Full Text]

Herniou, E. A., Luque, T., Chen, X., Vlak, J. M., Winstanley, D., Cory, J. S. & O'Reilly, D. R. (2001). Use of whole genome sequence data to infer baculovirus phylogeny. J Virol 75, 8117–8126.[Abstract/Free Full Text]

Herniou, E. A., Olszewski, J. A., Cory, J. S. & O'Reilly, D. R. (2003). The genome sequence and evolution of baculoviruses. Annu Rev Entomol 48, 211–234.[CrossRef][Medline]

Hink, W. F. (1970). Established insect cell line from the cabbage looper, Trichoplusia ni. Nature 226, 466–467.

Hink, W. F. & Hall, R. L. (1989). Recently established invertebrate cell lines. In Invertebrate Cell System Applications, pp. 269–293. Boca Raton, FL: CRC Press.

Hink, W. F. & Strauss, E. (1976). Growth of the Trichoplusia ni (TN-368) cell line in suspension culture. In Invertebrate Tissue Culture, Applications in Medicine, Biology, and Agriculture, pp. 297–300. Edited by E. Kurstak & K. Maramorosch. New York: Academic Press.

Hu, Z. H., Arif, B. M., Jin, F., Martens, J. W. M., Chen, X. W., Sun, J. S., Zuidema, D., Goldbach, R. W. & Vlak, J. M. (1998). Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome. J Gen Virol 79, 2841–2851.[Abstract]

Ikeda, M., Reimbold, E. A. & Thiem, S. M. (2005). Functional analysis of the baculovirus host range gene, hrf-1. Virology 332, 602–613.[CrossRef][Medline]

Jackai, L. E. N. (1995). Integrated pest management of borers of cowpea and beans. Insect Sci Appl 16, 237–250.

Jehle, J. A., Blissard, G. W., Bonning, B. C., Cory, J. S., Herniou, E. A., Rohrmann, G. F., Theilmann, D. A., Thiem, S. M. & Vlak, J. M. (2006). On the classification and nomenclature of baculoviruses: a proposal for revision. Arch Virol 151, 1257–1266.[CrossRef][Medline]

Kamita, S. G., Majima, K. & Maeda, S. (1993). Identification and characterization of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis. J Virol 67, 455–463.[Abstract/Free Full Text]

Kool, M. & Vlak, J. M. (1993). The structural and functional organization of the Autographa californica nuclear polyhedrosis virus genome. Arch Virol 130, 1–16.[CrossRef][Medline]

Kool, M., Ahren, C. H., Goldbach, R. W., Rohrmann, G. F. & Vlak, J. M. (1994). Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proc Natl Acad Sci U S A 91, 11212–11216.[Abstract/Free Full Text]

Kool, M., Ahrens, C. H., Vlak, J. M. & Rohrmann, G. F. (1995). Replication of baculovirus DNA. J Gen Virol 76, 2103–2118.[Abstract/Free Full Text]

Kumar, S., Tamura, K. & Nei, M. (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5, 150–163.[Abstract/Free Full Text]

Lauzon, H. A., Lucarotti, C. J., Krell, P. J., Feng, Q., Retnakaran, A. & Arif, B. M. (2004). Sequence and organization of the Neodiprion lecontei nucleopolyhedrovirus genome. J Virol 78, 7023–7035.[Abstract/Free Full Text]

Lee, S. Y., Poloumienko, A., Belfry, S., Qu, X., Chen, W., MacAfee, N., Morin, B., Lucarotti, C. & Krause, M. (1996). A common pathway for p10 and calyx protein in progressive stages of polyhedron envelope assembly in AcMNPV-infected Spodoptera frugiperda larvae. Arch Virol 141, 1247–1258.[CrossRef][Medline]

Lee, S.-T., Srinivasan, R., Lo, Y.-J. & Talekar, N. S. (2007). Identification, characterization and bioassays of Maruca vitrata multiple nucleopolyhedrovirus (MaviNPV) against Maruca vitrata (Lepidoptera, Pyralidae). BioControl 52, 801–819.[CrossRef]

Leisy, D. J. & Rohrmann, G. F. (1993). Characterization of the replication of plasmids containing hr sequences in baculovirus-infected Spodoptera frugiperda cells. Virology 196, 722–730.[CrossRef][Medline]

Leisy, D. J., Rasmussen, C., Kim, H. T. & Rohrmann, G. F. (1995). The Autographa californica nuclear polyhedrosis virus homologous region 1a: identical sequences are essential for DNA replication activity and transcriptional enhancer function. Virology 208, 742–752.[CrossRef][Medline]

Li, Y. & Miller, L. K. (1995). Expression and functional analysis of a baculovirus gene encoding a truncated protein kinase homolog. Virology 206, 314–323.[Medline]

Liu, W. J., Chang, Y. S., Wang, C. H., Kou, G. H. & Lo, C. F. (2005). Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology 334, 327–341.[CrossRef][Medline]

Livak, K. J. & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and 2{Delta}{Delta}CT method. Methods 25, 402–408.[CrossRef][Medline]

Lu, A. & Miller, L. K. (1995a). Differential requirements for baculovirus late expression factor genes in two cell lines. J Virol 69, 6265–6272.[Abstract]

Lu, A. & Miller, L. K. (1995b). The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. J Virol 69, 975–982.[Abstract]

Lu, A. & Miller, L. K. (1996). Species-specific effects of the hcf-1 gene on baculovirus virulence. J Virol 70, 5123–5130.[Abstract/Free Full Text]

Majima, K., Kobara, R. & Maeda, S. (1993). Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus. J Virol 67, 7513–7521.[Abstract/Free Full Text]

Martin, O. & Croizier, G. (1997). Infection of a Spodoptera frugiperda cell line with Bombyx mori nucleopolyhedrovirus. Virus Res 47, 179–185.[CrossRef][Medline]

McIntosh, A. H., Grasela, J. J. & Popham, H. J. R. (2005). AcMNPV in permissive, semipermissive, and nonpermissive cell lines from arthropoda. In Vitro Cell Dev Biol Anim 41, 298–304.[CrossRef][Medline]

Means, J. C., Penabaz, T. & Clem, R. J. (2006). Identification and functional characterization of AMVp33, a novel homolog of the baculovirus caspase inhibitor p35 found in Amsacta moorei entomopoxvirus. Virology 358, 436–437.[CrossRef][Medline]

Mikhailov, V. S., Mikhailova, A. L., Iwanaga, M., Gomi, S. & Maeda, S. (1998). Bombyx mori nucleopolyhedrovirus encodes a DNA-binding protein capable of destabilizing duplex DNA. J Virol 72, 3107–3116.[Abstract/Free Full Text]

Mikhailov, V. S., Okano, K. & Rohrmann, G. F. (2003). Baculovirus alkaline nuclease possesses a 5'->3' exonuclease activity and associates with the DNA-binding protein LEF-3. J Virol 77, 2436–2444.[Abstract/Free Full Text]

Miller, L. K. & Lu, A. (1997). The molecular basis of baculovirus host range. In The Baculoviruses, pp. 217–235. Edited by L. K. Miller. New York: Plenum.

Morris, T. D. & Miller, L. K. (1992). Promoter influence on baculovirus-mediated gene expression in permissive and nonpermissive insect cell line. J Virol 66, 7397–7405.[Abstract/Free Full Text]

Morris, T. D., Todd, J. W., Fisher, B. & Miller, L. K. (1994). Identification of lef-7: a baculovirus gene affecting late gene expression. Virology 200, 360–369.[Medline]

Oliveira, J. V. C., Wolff, J. L. C., Garcia-Maruniak, A., Ribeiro, B. M., de Castro, M. E. B., de Souza, M. L., Moscardi, F., Maruniak, J. E. & Zanotto, P. M. A. (2006). Genome of the most widely used viral biopesticide: Anticarsia gemmatalis multiple nucleopolyhedrovirus. J Gen Virol 87, 3233–3250.[Abstract/Free Full Text]

O'Reilly, D. R. (1997). Auxiliary genes of baculoviruses. In The Baculoviruses, pp. 267–300. Edited by L. K. Miller. New York: Plenum.

O'Reilly, D. R., Crawford, A. M. & Miller, L. K. (1989). Viral proliferating cell nuclear antigen. Nature 337, 606

O'Reilly, D. R., Miller, L. K. & Luckow, V. A. (1994a). Gene organization, regulation, and function. In Baculovirus Expression Vectors (A Laboratory Manual), pp. 12–23. New York: Oxford University Press.

O'Reilly, D. R., Miller, L. K. & Luckow, V. A. (1994b). Insect cell culture. In Baculovirus Expression Vectors (A Laboratory Manual), pp. 109–123. New York: Oxford University Press.

Pazin, M. J. & Kadonaga, J. T. (1997). SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein–DNA interactions? Cell 88, 737–740.[CrossRef][Medline]

Pearson, M. N., Bjornson, R. M., Pearson, G. D. & Rohrmann, G. F. (1992). The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257, 1382–1384.[Abstract/Free Full Text]

Possee, R. D. & Rohrmann, G. F. (1997). Baculovirus genome organization and evolution. In The Baculoviruses, pp. 109–140. Edited by L. K. Miller. New York: Plenum.

Rodems, S. M. & Friesen, P. D. (1995). Transcriptional enhancer activity of hr5 requires dual palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1. J Virol 69, 5368–5375.[Abstract]

Seshagiri, S. & Miller, L. K. (1997). Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1. Proc Natl Acad Sci U S A 94, 13606–13611.[Abstract/Free Full Text]

Shanower, T. G., Romeis, J. & Minja, E. M. (1999). Insect pests of pigeonpea and their management. Annu Rev Entomol 44, 77–96.[CrossRef][Medline]

Shirata, N., Ikeda, M., Kamiya, K., Kawamura, S., Kunimi, Y. & Kobayashi, M. (1999). Replication of nucleopolyhedroviruses of Autographa californica (Lepidoptera: Noctuidae), Bombyx mori (Lepidoptera: Bombycidae), Hyphantria cunea (Lepidoptera: Arctiidae), and Spodoptera exigua (Lepidoptera: Noctuidae) in four lepidopteran cell lines. Appl Entomol Zool (Jpn) 34, 507–516.

Summers, M. D. & Smith, G. E. (1987). A manual of methods for baculovirus vectors and insect cell culture procedures. Texas Agricul Exp Station Bull 1555, 5

Theilmann, D. A. & Stewart, S. (1992). Tandemly repeated sequence at the 3' end of the IE-2 gene of the baculovirus Orgyia pseudosugata multicapsid nuclear polyhedrosis virus is an enhancer element. Virology 187, 97–106.[CrossRef][Medline]

Theilmann, D. A., Blissard, G. W., Bonning, B., Jehle, J. A., O'Reilly, D. R., Rohrmann, G. F., Thiem, S. & Valk, J. M. (2005). Family Baculoviridae. In Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Viruses, pp. 1129–1185. Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger & L. A. Ball. New York: Springer.

Thiem, S. M., Du, X., Quentin, M. E. & Berner, M. M. (1996). Identification of a baculovirus gene that promotes Autographa californica nuclear polyhedrosis virus replication in a nonpermissive insect cell line. J Virol 70, 2221–2229.[Abstract]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876–4882.[Abstract/Free Full Text]

Tsukiyama, T. & Wu, C. (1997). Chromatin remodeling and transcription. Curr Opin Genet Dev 7, 182–191.[CrossRef][Medline]

Vlak, J. M. & Smith, G. E. (1982). Orientation of the genome of Autographa californica nuclear polyhedrosis virus: a proposal. J Virol 41, 1118–1121.[Abstract/Free Full Text]

Wang, C. H., Chou, C. M., Liu, H. C., Kau, S. L., Kou, G. H. & Lo, C. F. (1996). Continuous cell line from pupal ovary of Perina nuda (Lepidoptera: Lymantriidae) that is permissive to nuclear polyhedrosis virus from P. nuda. J Invertebr Pathol 67, 199–204.[CrossRef][Medline]

Wheeler, D. L., Church, D. M., Federhen, S., Lash, A. E., Madden, T. L., Pontious, J. U., Schuler, G. D., Schriml, L. M., Sequeira, E. & other authors (2003). Database resources of the National Center for Biotechnology. Nucleic Acids Res 31, 28–33.[Abstract/Free Full Text]

Wu, C. Y. & Wang, C. H. (2005). Characterization and polyhedrin gene cloning of Lymantria xylina multiple nucleopolyhedrovirus. J Invertebr Pathol 88, 238–246.[CrossRef][Medline]

Wu, C. Y. & Wang, C. H. (2006). New cell lines from Lymantria xylina (Lepidoptera: Lymantriidae): characterization and susceptibility to baculoviruses. J Invertebr Pathol 93, 186–191.[CrossRef][Medline]

Xing, K., Deng, R., Wang, J., Feng, J., Huang, M. & Wang, X. (2005). Analysis and prediction of baculovirus promoter sequences. Virus Res 113, 64–71.[CrossRef][Medline]

Yang, S. & Miller, L. K. (1998). Control of baculovirus polyhedrin gene expression by very late factor 1. Virology 248, 131–138.[CrossRef][Medline]

Yang, S. & Miller, L. K. (1999). Activation of baculovirus very late promoters by interaction with very late factor 1. J Virol 73, 3404–3409.[Abstract/Free Full Text]

Yeh, S. C., Lee, S. T., Wu, C. Y. & Wang, C. H. (2007). A cell line (NTU-MV) established from Maruca vitrata (Lepidoptera: Pyralidae): characterization, viral susceptibility, and polyhedra production. J Invertebr Pathol 96, 138–146.[CrossRef][Medline]

Received 21 February 2008; accepted 5 May 2008.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Y.-R.
Right arrow Articles by Wang, C.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Y.-R.
Right arrow Articles by Wang, C.-H.
Agricola
Right arrow Articles by Chen, Y.-R.
Right arrow Articles by Wang, C.-H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS